AE BB DB Explorer


Action:
Author:
Search Terms (separate with commas, no spaces):


form_srcid: dnmlthr

form_srcid: dnmlthr

form_cmd: view_author

Your IP address is 23.20.149.27

View Author detected.

view author posts with search matches:

Retrieve source record and display it.

form_author:

form_srcid: dnmlthr

q: SELECT AUTHOR, MEMBER_NAME, IP_ADDR, POST_DATE, TOPIC_ID, t1.FORUM_ID, POST, POST_ID, FORUM_VIEW_THREADS from ib_forum_posts AS t1 LEFT JOIN (ib_member_profiles AS t2, ib_forum_info AS t3) ON (t1.forum_id = t3.forum_id AND t1.author = t2.member_id) WHERE MEMBER_NAME like 'dnmlthr%' and forum_view_threads LIKE '*' ORDER BY POST_DATE ASC

DB_err:

DB_result: Resource id #4

Date: 2008/03/22 04:20:36, Link
Author: dnmlthr
Quote (Richardthughes @ Mar. 22 2008,00:46)
UD finally gets a communique from Tardquarters:
http://www.uncommondescent.com/expelle....reening

I'm fairly new to this game, but are DI "press releases" always this filled with hyperbole, downright lies and sweet sweet tard?

Date: 2008/03/22 05:28:13, Link
Author: dnmlthr
[quote=William Dembski]
Leo Stotch: The derision is not over his coming over to the ID side; the derision is over his saying the origin-of-life problem admits a solution by hyper-intelligent aliens bringing about life on earth (yes, this is an ID option) and then turning around and saying God is a completely whacked out solution to the same problem.
[/quote]

If anyone needed any further proof that Dembski simply doesn't understand or want to understand the distinction between naturalistic and supernatural explanations, enjoy.

/dnmlthr, stuck in moderation

Date: 2008/03/23 04:11:02, Link
Author: dnmlthr
When your primary pseudoscience just doesn't have the kick it used to have, it's time to move on to perpetual motion. Wow.

 
Quote

bFast, 03/22/2008 11:53 pm

iPod, this is an interesting experiment. It seems clear that radio waves, which is what he’s bombarding the water with, can separate the salt water into hydrogen and oxygen. What has not been demonstrated is that the output is greater than the radio-frequency energy put in. As such would be quite a breakthrough, if it had been confirmed, we would have heard. Unless of course the oil companies got there first and made this marvel go away like all of the others. Are you familiar with the pogue carburater? It too can win the green car X prize in a stock ‘65 Ford Mustang.


(emphasis mine)

Date: 2008/03/23 04:32:27, Link
Author: dnmlthr
The link for the above comment is http://www.uncommondescent.com/science/water-power/#comment-190085

Date: 2008/03/23 18:24:49, Link
Author: dnmlthr
http://www.uncommondescent.com/intelli....us-more

O'Leary has managed to squeeze in no less than 4 links to her ever growing link farm today.

She writes:
Quote
One blogger found himself expelled for even writing about the Expelled film.

In this context being "expelled" apparently means "receiving e-mail and comments". The malicious atheist conspiracy is really getting desperate!

Date: 2008/03/24 02:45:25, Link
Author: dnmlthr
O'Leary isn't much for substantiating her claims it seems.

http://post-darwinist.blogspot.com/2008....ry.html

 
Quote

Now, if we want a model for how to address design in the universe, we might begin by looking at hw[sic] the Big Bang (an obviously creationist theory) is addressed: ...


Nowhere in the text is the obvious creationist slant of the big bang theory explained. No mechanism for "addressing design" regarding the big bang is proposed either.

I guess if you can disregard evidence, logic and the pathetic level of detail real scientists have to deal with, taking on cosmology as a side project is no big deal!

Date: 2008/03/24 13:36:14, Link
Author: dnmlthr
Undergrad, CS. Black belt in smack talk.

Date: 2008/03/24 16:34:28, Link
Author: dnmlthr
http://www.uncommondescent.com/intelli....-190348

Poachy breaks out the tardfoil hat:

Quote

Quote

This doesn’t bode well for Myers’ upcoming tenure review. If enough of his peers start viewing him as a liability to science and the University of Minnesota then they’ll give him the bum’s rush just as quick as they did Guilliermo Gonzalez.


Don’t get your hopes up. Myers is a leader in the Darwinist movement to suppress any dissent in academia. My guess is he will get tenure because he will unleash the hounds of war on anyone who stands in his way. He probably has the entire University of Minnesota power structure dancing to whatever tune he calls.

Date: 2008/03/25 11:33:09, Link
Author: dnmlthr
Quote (Richardthughes @ Mar. 25 2008,17:28)
DaveTard. Had "bad information".


Since he seems to be sitting on his primary source of information, perhaps he's just in need of some colon cleansing?

Date: 2008/03/25 14:57:28, Link
Author: dnmlthr
Quote (Lou FCD @ Mar. 25 2008,19:05)
Given the source from whence comes his information, there's definitely a slot being violated whenever he types, but it has nothing to do with thermodynamics.


Please let me know if I'm way out of line posting this, but whenever I read something DaveScot has written, I cannot help but to hear it narrated by this guy: http://www.liveleak.com/view?i=28a_1198988249

 
Quote
Look at this irreducible complexity man, have you ever seen this much irreducible complexity on a man before? Oh yeah

Date: 2008/03/26 14:09:22, Link
Author: dnmlthr
Considering his "Ilse, She-Wolf of the SS" fetish, here's one:

"Sparta preceded Darwin with over 2000 years, yet their contemporaries wrote of them practicing eugenics. Did Darwin have a time machine and if so, do you find it plausible that oiled and muscled macho men (and women) would take advice from a victorian gentleman?"

Date: 2008/03/26 14:20:04, Link
Author: dnmlthr
That would be Ilsa, She-Wolf of the SS.

I don't seem to be able to edit my posts. Either through incompetence (likely!) or the way the board is configured. Considering the willingness of cdesign proponentsists to blackhole I can understand the reasoning for the latter however.

In all seriousness, I think the Sparta connection is interesting, because whether or not they actually practiced eugenics, their contemporaries at the very least knew of the idea.

Date: 2008/03/27 15:25:35, Link
Author: dnmlthr
Quote (BCtheEra @ Mar. 27 2008,21:13)
 
Following up on my previous post, apparently my seemingly innocuous comment was found lacking.  Do you think they use the EF for moderation at UD?


That would explain alot since the moderation process appears to find intelligence where there is none.

Date: 2008/03/30 14:22:04, Link
Author: dnmlthr
Richardthughes: Sal sure loves to reuse debunked old crap
http://www.youngcosmos.com/blog/archives/233

Quote

For starters, Tipler observes that the Shroud of Turin has DNA on it consistent with an XX male, which would suggest a virgin birth! He has some other really cool ideas for examining the rocks near the tomb of Jesus for traces of specific kinds of sub-atomic events.


As for the "neurotic obsession for truth" claim, perhaps we are seeing relativistic effects due to the proximity of a major "the argument regarding design"-well?

Date: 2008/03/31 11:48:34, Link
Author: dnmlthr
Classic internet tough guy syndrome.

I hate to liken the IDiots to such a cool animal as the wombat, but don't be surprised if logic starts speaking with an australian accent

Date: 2008/04/01 14:47:00, Link
Author: dnmlthr
Dinesh D´Souza has few friends over at UD it seems

Quote

What an incredible comparison. D’Souza here gives no evidence of knowing even the rudiments of the debate over ID — he merely repeats the worst propaganda against ID. I encourage anyone who has personal contact with him to provide him with better information. A point of leverage is that D’Souza presumably wants Christians, many of whom support ID, to buy his book.


Or in other words: Fly, fly my minons!

Date: 2008/04/01 15:02:41, Link
Author: dnmlthr
JPCollado writes:

Quote

D’Souza:
Quote

Why has the ID legal strategy proven to be such a failure, even at the hands of conservative judges?


Conservatism has nothing to do with it since there are Atheists that are conservative. Dinesh should know better.


All science so far!*

* Hope you don't mind me stealing this fabulous phrase.

Date: 2008/04/02 01:49:30, Link
Author: dnmlthr
Quote (dogdidit @ April 02 2008,04:05)
Not only haven't they discovered shit, they heap scorn and abuse on others who actually have. WHAT an inferiority complex.

DaveTard has discovered how to breathe through the nose and type, angrily, at the same time. Should count for something, right?

Date: 2008/04/02 05:42:56, Link
Author: dnmlthr
Louis: Martial arts can indeed be great fun, personally I enjoy kick boxing and boxing.

I disagree with the preferable (Rincewind) way of handling melee though, 400 yard dash seems to me like the best martial art for most situations.

Date: 2008/04/04 16:00:12, Link
Author: dnmlthr
Apparently only unattractive people can be transgendered. Who knew?

Quote

Remember the pregnant He/She I I told you about?

Check out this article that shows pictures of him when he was a she.

Holy cow, she was absolutely stunning, and in beauty pagents no less.

That's . just . crazy.!!


She's really unable to understand the basic fact that we all don't share the same experiences.

Date: 2008/04/17 18:08:41, Link
Author: dnmlthr
Guess the type of area that I live in...

We have:
- Rats of all shapes and sizes, with some really big ones every now and then
- Rabbits AKA rats with big ears
- Pigeons AKA rats with wings
- Too few dogs and definitely too few cats

Date: 2008/04/18 06:28:34, Link
Author: dnmlthr
A positive review of Crossroads Expelled!

Quote

Although I have friends that vigorously debate with me on this, I just can’t get away from how plainly the first chapter of Genesis describes how everything began…and I believe it. Because I’m a scientist? No. I wasn’t even that good at science. I believe it because the Bible says it.


Bolding mine.

All science so far.

Date: 2008/04/19 07:14:04, Link
Author: dnmlthr
Quote (Annyday @ April 19 2008,12:54)
Wow. Does even Sal have limits?

Nah, he just nixplained it.

Date: 2008/04/20 13:13:20, Link
Author: dnmlthr
Erasmus: Let's just say that by swedish standards it's an urban area. However, I came back from a week in New York a week ago, so it has a certain rural charm about it that I didn't notice two weeks ago.

Date: 2008/04/20 16:58:24, Link
Author: dnmlthr
Quote (Reciprocating Bill @ April 20 2008,22:47)

Can't say I saw anything like this coming.

To be honest, it doesn't feel like he did either. At any rate, good for him, even if it would turn out to be temporary.

Date: 2008/04/22 13:18:48, Link
Author: dnmlthr
Risking to show full frontal ignorance, and pretending they'll actually get around to do research, I wonder what they'll use for a noise source. A regular pseudo random number generator wouldn't do. If they build a noise source, wouldn't the result by definition be generated by an intelligence?

Can Dr. Dr. build a noise source so random that not even he can infer design from it?

Date: 2008/04/22 13:21:52, Link
Author: dnmlthr
I write like crap.

Can Dr. Dr. build a noise source so random that not even he _hisself_ can infer design from it?

Date: 2008/04/22 13:24:24, Link
Author: dnmlthr
Quote (carlsonjok @ April 22 2008,13:16)
 
Quote (ERV @ April 22 2008,07:00)
LUV DEH CATS WHERE IS R MAH CAEK????


:P

HA HA THIS IS YOU


The cake is a lie!

Date: 2008/04/23 16:47:33, Link
Author: dnmlthr
Quote (don_quixote @ April 23 2008,22:37)
Chris has finally lost the plot:

Paranoid delusions at The Intersection

Sounds like he's taking the ball and going home.

Date: 2008/04/26 03:41:58, Link
Author: dnmlthr
On another note, I'm fairly confident that we won't reach peak tard anytime soon.

Thus speaketh Fafarman
Quote

The song is a vow of poverty. Yoko Ono should lose all of John Lennon’s copyrights.

Date: 2008/04/28 08:46:50, Link
Author: dnmlthr
Noticed today too, weird. Hopefully it's just a technical screwup and not some policy drone pulling the plug.

Date: 2008/04/29 16:02:50, Link
Author: dnmlthr
Gerry Rzeppa has got to be a sock puppet.

Quote

scordova says, “I am ambivalent to the idea of teaching of ID in public schools…”

Statements like the one above always baffle me. If something is true, or is likely to the true, or is even just a plausible hypothesis, it ought to be passed on to the next generation. Whence this ambivalence?

Do the right thing. Let God handle the consequences.


I mean, why else paraphrase the "Kill them all. God will know his own" quote from the Cathar crusade? Or am I being Poe:d?

Emphasis mine.

Date: 2008/05/05 16:11:19, Link
Author: dnmlthr
Quote (Mr_Christopher @ May 05 2008,22:08)
Mother Teresa, doesn't she have a line of sticky buns or something?

I believe you might be thinking of someone else...

Date: 2008/05/05 16:21:27, Link
Author: dnmlthr
At least Ben and friends has one fan except for FtK

Here's a choice quote from the piece.

Quote

Stein’s critics fail to effectively refute anything in “Expelled”; they just use epithets to ridicule it and hope they can make it go away.


Guess she hasn't found expelled exposed, which is number 7 on google atm. Or Maxwell's demon is working triple shifts, poor guy.

Date: 2008/05/06 01:42:26, Link
Author: dnmlthr
Didymos: As one might have guessed, the comments on that post are tardilicous, bringing out the moldy corpse of the "oh yeah, but you're an atheist, you can't have any morals" canard.

JJCassidy:
Quote

It also doesn’t matter how you treat anything that doesn’t impact your survival. I can imagine that there is more reason for live animal testing under Darwinism, then without it.

To give one example: was it better to be a cow in India with the Hindi, or in Russia with the Bolsheviks?


SeanSean:
Quote

If I’m told that I’m nothing but the result of mindless forces, and that my conception of right and wrong has been found useful by natural selection (hard not to bring in teleology with a name like natural selection), then why the heck should I not murder? Especially if I can get away with it because I have a bigger stick than everyone else.


Emphasis mine.

Date: 2008/05/06 02:04:54, Link
Author: dnmlthr
Dr Dr is now promoting DVDs from Campus Crusade

All science so far!

Date: 2008/05/06 15:34:30, Link
Author: dnmlthr
Quote (Richardthughes @ May 06 2008,20:08)
American beer is like making love in a canoe, Dave.

But sometimes a canoe is exactly what's needed. Like a Brooklyn Lager in the late spring heat.

Date: 2008/05/07 03:16:04, Link
Author: dnmlthr
[Graffiti moved to Bathroom Wall. -Admin]

Quote (BopDiddy @ May 07 2008,02:03)
 
Quote (dnmlthr @ May 06 2008,15:34)
   
Quote (Richardthughes @ May 06 2008,20:08)
American beer is like making love in a canoe, Dave.

But sometimes a canoe is exactly what's needed. Like a Brooklyn Lager in the late spring heat.

Is that code, like a Cleveland Steamer?


Sometimes a beer is just a beer.

Date: 2008/05/07 17:11:01, Link
Author: dnmlthr
DaveScott:

Quote

Just keepin’ it real, homey.


No emphasis needed. Makes you wonder if he's grown tired of the whole spectacle and wants to go out with a bang.

Date: 2008/05/08 15:23:10, Link
Author: dnmlthr
It's quite sad really. I mean, just look at the scanned crumpled scraps of paper with frantic scribblings. Not quite timecube level though.

Date: 2008/05/09 07:36:33, Link
Author: dnmlthr
Quote (didymos @ May 09 2008,07:12)
Back on topic, what the fuck is Dr. Dr.'s point?

Bitterness? With so many ID supporters showing their true creationist bible-thumping colours, amplified by the Expelled fallout, his "it's science, honest" schtick looks even sillier, if such a thing is possible.

What use is he for the rest of the creationist camp if he cannot even superficially maintain the illusion of scientific respectability that their current strategy relies upon? On the other hand, is he willing to alienate the people buying his books by going head to head with them in an effort to maintain that illusion?

I'm probably reading way too much into this.

Date: 2008/05/13 00:45:24, Link
Author: dnmlthr
O'Leary flogs the "tenure is a human right!" horse over at her link farm.

Quote

Anyway, Mustafa knows the Istanbul scene pretty well, and it seems safe to say that that Yahya's case is more like Kent Hovind's (American creationist jailed on tax fraud charges) than Guillermo Gonzalez's.


Emphasis mine.

Date: 2008/05/14 14:54:37, Link
Author: dnmlthr
Quote (Richardthughes @ May 14 2008,18:02)
You don't have to be a complete Tard to be a DI fellow, but it helps...

http://scienceblogs.com/pharyng....ing.php

Actually, you do have to be a world class Tard.

The scariest words imaginable.

Quote

Hello, I'm Dr Egnor and today I will be operating on your brain

Date: 2008/05/20 07:52:07, Link
Author: dnmlthr
Quote (Reciprocating Bill @ May 20 2008,12:21)
Quote (stevestory @ May 20 2008,03:01)
http://www.uncommondescent.com/intelli....-288928

     
Quote
19 May 2008
The Expelled film: Straws in the wind, and other news
O'Leary

...
I wonder if ID bashers are hoping that readers will not realize that Behe WASN’T expelled.


Goddamit, learn to write more better! You're the worst journalist in the world.

Parsing....parsing....parsing....parsing....

Ok. I think MAYBE I know what she said.

Hot damn, that was near indecipherable.

Why would "ID bashers" want people to think Behe had been expelled? Expelled from something other than a crappy movie that is.

Not even her straw men make any sense.

Date: 2008/05/21 14:58:10, Link
Author: dnmlthr
And the EF is merely cognitive dissonance in an oh so precious sailor costume.

Date: 2008/05/21 15:37:39, Link
Author: dnmlthr
Quote (Richardthughes @ May 21 2008,21:30)
Even betterer:
Granny Spice:
http://www.uncommondescent.com/intelli....-289086

 
Quote
24
O'Leary
05/21/2008

3:09 pm
Barry, are you saying that ratios might be more achievable than absolute numbers? ....


WOW.

http://en.wikipedia.org/wiki/Ratio

Funny how all these ratios use two absolute numbers. Get back to knitting, Denyse.


Perhaps she's more into irrational numbers?

Date: 2008/05/23 03:00:27, Link
Author: dnmlthr
The A-Team goes for broke

 
Quote

cdesign proponentsists have yet to present any falsifying tests on which to judge the merits of their hypothesis and thus cannot fall into the sphere of science. You say there’s a magic leprechaun poofing everything into existence? Then put your money where your mouth is and prove it. That’s not an unreasonable request.

Emphasis mine.

Kairosfocus leaps into action.

Quote

That’s a gross strawman misrepresentation. Similarly, science is not about “proof,” but about empirically anchored inference to best — abductive — explanation.

By contrast, here is a basic def’n of ID by Dr [x2 — Mathematics, and Phil; add’l Masters is in theol] Wm A D:


No emphasis needed.

Edited quoting.
Edited again because I miss things.

Date: 2008/05/27 08:12:19, Link
Author: dnmlthr
Perhaps the tent is becoming even bigger, encompassing any and all forms of denialism and kookiness.

If UD is anything to go by, there are still rich denialism fields to harvest, just not strictly limited to creationism.

Date: 2008/05/31 14:31:14, Link
Author: dnmlthr
Bob O'H: Whiskey tango foxtrot. That's all I've got to say on the topic, except that it's impressive in a way. Just going through with it, including driving people around.

Date: 2008/05/31 15:23:46, Link
Author: dnmlthr
Quote (Arden Chatfield @ May 31 2008,20:33)
Quote (Bob O'H @ May 31 2008,12:12)
Giant vagina bicycle taxi

Best. Band. Name. Evar.

Mind if I call dibs? Started playing with a new bunch of people this afternoon, in a band yet to be named.

Date: 2008/06/02 10:35:48, Link
Author: dnmlthr
I call Poe on this one

Right up there with the Ray Comfort's banana.

Date: 2008/06/02 17:23:18, Link
Author: dnmlthr
You're right.

Must be all those VenomFangX videos that have left me unable to distinguish parody from the real deal...

Date: 2008/06/03 16:39:09, Link
Author: dnmlthr
Quote (Ftk @ June 03 2008,22:15)
 
Quote (midwifetoad @ June 03 2008,15:59)
 
Quote
Many are desperate and very emotionally spent due to their situation.  Sometimes a person will latch on to anything that they think might help their child or keep another child from suffering as their own has.


All the more reason to be careful to avoid quackery.

I believe I started my exchange with you by asking for some evidence that mainstream public health isn't studying the effects -- including unwanted effects -- of vaccination.

Why would you want that?  I didn't say they weren't.  I was merely telling some of the posters here that their dogmatic anti-vaxxing stance may not be completely justified and that they should remain open minded as there still seems to be some studies being done on the subject.

The anti-vaxer stance is wholly untenable. Period. They have no evidence at all. They do, however, cause people to get infected with PREVENTABLE YET DEADLY DISEASES because of a non-existing link between vaccines and autism. If that's not evil I don't know what is.

I didn't mean to get confrontational, but  I'm a wee bit irritable because the math institution at my university have lost another if my finals. This makes two in a row, no joke.

Date: 2008/06/03 17:13:10, Link
Author: dnmlthr
Quote (Ftk @ June 03 2008,22:56)
Quote
I didn't mean to get confrontational, but  I'm a wee bit irritable because the math institution at my university have lost another if my finals. This makes two in a row, no joke.


That sucks...sorry to here it.  My husband had a similiar problem during college when his department was making some changes in office procedure.  A bunch of stuff was screwed up and lost, and he ended up having to take a couple extra courses after graduation because they said they didn't have enough hours documented for him.  If was a screwed up mess.

That wasn't my real point, just a cheap and cowardly cushioning of a possibly angry-sounding post. My real point was that the anti-vaxers don't have anything to stand on.

Edit: More honesty.

Date: 2008/06/05 12:51:27, Link
Author: dnmlthr
Quote (carlsonjok @ June 05 2008,18:48)
WmAD is pissed!!
     
Quote
Colorado Governor Bill Ritter’s signing of a transgender anti-discrimination bill points up the lunacy that ensues in a world without design

Great, just great! The cross-dressers can now eat in the Baylor cafeteria and he still can't.  And, to add insult to injury, he can't make fun off them anymore, either.  Damn liberals! Always screwing up his fun!

Hey, at least he acknowledges that the world isn't designed.

Date: 2008/06/09 10:27:53, Link
Author: dnmlthr
Currently reading Road to Reality by Roger Penrose, but making slow progress. It's not exactly a book you just zip through on a lazy summer day.

Date: 2008/06/09 14:29:56, Link
Author: dnmlthr
Quote (Ftk @ June 09 2008,20:19)
Quote
And no, I can't come up with anything better than that. That's it.


WOW..  That's what I thought.  It's purely meaningless except in regard to seeking ultimate truth.  

It has no impact on a scientist's daily routine other than if he starts up a conversation about his thoughts in regard to truth and the meaning of life.

O RLY? So studying retroviruses common to humans and other mammals is useless then?

Care to venture a guess as to why humans and other mammals have retroviruses in common by the way?

Because "common design" by way of viruses injected into the genome sounds mighty sinister to me.

Date: 2008/06/09 14:38:48, Link
Author: dnmlthr
Quote (J-Dog @ June 09 2008,20:02)
   
Quote (dnmlthr @ June 09 2008,10:27)
Currently reading Road to Reality by Roger Penrose, but making slow progress. It's not exactly a book you just zip through on a lazy summer day.

Perhaps you could send that to FTK when you're finished?

(We could probably take up a collection here to reimburse you for the expense.)

Haha, actually I like to keep books of this nature when I'm done with them (it's just a scruffy paperback anyway). In any case, I doubt she'd waste more than 5 minutes on it anyway.

Quote (midwifetoad @ June 09 2008,20:22)

I hope that road doesn't traverse too many miles through the Emperor's Mind.

Are you refering to his more speculative chapters?

Edit: There's at least not a chapter dedicated to his ideas on cognition, of which I have read absolutely zilch. I somehow misread your comment into a permutation of the emperor's new clothes.

Date: 2008/06/09 15:04:45, Link
Author: dnmlthr
Quote (Ftk @ June 09 2008,20:19)
My goodness, are you familiar with creation science?

If you by creation science mean the dead ends of flood geology, T-Rexes eating coconuts and whatever else Ken Ham is up to these days, then I guess I am familiar with it.

 
Quote (Ftk @ June 09 2008,20:19)

In what way would a creationist not be able conduct research in this area merely because he adhere to common design???

Well, one problem would be not having a known mechanism to work with. Saying "goddidit" and leaving it at that doesn't exactly open up new avenues of research. For some reason the verses on molecular biology must have been expelled during the first council of Nicaea.

Quote (Ftk @ June 09 2008,20:19)

Quote
Care to venture a guess as to why humans and other mammals have retroviruses in common by the way?

Common design.  Mutations that have a negative affect on mammals.  They break down the system, not build it up, btw.

Lactose tolerance is a good thing, isn't it? If you're not into the dairy industry (vegan perhaps?), then perhaps HIV immunity might be considered a good thing?

Edit: Fixed renegade quote tags.

Date: 2008/06/09 15:30:58, Link
Author: dnmlthr
Quote (Ftk @ June 09 2008,21:22)
The other part is because COMMON DESCENT IS A FREAKING UNSUBSTANIATED INFERENCE, and a mightly questionable one at that.

Only unsubstantiated if you disregard all the existing lines of evidence. The molecular evidence alone is astounding.

Date: 2008/06/09 16:34:39, Link
Author: dnmlthr
Quote

Perhaps you can give me some good examples.


I have already given you two examples of positive human (and thus mammalian) mutations. Lactose tolerance and HIV immunity.

Besides, since you concede "microevolution", how would that work if all mutations were deleterious?

Date: 2008/06/11 10:11:33, Link
Author: dnmlthr
Quote (Richardthughes @ June 11 2008,14:53)
The strongest Tard in the universe:

http://www.uncommondescent.com/intelli....gravity

But has he seen a graviton?


I love the smell of a straw man in the morning.

Date: 2008/06/11 17:00:37, Link
Author: dnmlthr
Quote (Kristine @ June 11 2008,22:48)
I think Behe should never shut up. He came so close in Dover to redefining design as mainstream evolution, and now he's essentially claiming that an instance of demonstrable evolution is design. Way to go, man. No wonder they didn't include you in 'Xpelled. You're not exactly helping design, Behe.

He's just deep under cover. Donnie Behesco if you will.

Date: 2008/06/12 08:28:05, Link
Author: dnmlthr
FTK, in all earnestness, I am troubled by your fandom of a guy who without flinching claims that you should be disenfranchised. Regardless of our mutual disagreements, noone deserves such a crappy idol.

Now, how about these statements that you've made earlier in this thread.

1. There are only deleterious mutations in mammals
2. (Micro-)evolution works

We know number one to be false, we just need to look to HIV resistance and lactose tolerance in humans to see that. But as a thought experiment, how would such a system work? And how does the thought experiment compare to the actual physical reality that we live in?

Date: 2008/06/12 09:24:29, Link
Author: dnmlthr
Quote (Ftk @ June 12 2008,15:07)
Of course.  I've never argued that there are not any lateral mutations that benefit an organism.  I'm saying that they are very few and far between, they are ~relatively~ non-existent, and that they are the result of massively complex systems already fully functional.

Only a few pages back you said the following:

Quote

Common design.  Mutations that have a negative affect on mammals.  They break down the system, not build it up, btw.

Date: 2008/06/12 18:39:10, Link
Author: dnmlthr
Quote (C.J.O'Brien @ June 13 2008,00:36)
Jon, I was there. The actual posts by Walt Hizzownself definitely did not number over 20. It consisted almost entirely of short sections of the book being posted by FTK followed usually by ten or twenty more or less devastating replies. The best and most substantive were overkill (Wally's not really armed, you understand), but I actually used to have the thread bookmarked because it had so many links that were useful in combatting all sorts of Young Earth TARD.

Good times...

Makes me wish I was around. I mean, I was around, just not around here.

Date: 2008/06/12 18:45:59, Link
Author: dnmlthr
UD vs gravity, in a nutshell

Rarely has a youtube clip felt so appropriate.

Date: 2008/06/13 01:48:34, Link
Author: dnmlthr
Quote (Bob O'H @ June 13 2008,07:27)
(now, if only I had a spangly little graphic to illustrate this)

Date: 2008/06/13 16:23:58, Link
Author: dnmlthr
The comments on the Amazon page seem pretty sane so far. Expect influx of O'Learyisms in 3... 2... 1...

Considering hisselves own words on the target audience, here's my guess on its contents, page by page.

1. Cover
2. This page intentionally left blank
3. Goddidit
4. Buy my book

Date: 2008/06/14 16:06:37, Link
Author: dnmlthr
Thank you, thank you. A week late, but I appreciate the gesture.

Date: 2008/06/15 00:40:04, Link
Author: dnmlthr
Quote (Lou FCD @ June 15 2008,01:21)

Apologies, I try to check every day, but I'm senile or something.  I forget exactly.

I probably should've put a smiley in there somewhere, seeing as I haven't filled out a birth date in my profile.

Quote (Lou FCD @ June 15 2008,01:21)

Plus, I'm a little put off by your vowel-bigotry.

It's either that or get put off by the fact that it (the name that is) comes from a fairly crappy Saxon song.

Date: 2008/06/15 10:15:01, Link
Author: dnmlthr
Quote (oldmanintheskydidntdoit @ June 15 2008,11:07)
In keeping with such delusion Sal also proudly announces a pro-ID film studio.
       
Quote
To get a flavor of the changes happening, visit this radically pro-ID film studio which had its unveiling at the Cannes Film Festival. See http://www.IJNP.org

INJP?

Oh, so ID is nothing to do with Jesus? Ok Sal, thanks for proving that again!


Figures. If you talk science with Sal you're bound to be Christrolled sooner or later.

Date: 2008/06/17 14:18:52, Link
Author: dnmlthr
Quote (Bob O'H @ Mar. 17 2008,19:18)
 
Quote (Lou FCD @ Mar. 17 2008,12:43)
How 'bout this instead?

Or this?

Dave for Teh Win!!!onetyone!!!!

This made me damn near spill my wine

And no, it's not a euphemism.

Date: 2008/06/17 17:41:34, Link
Author: dnmlthr
Quote (carlsonjok @ June 17 2008,23:37)
Oh, and about Poachy?

*raises hand sheepishly*

Thank you! It was a damn good run.

Date: 2008/06/18 18:12:47, Link
Author: dnmlthr
Wrong place to post this I guess, just need to vent.

Today sweden passed a law that not only allows a government agency to intercept any landbased communications that crosses the border, but requires internet and telephone providers to route their traffic through what's in the bill is called (I shit you not) "cooperation stations".

Complete and utter failure.

I'm pissed. And slightly inebriated. But mostly pissed.

Date: 2008/06/19 11:11:57, Link
Author: dnmlthr
Arsle is swedish for "ass". Good ol' Andy's username is Aschlafly.
Ass-fly?

Date: 2008/06/20 02:44:29, Link
Author: dnmlthr
Sal Cordova and BA77 are competing for daddy's Dembski's affection.

Sal Cordova
 
Quote

 
Quote

Bornagain77:
   Dr. Dembski,
   I bet you never thought, when you entered this field, that you would have to master psychology as well.


The first of Dr. Dembski’s many degrees was in psychology.


Bornagain77
 
Quote

Scordova,
It figures, just as underestimating the complexity that is being found in the cell has been the source of my biggest mistakes in understanding ID, so to, it would go to reason, never to underestimate one of the leading teachers of ID.


Except, of course, that Dembski haven't had a class in how many years? A teacher without students and a theory without any evidence, sounds like a good fit.

Edited to fix spelling.

Date: 2008/06/22 03:33:24, Link
Author: dnmlthr
If it is your birthday, congratulations!
Edit: I cannot read, apparently.

Date: 2008/06/22 09:06:05, Link
Author: dnmlthr
aldrinexy's solution to the predicament of one's children actually learning something about the world depresses the hell out of me.

 
Quote

teaching your son to have strong and unwavering faith will solve and answer the predicament.

Date: 2008/06/26 16:14:38, Link
Author: dnmlthr
Quote (Ftk @ June 26 2008,22:11)
Quote
Nice... I signed it with the sockpuppet name so that you could put the two names together.


:O You. liar.  I cannot believe you have the audacity to lie about this.

Yes, yes of course. It was all an insidious plot, which is why he used his own e-mail address and not a fake one. Because it takes such a long time to get a fake e-mail address, what with the sky rocketing hotmail tax and all.

Date: 2008/06/26 17:12:25, Link
Author: dnmlthr
Quote (Lou FCD @ June 26 2008,23:10)
Quote (skeptic @ June 26 2008,18:07)
P.S., your daughter is right, that's a pretty awesome place.

She often is.  I haven't been yet, and I'm a little jealous.

Right?

Badum-tssch

Date: 2008/06/27 14:54:16, Link
Author: dnmlthr
For a long time I, a mere engineering student and washout from the software industry, tried to engage the likes of ftk in a friendly and understanding manner. I even felt more sorry for Dembski than anything else.

As of late, I feel that ambition waning more and more due to the dishonesty and frankly bullshit tactics employed by the pro-tard faction. Tard burnout? Quite possibly. Some people just seem impervious to reason and logic and I find it harder and harder to maintain a friendly demeanor towards disseminators of bullshit.

At any rate, I find this place a refuge where bullshit is confronted head on with a suitable side dish of sarcasm and scorn, as is sorely needed, even if I lurk way more than I engage.

Hugs and kisses,
dnmlthr

Date: 2008/06/27 15:09:44, Link
Author: dnmlthr
I have listened religiously (see, not atheist on a daily basis) to Neurosis for the last couple of months.

Here's a live performance of Locust Star from Ozzfest (ha!) a few of years ago: http://www.youtube.com/watch?v=fmdmnnv2NkY

Unlike most "hard" acts, they have kept getting better as they age.

Date: 2008/06/29 12:32:39, Link
Author: dnmlthr
Talk about flood geology.

Edit: Fixed syntax.

Date: 2008/06/29 15:27:19, Link
Author: dnmlthr
Quote (Reciprocating Bill @ June 29 2008,21:03)
What WAD wants is a warranty, not a guarantee. There's a form in the back of his bible he is supposed to complete and send in.

Guess he missed the sticker that said "warranty void if opened".

Date: 2008/06/30 17:09:12, Link
Author: dnmlthr
+1 for paranoia though, that was a nice touch.

Date: 2008/07/01 11:53:14, Link
Author: dnmlthr
The move has at least been beneficial to the typography of bad astronomy. I wonder if the move will bring any difference to the content.

Edit: Lessened suckitude of language.

Date: 2008/07/01 15:40:56, Link
Author: dnmlthr
Quote (Ra-Úl @ July 01 2008,20:39)
 
Quote (Lou FCD @ July 01 2008,14:11)
   
Quote (Ra-Úl @ July 01 2008,15:04)
The 'lunar craters were caused by a battle between Satan and the Angels' is a classic for the ages, with a lovely and admirably executed 180 by Dave; when a poster quoted one of Dave's beloved creo sources as having said that, Dave said "knee slapper", only to say this a few posts later: "Wow. I stand corrected. He DID write that on pp 66-67. Yes, I have the book. Amazing. I do see where he's coming from now though and I can follow his logic although I think it would be an impossible to theory to validate until we get to Heaven and ask God in person." Thomas Pynchon could not invent this guy.

Ra-Ul

LINK DAMN IT!  HAVE YOU NO HEART????

So sorry. I thought I had :
http://www.talkrational.org/showthread.php?t=3315

Wow. I'm at a loss for words. If there is a better example around of submission to perceived authority I'd love to see it.

Wait a minute, no I wouldn't. That's just sad.

Date: 2008/07/01 16:10:01, Link
Author: dnmlthr
Quote (carlsonjok @ July 01 2008,20:55)
Has he promised to pray for us yet?  If not, I hope he does so very soon. The way he has batted you Darwinoids around has me sunk into a existential morass and I have chores to do this afternoon.  I'd hate to chance my immortal soul out on the highways and byways if he hasn't offer supplications in my name to God.


HA HA, this is you.

Date: 2008/07/02 13:59:58, Link
Author: dnmlthr
Quote (midwifetoad @ July 02 2008,19:58)
Quote
Yes.  It's called "Your blog".


Odd. "My Blog" mostly just links to your stuff. One should be careful before stepping onto the Möbius link.

Are you saying that the two of you equal one Denyse O'Leary?

Date: 2008/07/05 10:32:36, Link
Author: dnmlthr
An award - "the golden crocoduck" - has been announced by youtuber potholer54 on his new youtube channel Potholer54debunks, to be awarded annually on october 28 to the most audacious lie told by a creationist.

The announcement and channel introduction can be found here

Since they all keep recycling their arguments, will he award the originator or the most strident proponent?

Date: 2008/07/05 10:34:33, Link
Author: dnmlthr
Quote (Peter Henderson @ July 05 2008,15:27)
Who's P Taylor ???? It's not this P Taylor by any chance ???:

http://www.justsixdays.co.uk/wordpress/index.php

In case anyone hasn't reaslized from his blog, this P Taylor is AiG (UK)'s media officer, i.e.second down from CEO Monty White. It can't be the same one surely ?

Now that would be hilarious!

Date: 2008/07/05 14:34:01, Link
Author: dnmlthr
Quote (Bob O'H @ July 05 2008,17:47)
Can sockpuppets enter the competition?

Not that I'm suggesting anything, you know.

Can you out-tard the tardmeisters?

Date: 2008/07/06 05:00:22, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,10:29)
Yeah you creationists are unreliable , you are all no different from creationists.What with your ultra darwinist beliefs, its pathetic.

Then again, there's this pesky little thing called "evidence" that creationists, regardless of what cheap tuxedo they may favor, just seem to lack. Or disregard rather.

Date: 2008/07/06 05:00:22, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,10:29)
Yeah you creationists are unreliable , you are all no different from creationists.What with your ultra darwinist beliefs, its pathetic.

Then again, there's this pesky little thing called "evidence" that creationists, regardless of what cheap tuxedo they may favor, just seem to lack. Or disregard rather.

Date: 2008/07/06 05:08:26, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,11:03)
I have more evidence for my position than you have for the existence of your own brain. Please

Great! It's getting published any day now I take it?
Well, you know where to find this thread when it's time to gloat after you've revolutionized the world of science.

Date: 2008/07/06 05:08:26, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,11:03)
I have more evidence for my position than you have for the existence of your own brain. Please

Great! It's getting published any day now I take it?
Well, you know where to find this thread when it's time to gloat after you've revolutionized the world of science.

Date: 2008/07/06 05:28:25, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,11:23)
You don't know my position? That's pathetic, you're completely ignorant and yet you let this thread continue, pathetic.

What's wrong with making sure your position is not misrepresented? Shouldn't take long.

Date: 2008/07/06 05:28:25, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,11:23)
You don't know my position? That's pathetic, you're completely ignorant and yet you let this thread continue, pathetic.

What's wrong with making sure your position is not misrepresented? Shouldn't take long.

Date: 2008/07/06 05:33:07, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,11:30)
Quote (Alan Fox @ July 06 2008,05:29)
Quote
You don't know my position? That's pathetic,


Your position is pathetic?

Nevertheless, we would like to see you take on oldman. I am curious to discover what the well-dressed emperor is wearing this summer.

No you're post is pathetic.

Are you going to do any actual debating (the points brought forth by oldman seem like a good starting point) or are you going to do the internet tough guy routine in perpetuity?

Date: 2008/07/06 05:33:07, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,11:30)
Quote (Alan Fox @ July 06 2008,05:29)
Quote
You don't know my position? That's pathetic,


Your position is pathetic?

Nevertheless, we would like to see you take on oldman. I am curious to discover what the well-dressed emperor is wearing this summer.

No you're post is pathetic.

Are you going to do any actual debating (the points brought forth by oldman seem like a good starting point) or are you going to do the internet tough guy routine in perpetuity?

Date: 2008/07/06 05:46:29, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,11:43)
refuting, dam you dumbasses can't even implement a simple edit function. How dumb is that?

Editing rights have to be earned.

Date: 2008/07/06 05:46:29, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,11:43)
refuting, dam you dumbasses can't even implement a simple edit function. How dumb is that?

Editing rights have to be earned.

Date: 2008/07/06 06:01:10, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,11:57)
Yes to people who are psycho that would be funny, don't blame me.

Well, since you seem to have changed your position, I think it would be a good thing if you could define your position as it currently stands, in order to get rid of any misconceptions.

Date: 2008/07/06 06:01:10, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,11:57)
Yes to people who are psycho that would be funny, don't blame me.

Well, since you seem to have changed your position, I think it would be a good thing if you could define your position as it currently stands, in order to get rid of any misconceptions.

Date: 2008/07/06 06:12:59, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,12:03)
 
Quote (dnmlthr @ July 06 2008,06:01)
   
Quote (Guts @ July 06 2008,11:57)
Yes to people who are psycho that would be funny, don't blame me.

Well, since you seem to have changed your position, I think it would be a good thing if you could define your position as it currently stands, in order to get rid of any misconceptions.

How in the world could you know I changed my position if you don't even know it? Bizarre.

Earlier in this thread you stated

 
Quote (Guts @ July 06 2008,11:45)
The EF? lol again, you are completely ignorant of my position. The EF is as much of a joke as the assertion that steve can argue scientific topics.


But in a thread on telic thoughts in 2005 you wrote the following.

 
Quote (Guts @ May 06 2005 on TT)

PvM:
 
Quote

These statements combined with the admission that false positives are possible make the EF useless. For example, assume that ID had presented a clear case of an EF applied to infer design, how would we know that it had not forgotten a particular hypothesis?

No it doesn't, it just makes the EF fallible, and not perfect, like most sciences. If the EF detects an object as designed, and but we find out it actually evolved, then you can say that it's not reliable. But that hasn't happened yet. Pointing to the possibility that it might happen doesn't render it useless at all.


How is that not changing your position? Now do you understand why there might be some confusion regarding your position?

Date: 2008/07/06 06:12:59, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,12:03)
 
Quote (dnmlthr @ July 06 2008,06:01)
   
Quote (Guts @ July 06 2008,11:57)
Yes to people who are psycho that would be funny, don't blame me.

Well, since you seem to have changed your position, I think it would be a good thing if you could define your position as it currently stands, in order to get rid of any misconceptions.

How in the world could you know I changed my position if you don't even know it? Bizarre.

Earlier in this thread you stated

 
Quote (Guts @ July 06 2008,11:45)
The EF? lol again, you are completely ignorant of my position. The EF is as much of a joke as the assertion that steve can argue scientific topics.


But in a thread on telic thoughts in 2005 you wrote the following.

 
Quote (Guts @ May 06 2005 on TT)

PvM:
 
Quote

These statements combined with the admission that false positives are possible make the EF useless. For example, assume that ID had presented a clear case of an EF applied to infer design, how would we know that it had not forgotten a particular hypothesis?

No it doesn't, it just makes the EF fallible, and not perfect, like most sciences. If the EF detects an object as designed, and but we find out it actually evolved, then you can say that it's not reliable. But that hasn't happened yet. Pointing to the possibility that it might happen doesn't render it useless at all.


How is that not changing your position? Now do you understand why there might be some confusion regarding your position?

Date: 2008/07/06 06:36:54, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,12:34)
So I've made no kind of point, and yet, this thread is more than 10 pages long, and accusations abound.  That requires professional attention from psychiatrists, I will demonstrate this in the comming weeks.

Why wait?

Date: 2008/07/06 06:36:54, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,12:34)
So I've made no kind of point, and yet, this thread is more than 10 pages long, and accusations abound.  That requires professional attention from psychiatrists, I will demonstrate this in the comming weeks.

Why wait?

Date: 2008/07/06 13:10:35, Link
Author: dnmlthr
Albatrossity: Actually, I think he had 20-30 or so posts under his belt prior to his latest visit, bringing his latest spree to 60-70 or so.

Date: 2008/07/06 13:10:35, Link
Author: dnmlthr
Albatrossity: Actually, I think he had 20-30 or so posts under his belt prior to his latest visit, bringing his latest spree to 60-70 or so.

Date: 2008/07/06 13:22:42, Link
Author: dnmlthr
Quote (lcd @ July 06 2008,19:09)

One thing though.  I can't help but note what I'd call a double standard here.  First, Newton came up with "Classical Physics".  Now science took that as truth for what, 300 years?  Then we had Relativity.  Now it's Quantum Physics.  So what about GUT?  I keep reading where they say it exists but nobody can find it.

I'm sure I'll get flamed for this, but Dembski's EF seems to be a great start, the "Classical Theory" also known as the first step.  Why must ID be perfect the first time when mainstream science still hasn't gotten it right?

lcd: Classical physics is still usable, more than anything else it's a matter of scale. Neither relativity nor QM have replaced newtonian physics for day-to-day* stuff that goes on on the surface of the planet. As for grand unified theories, work is being done, but who knows where it will lead?

The EF, on the other hand, has yet to produce any testable predictions at all.

Edit:
Contrast that with the theory that they're not trying to augment (see examples above) but completely supplant, which is in use every single day all across the globe.
End of edit.

* I'm sure someone around here uses both on a daily basis, but you get my point.

Date: 2008/07/06 13:22:42, Link
Author: dnmlthr
Quote (lcd @ July 06 2008,19:09)

One thing though.  I can't help but note what I'd call a double standard here.  First, Newton came up with "Classical Physics".  Now science took that as truth for what, 300 years?  Then we had Relativity.  Now it's Quantum Physics.  So what about GUT?  I keep reading where they say it exists but nobody can find it.

I'm sure I'll get flamed for this, but Dembski's EF seems to be a great start, the "Classical Theory" also known as the first step.  Why must ID be perfect the first time when mainstream science still hasn't gotten it right?

lcd: Classical physics is still usable, more than anything else it's a matter of scale. Neither relativity nor QM have replaced newtonian physics for day-to-day* stuff that goes on on the surface of the planet. As for grand unified theories, work is being done, but who knows where it will lead?

The EF, on the other hand, has yet to produce any testable predictions at all.

Edit:
Contrast that with the theory that they're not trying to augment (see examples above) but completely supplant, which is in use every single day all across the globe.
End of edit.

* I'm sure someone around here uses both on a daily basis, but you get my point.

Date: 2008/07/06 15:03:20, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,21:00)
 
Quote

I suspect you imaine you make art every time you make a turd.


No I meant what I said, the accusation was that I don't answer questions, in fact I answer many questions.

Then one more can't be much of a hassle, can it? You've got several earlier in the thread to choose from.

Date: 2008/07/06 15:03:20, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,21:00)
 
Quote

I suspect you imaine you make art every time you make a turd.


No I meant what I said, the accusation was that I don't answer questions, in fact I answer many questions.

Then one more can't be much of a hassle, can it? You've got several earlier in the thread to choose from.

Date: 2008/07/06 15:50:51, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,21:49)
I couldn't possibly have given a more direct answer.

Then I take it you cannot name a single ID prediction that has passed any form of test, which in itself is an answer as good as any I suppose.

Date: 2008/07/06 15:50:51, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,21:49)
I couldn't possibly have given a more direct answer.

Then I take it you cannot name a single ID prediction that has passed any form of test, which in itself is an answer as good as any I suppose.

Date: 2008/07/06 15:55:30, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,21:53)
Quote (dnmlthr @ July 06 2008,15:50)
Quote (Guts @ July 06 2008,21:49)
I couldn't possibly have given a more direct answer.

Then I take it you cannot name a single ID prediction that has passed any form of test, which in itself is an answer as good as any I suppose.

I could name dozens of ID predictions that have passed tests. But there seems to be a fundamental misundersatnding of science and how it is done in this forum.

If that really was the case you could have shut us all up a long time ago. Thanks for playing.

Date: 2008/07/06 15:55:30, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,21:53)
Quote (dnmlthr @ July 06 2008,15:50)
Quote (Guts @ July 06 2008,21:49)
I couldn't possibly have given a more direct answer.

Then I take it you cannot name a single ID prediction that has passed any form of test, which in itself is an answer as good as any I suppose.

I could name dozens of ID predictions that have passed tests. But there seems to be a fundamental misundersatnding of science and how it is done in this forum.

If that really was the case you could have shut us all up a long time ago. Thanks for playing.

Date: 2008/07/06 16:18:04, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,22:16)
Quote

Name the dozens. Show us how science is done. Put up or shut up, since you're supposedly the only scientifically literate one here. Quit dodging the questions.


You didn't even understand what I wrote, thats why you can't respond.

By the way, I only use insults because thats the language that you all speak here. It's the norm. You guys drew first blood.

Stop whining and show us the predictions that you spoke of earlier.

Date: 2008/07/06 16:18:04, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,22:16)
Quote

Name the dozens. Show us how science is done. Put up or shut up, since you're supposedly the only scientifically literate one here. Quit dodging the questions.


You didn't even understand what I wrote, thats why you can't respond.

By the way, I only use insults because thats the language that you all speak here. It's the norm. You guys drew first blood.

Stop whining and show us the predictions that you spoke of earlier.

Date: 2008/07/06 16:23:51, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,22:21)
Quote

I could name dozens of ID predictions that have passed tests. But it's not important, so I won't name any. Now leave me alone, dumbass!"


Where did I say leave me alone?

Again with the dodging.

Quote

I could name dozens of ID predictions that have passed tests. But there seems to be a fundamental misundersatnding of science and how it is done in this forum.


What predictions were you speaking of?

Date: 2008/07/06 16:23:51, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,22:21)
Quote

I could name dozens of ID predictions that have passed tests. But it's not important, so I won't name any. Now leave me alone, dumbass!"


Where did I say leave me alone?

Again with the dodging.

Quote

I could name dozens of ID predictions that have passed tests. But there seems to be a fundamental misundersatnding of science and how it is done in this forum.


What predictions were you speaking of?

Date: 2008/07/06 16:25:47, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,22:24)
Quote

I could name dozens of ID predictions that have passed tests. But it's not important, so I won't name any. Now leave me alone, dumbass!"


In fact, this whole sentence is wrong, it's not that it's not important, it's that it raises many issues. Let me just say that when P(B/A) = P(A/B) = P(A/A), then the data A maximally confirm B. because they raise its probability from whatever its prior probability was to one.

Again with the dodging.

Quote
I could name dozens of ID predictions that have passed tests. But there seems to be a fundamental misundersatnding of science and how it is done in this forum.


What predictions were you speaking of?

Date: 2008/07/06 16:25:47, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,22:24)
Quote

I could name dozens of ID predictions that have passed tests. But it's not important, so I won't name any. Now leave me alone, dumbass!"


In fact, this whole sentence is wrong, it's not that it's not important, it's that it raises many issues. Let me just say that when P(B/A) = P(A/B) = P(A/A), then the data A maximally confirm B. because they raise its probability from whatever its prior probability was to one.

Again with the dodging.

Quote
I could name dozens of ID predictions that have passed tests. But there seems to be a fundamental misundersatnding of science and how it is done in this forum.


What predictions were you speaking of?

Date: 2008/07/06 16:27:53, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,22:26)
I sure can name 10. But like I said it raises many issues.Such as, you can never derive data points from probabilistic theories, but only probabilities of data points

Quit stalling.

Quote
I could name dozens of ID predictions that have passed tests. But there seems to be a fundamental misundersatnding of science and how it is done in this forum.


What predictions were you speaking of?

Date: 2008/07/06 16:27:53, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,22:26)
I sure can name 10. But like I said it raises many issues.Such as, you can never derive data points from probabilistic theories, but only probabilities of data points

Quit stalling.

Quote
I could name dozens of ID predictions that have passed tests. But there seems to be a fundamental misundersatnding of science and how it is done in this forum.


What predictions were you speaking of?

Date: 2008/07/06 16:31:36, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,22:29)
Quote

I don't believe you can name *any*, much less ten.


I can name dozens . But I think what you are looking for is a criterion by which to distinguish a theoretical explanation of the data from a mere redescription of it.  Call your criterion the "parameter counting criterion".  I don't believe this is a very good criterion for distinguishing theories from non-theories.

Quote
I could name dozens of ID predictions that have passed tests. But there seems to be a fundamental misundersatnding of science and how it is done in this forum.


What predictions were you talking about? I'm getting tired of posting this quote time and time again.

Date: 2008/07/06 16:31:36, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,22:29)
Quote

I don't believe you can name *any*, much less ten.


I can name dozens . But I think what you are looking for is a criterion by which to distinguish a theoretical explanation of the data from a mere redescription of it.  Call your criterion the "parameter counting criterion".  I don't believe this is a very good criterion for distinguishing theories from non-theories.

Quote
I could name dozens of ID predictions that have passed tests. But there seems to be a fundamental misundersatnding of science and how it is done in this forum.


What predictions were you talking about? I'm getting tired of posting this quote time and time again.

Date: 2008/07/06 16:35:54, Link
Author: dnmlthr
There is a great, but nauseating, short story by Chuck Palahniuk called "Guts", from his book "Haunted".

Anyway, how about those dozens of predictions?

Date: 2008/07/06 16:35:54, Link
Author: dnmlthr
There is a great, but nauseating, short story by Chuck Palahniuk called "Guts", from his book "Haunted".

Anyway, how about those dozens of predictions?

Date: 2008/07/06 16:41:43, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,22:40)
That post before last was a joke by the way.

Quote
I could name dozens of ID predictions that have passed tests. But there seems to be a fundamental misundersatnding of science and how it is done in this forum.


If you can name them, and they're not secret, then what's the problem?

Date: 2008/07/06 16:41:43, Link
Author: dnmlthr
Quote (Guts @ July 06 2008,22:40)
That post before last was a joke by the way.

Quote
I could name dozens of ID predictions that have passed tests. But there seems to be a fundamental misundersatnding of science and how it is done in this forum.


If you can name them, and they're not secret, then what's the problem?

Date: 2008/07/06 16:45:51, Link
Author: dnmlthr
Well, I'm leaving this in the hands of you less timezone-impaired folks.

Quote
I could name dozens of ID predictions that have passed tests. But there seems to be a fundamental misundersatnding of science and how it is done in this forum.


Will I wake up to a world where science has been revolutionized? Only time will tell. G'night.

Date: 2008/07/06 16:45:51, Link
Author: dnmlthr
Well, I'm leaving this in the hands of you less timezone-impaired folks.

Quote
I could name dozens of ID predictions that have passed tests. But there seems to be a fundamental misundersatnding of science and how it is done in this forum.


Will I wake up to a world where science has been revolutionized? Only time will tell. G'night.

Date: 2008/07/09 00:52:16, Link
Author: dnmlthr
Quote (Ftk @ July 09 2008,06:42)
Nope, no proof or evidence of any kind that this may be accurate.  Just speculating....kind of like the speculations you all make about common descent.

Now you're just being childish. Your ignorance of the evidence does not constitute absence of evidence.

Date: 2008/07/09 12:25:37, Link
Author: dnmlthr
And if you run out of evidence for evolution as well as examples of it being put to practical use,  then I'm fairly certain you can find something interesting to read among these nearly 9 million articles.

Just a little heads up, that's all.

Date: 2008/07/09 12:36:55, Link
Author: dnmlthr
Quote (Ftk @ July 09 2008,18:27)
   
Quote
If you look really really good, you've seen that there is a simple yet unanswered list of questions. As long as the questions remained dodged, they keep mocking.


Yes, you see, lcd....ftk has to answer every question posed to her. These folks don't have to follow those rules.

Giving a single satisfactory (i.e. backed up by actual evidence) answer would go a long way.

   
Quote (Ftk @ July 09 2008,18:27)

I'm still waiting to be told why common descent must be adhered to in order to do biology.  No one addressed the primary topic of my post.  Although, if I know Bill he's sitting back watching the fireworks while putting together a thoughtful response rather than blurting out in emotional furor like Eramus et. al.

Look at the image to the right on this page. Look at it again.

Common descent explains that. Know of any other concept that does?

Edit: Changed "theory" into "concept". Not exactly sure why, but it looked funny.

Date: 2008/07/09 14:15:03, Link
Author: dnmlthr
Quote (lcd @ July 09 2008,20:08)

Quote
So would Fall Theory imply that disease causing organisms were better at their work before and just after the Fall, or have they lost information and become wimpy over time?

Actually there were no disease causing bacteria.  Yes, there was bacteria, but it was the fall that caused some of them to degenerate and give us what we see today.

Again, there was no death before the fall.  Our sins to God are the cause of all the pain and suffering we see today.


So only things that are bad for humans evolve novel new features while the rest of the natural world degenerates?

What about wolves, bears and other predators that historically might have competed with humans for food?

Did they evolve new features after the fall and will they degenerate as soon as they no longer pose a threat, or will they keep evolving until they take us out?

Edit: Formatting.

Date: 2008/07/09 14:22:30, Link
Author: dnmlthr
Quote (Ftk @ July 09 2008,20:16)
It doesn't matter if you do or not.  It makes as much sense as stating that a blob is capable of evolving into everything we observe in nature today.  Why should anyone take that seriously?

God or a lucky blob....make your choice.

This is a false dichotomy and you've brought it up in various forms before.

Evolution is a mechanism that has been observed, studied and documented. The same cannot be said for miracles.

Date: 2008/07/10 16:27:01, Link
Author: dnmlthr
[Graffiti moved to Bathroom Wall. -Admin]

Quote (Ftk @ July 10 2008,22:14)
Well, I'd certainly rather hang out in a bar with Sal than you.  You're an old grouch.

Hanging out with a gay bashing bigot is your idea of a good time? You really need to get out more.

Date: 2008/07/11 10:17:57, Link
Author: dnmlthr
http://www.uncommondescent.com/intelli....-292301

 
Quote
13

DaveScot

07/11/2008

6:17 am
Russ

Over on ATBC someone says of us:

"Most people think that murder is wrong even if it goes unpunished, doofus.

Dave and Russ: two grown men to whom the word “conscience” means nothing more than “wondering if Sky Daddy would approve”. "

What is a “conscience” when an atheist refers to it? Can it be weighed or measured to confirm its material existence? Is it subject to experiment to figure how it works?

At any rate, my “conscience” doesn’t necessarily think that murder is wrong. For instance, I could easily murder someone like Timothy McVeigh if I found out he was planning to kill a bunch of innocent people. The only thing that would stop me would be the threat of punishment. You can’t just go around killing people by unilateral decision. My conscience, which is really no more than my own self-reflection, would bother me if I could have murdered McVeigh but didn’t and then 168 innocent men women and children died when I could have prevented it by taking the law into my own hands.


The baby Hitler fallacy. How come I'm not surprised that no argument is too stupid to rehash over at UD.

Argumentum ad making up scenarios where you kill someone

Edit: Fixed formatting, and added a link.

Date: 2008/07/11 12:57:44, Link
Author: dnmlthr
Back to the scheduled programming, todays forecast contains much gloating about the fallout of PZ's cracker post.

O'Leary naturally uses the occasion to hammer home the message of the scientific nature of ID.

Quote

What blows me away is the artless messages I get from wwell’meaning people who inform me “you can believe in God and evolution!” - apparently, these people have simply accepted whole hog, at face value, Darwin lobbyist Eugenie Scott’s hype, completely ignoring the history.

It’s somewhat like accepting the Communist party’s account of communism as Truth.

See: “Accepting evolution” does not make you an atheist… oh, puh-LEASE! Not this rubbish again!


Edit: Subtlety is not my forte, as you probably can tell from this lame attempt to steer this thread back to UD.

Date: 2008/07/11 13:04:40, Link
Author: dnmlthr
Quote

Oh, and I apologize to everyone here for everything I've said the past two days.  I've been on an ivy/and other personal issues ranting frenzy.  So, I appreciate your ability to keep me so entertained that I forget about the real world for a bit.


Not to make light of what I am I'm sure is a painful medical situation, but are you through your recent bout of dare I say rashionality?

Hurr hurr hurr.

Edit: Not only are the jokes bad, but the spelling too.

Date: 2008/07/11 13:31:13, Link
Author: dnmlthr
Quote (Lou FCD @ July 11 2008,19:26)
[quote=Lou FCD,July 09 2008,22:42]
Got my entrance exam scores today.

I did OK, apparently.


Nice!

Date: 2008/07/11 15:49:49, Link
Author: dnmlthr
DaveScot has, predictably, as much of a grip on networking as he has on biology. I am truly shocked.


Not that that has ever stopped him pontificating on a subject before, of course.

Date: 2008/07/11 16:17:41, Link
Author: dnmlthr
Quote (Ftk @ July 11 2008,22:01)
Dave seems more than willing to engage in conversation with you bananators...

   
Quote
And if anyone is wondering why I don’t respond on ATBC it’s because I’m banned there.

Threatening to hack the place is more than enough of a bannable offense, don't you think?

Not that I think he poses much of an information security threat to anyone but himself, considering he doesn't even seem to grasp filesystem-level access control...

Date: 2008/07/11 17:50:41, Link
Author: dnmlthr
Quote (Ftk @ July 11 2008,23:44)
Quote (Nerull @ July 11 2008,17:37)
Quote
All the so-called “mavericks of the solar system” (asteroids, meteoroids, and comets) resulted from the explosive events at the beginning of the flood.


Speaking of selective reading, do you know what the word 'all' means, FTK?

Would you care to tell me how Walt is not saying that every asteroid, meteoroid, and comet in the solar system was created by the flood?

lol...no, I'll give you a reading assignment instead, because as soon as one question is answered, they'll be another.  You need to read it very, very, very thoroughly.  He covers a LOT of stuff in the chapter, notes and links.  Now get to it!  

Love,
Miss Crabtree

So Walt is directly contradicting himself by way of footnotes? What does that say about his credibility?

Date: 2008/07/11 18:06:48, Link
Author: dnmlthr
Quote (Dr.GH @ July 11 2008,23:44)
 
Quote (Nerull @ July 11 2008,15:21)

Still waiting to hear what exactly is bigoted about it.


Buy a dictionary. Read the definition of "bigotry." Read PZ's post.

Try this: Walk into a VFW post. Go to the bar (just follow the sound of people). Drop an American flag on the floor and piss on it.

When you come to (hopfully), ask your self, "Self? Why should I be surprised I hurt so bad?"

Unless undertaken in the pure spirit of a scientific experiment in social psychology, you action would be bigorty, merely because it was to denigrate the beliefs of others.

People react to symbols and ideas as if they are real objects. The empathic response experienced (by healthy people) of wincing while watching a video of someone being injured is actually triggered by the same parts of the brain that are active when a (healthy) person is injured.  "I feel your pain" other than as a political slogan, is really sincere. TV shows like "America's Funniest Home Movies" or "Jackass" are rough indications of the number of people with psychopathic personality disorders. (It is an over estimate for several reasons).

No dead trees necessary

 
Quote

Bigot

Pronunciation:
   \?bi-g?t\
Function:
   noun
Etymology:
   French, hypocrite, bigot
Date:
   1660

: a person obstinately or intolerantly devoted to his or her own opinions and prejudices; especially : one who regards or treats the members of a group (as a racial or ethnic group) with hatred and intolerance


I am not  sure irreverence to the dearly held symbols of others qualifies, at least not according to this definition.

Then again, I read his original post as a PZ styled confrontational commentary to the events surrounding the original wayward wafer, so I might be reading into his words things that aren't there. Or blinding myself from things that really are there rather.

Date: 2008/07/11 18:37:59, Link
Author: dnmlthr
Quote (Dr.GH @ July 12 2008,00:26)
You are not sure?

Irreverence is to ask that the Host be served with cheese whip because you hate the taste of raw meat. "Hatred and intolerance" is:  
Quote
So, what to do. I have an idea. Can anyone out there score me some consecrated communion wafers? There's no way I can personally get them — my local churches have stakes prepared for me, I'm sure — but if any of you would be willing to do what it takes to get me some, or even one, and mail it to me, I'll show you sacrilege, gladly, and with much fanfare. I won't be tempted to hold it hostage (no, not even if I have a choice between returning the Eucharist and watching Bill Donohue kick the pope in the balls, which would apparently be a more humane act than desecrating a goddamned cracker), but will instead treat it with profound disrespect and heinous cracker abuse, all photographed and presented here on the web. I shall do so joyfully and with laughter in my heart.


Now I am sure.

I am 100% certain that I consider "heinous cracker abuse" to be irreverent, clearly a turn of phrase meant to be humorous.

Edit: Edited for style.

Date: 2008/07/12 09:33:03, Link
Author: dnmlthr
Quote (carlsonjok @ July 12 2008,15:29)
You mean you actually formed an opinion all by your onesies without deferring to some Alpha Male authority figure?  Well, I'll be damned.........   ;)

Incidentally, it just happens to coincide with the conclusions of the UD silverbacks.

Date: 2008/07/12 11:26:54, Link
Author: dnmlthr
Quote (Dr.GH @ July 12 2008,15:22)
Let me ask you and anyone else- Is burning a cross on a black families lawn a "hate crime?" It has been successfuly prosecuted and people have gone to jail.

Is painting a Swastika, or writing Nazi slogans on a Temple a Hate Crime? It has been successfuly prosecuted and people have gone to jail.

The monetary value of the lawn damage, or the paint to cover the Nazi slogans, does not set the level of the crime. It is the painful emotional impact that the act caused that sets the level of the crime.

Both cross burning and swastika painting may be reasonably interpreted as threats, considering the historical baggage of those activities. There is nothing you can do to a wafer that compares to those activities, IMO.

Date: 2008/07/12 19:59:42, Link
Author: dnmlthr
Quote (Dr.GH @ July 13 2008,01:40)
Does that distain allow you to disrupt a religious observance? Does that distain allow you to take church property?

Plus, I also wonder about the predictable reaction of believers- is it incitement to mess with their rituals?

Let's imagine that there is a child's birthday party in a public park- The family is deeply religious and they have their eyes closed in prayer.  You are more wise than they are and so you dump the birthday cake on the ground.

You get arrested.  It is as simple as that.  If you get a good ass kicking resisting arrest, few courts would probably bother prosecuting the family members.

Why do you keep using these really weak analogies? Dumping a kids birthday cake on the ground != walking away with a wafer from mass (that you have been given) != burning crosses != spraying swastikas on synagogues.

Date: 2008/07/12 20:25:11, Link
Author: dnmlthr
Quote (Dr.GH @ July 13 2008,02:13)
The kid's cake was cheap, and they shouldn't pray when it offends you. Right? It was a public park and they were being offensive to your tender emotions. They deserved it.


Date: 2008/07/12 20:37:21, Link
Author: dnmlthr
Quote (Dr.GH @ July 13 2008,02:13)
The kid's cake was cheap, and they shouldn't pray when it offends you. Right? It was a public park and they were being offensive to your tender emotions. They deserved it.

Nice strawman by the way, care to elaborate on which one of my posts that's indicative of that type of attitude?

Date: 2008/07/12 21:03:02, Link
Author: dnmlthr
If you still don't see the difference between burning a cross and walking away with a wafer there's really nothing I can say. What is the implied threat of the wafer scenario?

As for intent, one of the two is intended to terrorize, the other to be an asshole and possibly make some kind of point.

And what's up with the "I have seen things on the streets" shit? No amount of street cred can save a tortured analogy.

Date: 2008/07/13 02:44:55, Link
Author: dnmlthr
Quote (Dr.GH @ July 13 2008,03:59)
Quote (dnmlthr @ July 12 2008,19:03)
If you still don't see the difference between burning a cross and walking away with a wafer there's really nothing I can say. What is the implied threat of the wafer scenario?

As for intent, one of the two is intended to terrorize, the other to be an asshole and possibly make some kind of point.

And what's up with the "I have seen things on the streets" shit? No amount of street cred can save a tortured analogy.

The Catholics seem to feel they are being terrorized.


What reason do catholics have to fear for their lives because of the wafer incident? Name a precedent.

Quote

You either think they have no real emotional response, or that because you have a superior grasp of reality their emotional response is unjustified.

Or maybe they have no right to have an emotional response just because ___?


The "you think you're an übermensch" strawman is  getting really old and crusty by now, it's time you make up a new one.

Date: 2008/07/13 10:01:10, Link
Author: dnmlthr
Quote (CeilingCat @ July 13 2008,15:06)
This seems to be standard procedure for all accomplished faith healers.  The photogenic who have at least a chance of standing up from their wheelchairs or dropping their crutches are brought up front and the hopeless cases are kept in the back of the room, out of the bright lights and tv cameras.  The Amazing Randi wrote an article about attending a faith healer's session once and mentioned the rows of wheelchairs with hopelessly screwed up people in the darkness at the back of the room.

Faith healers are nasty pieces of work, guess you have to be when you sell nothing but disappointment, false hope and fraud to the ill. Bet this Todd Bentley character sleeps like a baby though.

Date: 2008/07/13 16:56:34, Link
Author: dnmlthr
Since you refuse to actually read what's written in the thread I see no reason to continue this conversation. Have fun in the hay.

Edit: this/the

Date: 2008/07/14 12:35:59, Link
Author: dnmlthr
If this thread ends up centering around LCD, may I suggest a title change in order to maintain a non-hostile atmosphere?

Edit: I write like yoda sometimes.

Date: 2008/07/16 13:57:45, Link
Author: dnmlthr
Quote (Texas Teach @ July 16 2008,19:49)
It sounds like we need to sign Chuck up for the Internet Tough Guy Olympics.  Imagine getting him to compete against DaveTard (and his dogs).



It would be... wonderful!

Date: 2008/07/16 16:07:06, Link
Author: dnmlthr
Quote (ppb @ July 16 2008,21:54)
Quote (raguel @ July 16 2008,16:13)
It seems to me that paleontologists are always looking in the wrong place for something. I'd imagine Shubin was in the wrong place to find  rabbit and kangaroo fossils, but somehow managed to find tiktaalik instead.

In this case, Shubin knew the right place to look.  He understood what came before and after, had a good understanding of the age and type of deposits where he would find them, then found the most likely place on earth to do his digging.  That's science at it's best!

I agree, expecting the process to be near-instantaneous is at best a misconception, at worst a straw man.

Date: 2008/07/16 16:22:42, Link
Author: dnmlthr
Horrendously off topic for any thread. Banishment to the spot behind the dumpster in the damp back alley?

Bad: being called back to the office for a late-night debugging session.
Good: getting it done in 10 minutes.
Slight dip in goodness: spending 45 minutes explaining the problem to a project manager.
Better: sans bus driver's strike the trip home only took 30 minutes.
Bettererer: relaxing with a glass of crappy wine that you know you won't finish.

Servers. Can't live with 'em, can't live without 'em apparently.

Edited: Grammar etc.
Edit again: it's 23:25 over here.

Date: 2008/07/16 17:37:31, Link
Author: dnmlthr
Another suspected Krolling posted over at pharyngula.

 
Quote

   this woman who is the principle of this middle school should be fired on the spot, ther is no need to make a determination to who is responsible. When the person in charge of the school is responsible.

   You see womwn can not have it both way, demand equality and respect, then ask for understanding because " I was flustered by a reporters phone call". If she get's flustered by a phone call, then imagine how she would handle a terror situation, or an emergency.

   perhaps this will make some people in this state wake up, and see that these people we have abdicated our parental duties to, could care less about these children.

   As long as they can get their six to seven months a year off, teach our kids that America sucks and it's ok to have two mommies public education is fine, but if you want good old fashion morals reading, writting and math skills. well that's another thing.

   What's next field trips to whore houses.

   Let's wake up New Hampshire, and let's do what we shoud have done a long time ago, run all these scum bag socialists from our state back to mass where they belong
   - chuck kroll, manchester


Emphasis mine. If it's the same guy it seems to me that he would benefit from taking a walk between writing and pressing submit.

As for Melanie Kroll getting her job back, yeah why not cut her some slack but at the same time I don't find it too plausible.
Whatever negligence displayed on her part has set off a chain reaction that has resulted in alot of negative attention ending up in the lap of her employers. At the very least they've ended up being the butt of alot of bad jokes.

Having been on the clean-up side, albeit on the technical side, after clear breaches of policy, it's just plain bad all around.

Date: 2008/07/21 12:27:10, Link
Author: dnmlthr
Richardthughes: Somehow I get the feeling you're fond of stratocasters... ;)

Synthesizers, drum machines, analog delays and a rudimentary laptop studio are my weapons of choice. Oh, and a Gibson SG.

Date: 2008/07/21 13:25:54, Link
Author: dnmlthr
Quote (Chayanov @ July 21 2008,19:21)
This is the "science" of ID: comparing photos to see what things look like other things.

Now you're selling them short, they also look at pictures of things that look complicated, shrug and say an unspecified designer did it.

Date: 2008/07/22 11:18:39, Link
Author: dnmlthr
Quote (lcd @ July 22 2008,00:51)
 
Quote (keiths @ July 21 2008,15:10)

Well, now you've seen it.  What's your opinion, lcd?

I am not happy.

A both reasonable and understandable response.

Date: 2008/07/22 11:23:13, Link
Author: dnmlthr
Quote (Richardthughes @ July 21 2008,18:56)
Quote (dnmlthr @ July 21 2008,12:27)
Richardthughes: Somehow I get the feeling you're fond of stratocasters... ;)

Synthesizers, drum machines, analog delays and a rudimentary laptop studio are my weapons of choice. Oh, and a Gibson SG.

Cool. I have a Digi 002 and ableton also. Whilst my guitaring is quite disco, my choons are fairly electronic.

Do you like ableton live? I tried out the demo but kept finding myself cross-fading away pops and crackles all the time. These days I just slave the MIDI gear to cubase, the CV gear to the MIDI gear and use the DAW as an expensive tape deck.

Date: 2008/07/22 11:34:31, Link
Author: dnmlthr
Sizzle didn't go over too well over at Scienceblogs. To which Randy and Mooney (of the great hair) responds that the sb people reviewing the film "don't get it".

Quote
...
the audience laughed loudly and knowingly when Randy Olson explained the negative response to the film here on ScienceBlogs and remarked, "lots of the scientists don't quite get it."


http://scienceblogs.com/intersection/2008/07/sizzling_in_la.php

Mooney is so thin-skinned these days that he won't even let mild criticisms get through the filter, boy am I surprised.

Edit: My bad, apparently a bunch of less than praising comments were just held up and have now been published.

Date: 2008/07/22 11:38:32, Link
Author: dnmlthr
Quote (Richardthughes @ July 22 2008,17:34)
Quote (dnmlthr @ July 22 2008,11:23)
 
Quote (Richardthughes @ July 21 2008,18:56)
 
Quote (dnmlthr @ July 21 2008,12:27)
Richardthughes: Somehow I get the feeling you're fond of stratocasters... ;)

Synthesizers, drum machines, analog delays and a rudimentary laptop studio are my weapons of choice. Oh, and a Gibson SG.

Cool. I have a Digi 002 and ableton also. Whilst my guitaring is quite disco, my choons are fairly electronic.

Do you like ableton live? I tried out the demo but kept finding myself cross-fading away pops and crackles all the time. These days I just slave the MIDI gear to cubase, the CV gear to the MIDI gear and use the DAW as an expensive tape deck.

It depends on the quality of the sample... some vinyl is brutal.  ???

I thought more about non-zero loop crossings. Say you have a 4-bar loop where the end doesn't match up with the start, resulting in a clear "pop" when looped.

Something like this, ASCII art style.

  *    **      *
*** ****   **
********* **** <-- non-zero loop ending resulting in a pop.
<---- loop ---->

Date: 2008/07/22 12:42:08, Link
Author: dnmlthr
Yeah. I do the same thing in cubase, but the effect is far less noticeable, basically making sure that both the start and end of the loop ends at zero, with a slight fadeout at the end and slight fadein at the start.

That was my only gripe with Live though.

Date: 2008/07/22 17:45:40, Link
Author: dnmlthr
[Graffiti moved to Bathroom Wall. -Admin]

The kids should be left out of the discussion, period.

Date: 2008/07/23 01:33:50, Link
Author: dnmlthr
Quote (Argon @ July 23 2008,02:02)
You can explain to Schlafly in a dozen different ways how Zachary Blount isolated Cit- clones before running the 'replay experiments' but it just doesn't sink in. Now Andy is going to send a letter to PNAS detailing the 'flaws' in Lenski's paper.

http://www.conservapedia.com/Letter_to_PNAS

Sweet!

It's all posturing to be able to claim persecution and fraud when the big bad evilutionists ignore his claims.

Date: 2008/07/23 17:20:20, Link
Author: dnmlthr
[Graffiti moved to Bathroom Wall. -Admin]

Quote (Arden Chatfield @ July 23 2008,21:37)
(Even the Catholics had serious misgivings about Revelations -- given how many hillbillies it's made crazy, I think their concerns were well founded.)

Moonshine and psychedelic religious texts are a bad combination, mkay?

Date: 2008/07/26 13:43:22, Link
Author: dnmlthr
Quote (Lou FCD @ July 26 2008,17:00)
Jeff, go us!  Us old geezers gotta stick together and show them young'ns how it's done, eh?

Tell me about it, in my class me and a couple of others apparently go under the nickname "the old timers". I'm 28.

Get off my lawn!

Date: 2008/07/26 17:53:42, Link
Author: dnmlthr
Sure you're not a monkey pig?

Congratulations, btw.

Date: 2008/07/27 03:20:12, Link
Author: dnmlthr
Quote (oldmanintheskydidntdoit @ July 27 2008,09:08)
DaveScot might be coming close to the truth    
Quote
If ID won’t stand up to critical examination then why all the fuss about it? There’s no big controversy over any other bits of “science” other than mud to man evolution and global warming. Why?


Yeah, keep asking "why" DS and you might get an answer. You might not like the answer that the morons at UD will give you but you'll get an answer.....

Tard

Is there no woo that's too stupid for Larry Fafarman?

Doesn't seem that way

 
Quote

There is a big controversy over string theory — a lot of physicists are doing research on it but a lot of other physicists consider it to be unscientific. There is a big controversy over whether thimerosal, a preservative used in vaccines, is a factor in autism. There must be a lot of little scientific controversies that are not in the news.


The Huffington Post, David Kirby and Jim Carrey vs the medical community. My my Larry, that's quite a scientific controversy.

Date: 2008/07/28 12:56:22, Link
Author: dnmlthr
Just finished Thunderstruck by Erik Larson. There are a few irritating stylistic choices (the overly dramatic plant for one) but overall it's an interesting take on the early 20th century race for cross atlantic wireless communication, among other things.

Good for a few lazy summer afternoons.

Date: 2008/07/28 14:36:03, Link
Author: dnmlthr
The nominees have been presented

Billy Crone (some kind of "demonic possession/UFO" theorist),  Berlinski (with a good ol' argument from authority), Harun Yaya, Ray Comfort and a smattering of random youtube creationists.

Here's the playlist

Date: 2008/07/29 13:54:56, Link
Author: dnmlthr
Quote (Assassinator @ July 29 2008,19:53)
Yes, you read, interpret the texts and beleive in thát. I talk to people on a regular basis who don't beleive in what you do.

In fact, some of us are atheists on a daily basis.

Date: 2008/07/29 13:57:04, Link
Author: dnmlthr
Quote (Steviepinhead @ July 29 2008,00:49)
We neither take exception to your review of Thunderstruck, or to your enjoyment of your lazy summer afternoons...

We do, however, object to your limitation of the latter to a "few."

--Society for More Lazy Summer Afternoons

Then you'll need a couple of books more. You see, Thunderstruck isn't that thick. By which I mean it doesn't contain an awful lot of pages.

Date: 2008/07/30 14:06:19, Link
Author: dnmlthr
Quote (Richardthughes @ July 30 2008,17:18)
The day that music died:

http://www.uncommondescent.com/evoluti....-rogers

Please listen to the mp3. Imagine the creobots getting down to it at the Disco Institute Christmas disco. Don't have any fluid in your mouth / close to monitors, etc.

PS - Bob, your boyfriend's back.

It's so bad it stopped being so bad that it was funny a long time ago.

Date: 2008/07/30 17:18:38, Link
Author: dnmlthr
Quote (Richardthughes @ July 30 2008,22:59)
What long odds of clusterfuckery and assclownery are required that this, erm, 'song' can come to life on teh_interwebs?

That's so improbable (10^-150) as to be impossbible. Therefore goddidit.

Meanwhile, D'ol is cultivating her link farm. I think she thinks she's made a point, I just can't decipher what it could be. Absolute word salad.

Date: 2008/07/31 12:46:05, Link
Author: dnmlthr
Quote (Lou FCD @ July 31 2008,14:16)
Quote (Wesley R. Elsberry @ July 30 2008,18:11)
I'm not sure how my name could come up and various of the things I listed not be part of what any basic summary of my part in creation/evolution discussion should include. How does that work?

Selective blinders.

Sort of like polarized sunglasses.

Maxwell's ray-bans?

Date: 2008/08/04 14:15:28, Link
Author: dnmlthr
Quote (dhogaza @ Aug. 04 2008,17:45)
Shit, we need a mole at PNAS ... I hope no one chokes to death on their coffee when they read the contents and break out into uncontrollable hysterics.

I hope their response will be modeled on Lenski's superb second letter.

Date: 2008/08/09 03:31:41, Link
Author: dnmlthr
There's only one car worth driving.

Edit: formatting, no need to quote etc

Date: 2008/08/09 03:53:40, Link
Author: dnmlthr
Quote (Erasmus, FCD @ Aug. 08 2008,23:58)
This is some really repressed gay shit


Quote
Chuck's Chun Kuk Do was unbelievably strong, but his flexibility has waned with the years and so the lightning-fast sokuto intended for my solar plexus only grazed my left shin. Even so, the speed of it forced me to switch from an aggressive Tiger stance to a more defensive Nekko-achi, from which I snapped a front kick that would have crushed his jaw had he not slashed down with a patented Shigawire Mustache block that severed two of my toes. Screaming in pain and fury, I leaped backward while throwing a defensive maegeri that didn't make contact, but blinded him with a spray of blood. While Chuck rubbed at his face to clear his vision, I took advantage of his momentary blindness to attack again and broke several of his ribs with a skipping left sokuto that left a bloody footprint on his white gi.

Chuck doubled over and I stepped forward to throw a right-left combination to his head that would have finished him, but the movement turned out to be a ruse. Just as I threw the right hook, he caught my wrist, twisted his body and threw me over his shoulder, slamming me into the pavement in front of my garage. I was stunned, naturally, and my shoulder was dislocated, but I managed to roll away before he drove his heel down into my throat. Still, I was in a very precarious position and had all but given up hope of keeping the hawk on Monday's front page. Fortunately for me, the disturbance of the air caused by my violent passage through it had slightly ruffled Joseph Farah's exquisitely coiffed mane, so Mr. Farah immediately called time, declared the match a draw, and told us to sort it out amongst ourselves while he flipped open his solid gold satellite phone and arranged for an emergency styling right there in the driveway.


Reads like slashfic. Makes sense, worldnutdaily is related to reality the same way fanfic is related to canon.

Date: 2008/08/09 11:21:33, Link
Author: dnmlthr
I've never owned a car, though I've had a license for close to 8 years. I don't know if it's healthy or stupid.

Date: 2008/08/12 02:58:59, Link
Author: dnmlthr
Quote (Dr.GH @ Aug. 11 2008,01:34)
Quote (afarensis @ Aug. 10 2008,09:27)
 
Quote (Bob O'H @ Aug. 10 2008,08:37)
 
Quote (deadman_932 @ Aug. 09 2008,19:26)
U.K. Sociologist Steve Fuller (University of Warwick), pictured below:

*ahem*  

Fuller is a Yank - he just resides in Britain.

Reminds me of an old saying "Possession is 9/10th's of the law" and right now the Brits posses him, and they are welcome to him.  :D

I hope they don't get an exorcist to send him back home.

Speaking of Fuller, here's a takedown of his book "Science v. Religion? Intelligent Design and the Problem of Evolution".

Interesting quote (followed by a good old skewering!):

Quote
Fuller's grasp of history of science, and of the sciences themselves, turns out to be equally interesting.


Followed by some really bizarre statements. Fuller is either woefully ignorant of his subject matter - or expects his audience to be.

How can you not love this quote from the end of the review?

Quote

These excursions into fancy allow me to end on a positive note: the lack of depth or insight in this book is more than compensated by the entertainment it provides, at least to a philosopher or historian of science. No one should begrudge us our simple pleasures. I'm happy to have read this book, and even more so not to have paid for it.

Date: 2008/08/12 13:27:56, Link
Author: dnmlthr
Quote (cewagner @ Aug. 12 2008,19:18)
Quote
What part of selection is not direction?


None of it.

Selection is no different from ordering a truckload of stones and culling out all the stones that have masses greater than 500 grams. It will never build a house.

That analogy is flawed. For one, it assumes that selection has a goal. Second, a single stone (which is what you are selecting in this analogy) is not the same as a house.

Date: 2008/08/13 01:40:52, Link
Author: dnmlthr
Quote (afarensis @ Aug. 13 2008,03:03)
Afarensis looks at the calendar and realizes that 15 days have gone by and still no FTK... "I hope" he says to himself "that I didn't brush up on the fins to limbs transition for nothing". Really, the tedium is starting to get to me, I think I'm hallucinating. Is Louis really talking about Prince Charle's legs upthread or have I lost touch with reality? :(

This is the ftk thread, reality doesn't really like it here.

Date: 2008/08/14 15:12:54, Link
Author: dnmlthr
EDIT: Conservapedia has been hijacked by spammers it would seem.

This was the link that I posted:  www.conservapedia.com/Unicorn
Oh my, unicorns!

Quote
The Unicorn is likely purely a mythical beast, commonly depicted as resembling a white horse with a single horn grown out of its forehead


I don't think any further commentary is necessary. Emphasis mine.

Edit: Added link.

Date: 2008/08/14 16:42:58, Link
Author: dnmlthr
Indeed, it seems like they've been hijacked by spammers.

According to the WHOIS entry, the domain hasn't expired anyway, and Schlafly's name is still in there as well.

Date: 2008/08/16 07:06:22, Link
Author: dnmlthr
Here's a link to Reuters' coverage

Quote

Results from tests on genetic material from alleged remains of one of the mythical half-ape and half-human creatures, made public at a news conference on Friday held after the claimed discovery swept the Internet, failed to prove its existence.

Its spread was fuelled by a photograph of a hairy heap, bearing a close resemblance to a shaggy full-body gorilla costume, stuffed into a container resembling a refrigerator.

One of the two samples of DNA said to prove the existence of the Bigfoot came from a human and the other was 96 percent from an opossum, according to Curt Nelson, a scientist at the University of Minnesota who performed the DNA analysis.


I am shocked.

Date: 2008/08/17 09:13:39, Link
Author: dnmlthr
I've lost my mind, according to Granville Sewell.

 
Quote
When one studies history (especially the history of religion), one may become overwhelmed by the misery and confusion of the human condition, and wonder, why is it so hard to see evidence of the hand of God in human history?

It's not like the evidence really matters, since he's starting with his conclusions anyway.

 
Quote
But notably absent from any list of reasons why intellectuals reject Intelligent Design is any direct scientific evidence that natural selection of random mutations or any other unintelligent process can actually do intelligent things.

What does that even mean? "To do intelligent things". I can imagine a scenario where a falling rock produces an "intelligent" end result. Does that imply Intelligent Falling?

     
Quote
However strong may be the philosophical, psychological and religious reasons why many of our greatest minds reject ID, the argument for ID is still crystal clear to the unindoctrinated mind: once you allow yourself to seriously consider the possibility that the human body and the human mind could be entirely the products of unintelligent forces, “you have lost your mind.”

To me it sounds like he's saying "share my assumptions or I will declare you insane", with a nice slice of projection pie on the side.

Date: 2008/08/18 10:22:02, Link
Author: dnmlthr
Quote (Thought Provoker @ Aug. 18 2008,16:06)
Hi Jeffox,

Thank you for your response and recognition.

Unfortunately, it looks like the troops are circling the wagons again.

Yes, I was aware for the submarine in the desert and was even tempted to mention it in my previous comment because it goes to show how incredably quickly the "Rickover Navy" got things going.

I understand there is also a battleship in the desert somewhere too.  Some of the navy guys had interesting stories about that too.

I fail to see the utility of the Rickover navy analogy, unless they recycled debunked notions unsupported by evidence.

Looking to what has actually been produced, and keeping with the tortured military analogies, ID is more closely related to First Earth Batallion.

Date: 2008/08/18 15:39:08, Link
Author: dnmlthr
Quote (Lou FCD @ Aug. 18 2008,21:15)
Ok had the Bio lecture at 8, the lab at 11.  Kids mostly, and they were pretty quiet.  I did answer some of the prof's questions, both because I knew the answers and to help maybe encourage some of the kids to get involved.  I'd wait a bit though, hoping someone else would speak up.  His questions were very basic and easy, so I think shyness had something to do with it.  A few of them followed my lead and stepped up from time to time.

Finally, 'bout halfway through the lab, some more of them started getting involved, and the lab was pretty fun for most of us.  We did a little card game thing demonstrating the process of the scientific method.

The Doc stressed pretty heavily that the lecture would focus on the life part of biology, the lab on the study the science and the scientific method part of biology.

He didn't once come out and mention evolution, but reading between the lines with my AtBC filter glasses on, it was pretty obvious where he was going.  "Support with evidence", "Claims are useless without evidence", "Peer review", all the good stuff that is the basis for why ToE is science and creationism is TARD.

Of course, the text is heavy with the importance of evolution from the introduction on to the appendix.  One might call it "laced with Darwinism", in fact.  (Biology 8th ed. by Campbell and Reese et al)

Nice! Just make sure none of them pesky kids stray onto your lawn...

We still have two more weeks to go and I'm finally getting some vacation time.

Date: 2008/08/19 02:33:00, Link
Author: dnmlthr
Deadman, I'd like to thank you for your recommendations and raise you one: LyX - a near-WYSIWYG front end for latex with good support for writing equations. They've really improved with the 1.5 version.

Date: 2008/08/20 07:03:50, Link
Author: dnmlthr
I quit my job today. For the first time in 9 years I no longer have an employer. Weird feeling.

Date: 2008/08/20 07:50:34, Link
Author: dnmlthr
Quote (Erasmus, FCD @ Aug. 20 2008,13:28)
take this job.... and shove it.

[sexxi hawt honky tonk walk up bass line]

I aint workin here no more
Mah woman just left, and took all the reasons
(I-II-V rich follow along)
I was working for....

You better not try to stand in my way
As i am walking out the door
Take this job and shove it
I aint workin here no more

When in doubt, turn to DK.

Date: 2008/08/21 06:43:03, Link
Author: dnmlthr
Quote (midwifetoad @ Aug. 21 2008,12:35)
Quote (Wesley R. Elsberry @ Aug. 21 2008,03:56)
He can write a book (or have it ghost-written), hit the talk-show circuit, and never miss the day job.

I'm thinking the title would include words like coverup and conspiracy.

I expect at least one of these to pop up soon.

"The evidence for bigfoot THEY don't want you to know about"
"Sasquatch medicine - harnessing the healing powers of bigfoot"
"A message from bigfoot - FROM BEYOND THE GRAVE"


Edit: speling

Date: 2008/08/22 14:33:18, Link
Author: dnmlthr
Quote (charlie wagner @ Aug. 22 2008,20:27)

Ideology has no place in any public school science classroom and it must be stopped wherever it occurs. But one must also recognize that there have also been zealots on the evolutionist side who want to teach mechanisms of evolution that have no empirical support. The answer is simple and clear. Religious creationism must be eliminated from school curriculums and darwinian evolution must be taught not as fact, but in it's historical context. There is enough factual science, from anatomy to zoology to fill any school's scientific curriculum with non-controversial, factual science. Any teaching of darwinian evolution or creationism or "the controversy" is nothing more than a waste of time that could be better spent on real science.


What's your favourite claim in a highschool biology textbook for which there is no evidence? I mean, since this is a big issue for you, you must've run across plenty of them.

Edit: Speling, shortened the quote.

Date: 2008/08/22 14:55:56, Link
Author: dnmlthr
Bathroom walling imminent...

I'm just wondering, what will Sal say now?

Is it just me, or is Bill channeling Coulter in this pic?

Here's a couple more, just for kicks.





Funny how the 50's and early 60's ones fit him the best.

Date: 2008/08/22 18:47:56, Link
Author: dnmlthr
Quote (Lou FCD @ Aug. 22 2008,22:46)
She's donating the hair to Locks of Love.

...

She's been planning this for years since she first heard about the program.  It's kind of a big day for her.

A teenager that is considerate of others? Almost sounds like sci-fi, awesomely done!

Date: 2008/08/23 15:02:16, Link
Author: dnmlthr
Quote (sparc @ Aug. 23 2008,20:57)
 
Quote
5

DaveScot

08/23/2008

11:40 am

Tard Alert!

In order to make this thread a little easier to manage any critics of Fuller’s must use their real name to post a comment. Check the anonymous bravado at the door. I ought to make that a policy for the whole damn blog not just this one thread.
KairosFocus may never return.

Oh but I think he will (emphasis mine).

Date: 2008/08/24 12:41:45, Link
Author: dnmlthr
Oh my how you have grown, congratulations on your big day blipey! Let auntie Bill pinch those rosy cheeks.

Date: 2008/08/26 16:34:29, Link
Author: dnmlthr
Does compressibility play into this? That is, how much do you need to know to recreate a document*?

Consider a document containing the complete works of Shakespeare, I'd expect it to be reasonably compressable, likewise a document of the same size containing only the same letter over and over again. But how about a document of the same size that contains completely random characters?

Which one of these contain the most information? Which one is the most complex? The Shakespeare document would certainly seem to contain the most usable information (in the context of a human reader), but I'd expect it to not be the least compressible.

It's getting late, so I'll just leave you with this confused comment, hopefully to come back at a time when my brain isn't mush.

* For the sake of discussion, I'll talk about a simple text document sans metadata

Date: 2008/08/27 17:14:29, Link
Author: dnmlthr
Quote (Arden Chatfield @ Aug. 27 2008,18:18)
 
Quote (Amadan @ Aug. 27 2008,09:01)
What goes around comes around. It'll be interesting to see who starts shouting the loudest about this in the ID camp.

My prediction:

With a completely straight face, they will scream about how horribly inappropriate it is to compare your opponents to Hitler.

When presented with the double standard, they will (a) not reply or (b) say 'that's different'.

Or c) accuse you of daily atheism

Date: 2008/08/30 09:04:36, Link
Author: dnmlthr
He's the Stryper of web comics. I'm laughing on the inside, promise.

Date: 2008/09/03 03:46:04, Link
Author: dnmlthr
Currently binging on functional programming, in part thanks to school.

Programming in Haskell by Hutton
Apart from using mathematical notation in code examples instead of the corresponding ASCII character set that you would use when entering code into your editor, a practice so stupid that it boggles the mind, I guess it's ok as a very basic primer on Haskell and functional programming. Mercifully thin and thus nice to my back, unlike most of our other literature.

Structure and Interpretation of Computer Programming by Abelson and Sussman
Haven't had the time to dig into this yet, school season is pretty intense right now. I just hope it's half as good as its classic status indicates.

Date: 2008/09/03 04:35:39, Link
Author: dnmlthr
Note: I'm a dirty jurropean, so I won't even pretend to understand US electoral politics.

There are however other metrics than issues or personality that you can vote by.

Who are their backers, financially and politically. With only two major parties, from which faction within the respective parties do the candidates come?

Date: 2008/09/03 08:50:53, Link
Author: dnmlthr
Quote (dheddle @ Sep. 03 2008,13:54)
Quote (Albatrossity2 @ Sep. 03 2008,07:48)
 
Quote (dheddle @ Sep. 03 2008,04:13)
Issue voting will break your heart everytime.

And values voting will break the country.

Good choice.

Well, I do tend to be Calvinistic about these things.

In the sense of unconditional election or total depravity?

Date: 2008/09/04 11:01:04, Link
Author: dnmlthr
Psst, don't show this to your better halves.

Date: 2008/09/04 12:19:50, Link
Author: dnmlthr
Quote (Louis @ Sep. 04 2008,17:17)
Where did you get that photo?

Whenever my friends run across stuff like this they immediately come to think of me, for some reason. That can hardly be a compliment.

Date: 2008/09/04 14:24:59, Link
Author: dnmlthr
Quote (Richardthughes @ Sep. 04 2008,20:06)
WESM. You've struck a nerve. Dave had created new laws and re-engineered the strengths of universal forces to put gravity on top. No atheist could top that sort of output.

Not to mention the fact that he breaks the second law of thermodynamics every time he sits down by the keyboard.

Date: 2008/09/04 16:00:54, Link
Author: dnmlthr
Does it really matter though? It's been a little slow around here for awhile.

Date: 2008/09/05 14:32:28, Link
Author: dnmlthr
In one of my current courses, as a lab exercise we've implemented Jukes-Cantor and Poisson in a scaled down bioinformatics-esque setting. Are these models still in use?

Date: 2008/09/06 08:30:59, Link
Author: dnmlthr
Weird, where did afarensis' comment go?

Date: 2008/09/06 12:44:33, Link
Author: dnmlthr
[Graffiti moved to Bathroom Wall. -Admin]

Quote (Richardthughes @ Sep. 06 2008,18:23)
Hey! how exactly is this 'Graffiti'?

Perhaps 'graffiti' in the sense that you intentionally try to push his buttons?

Date: 2008/09/06 13:55:26, Link
Author: dnmlthr
Quote (Richardthughes @ Sep. 06 2008,18:58)
Quote (dnmlthr @ Sep. 06 2008,12:44)
[Graffiti moved to Bathroom Wall. -Admin]<br/><br/>
Quote (Richardthughes @ Sep. 06 2008,18:23)
Hey! how exactly is this 'Graffiti'?

Perhaps 'graffiti' in the sense that you intentionally try to push his buttons?

DaveTards? Absolutely! ANYONE like that deserves to get their buttons pushed. It's not like a made 'graphic scatological' comments or anything!

Doesn't really strike me as a worthwhile endeavour, to be honest.

Date: 2008/09/07 05:00:08, Link
Author: dnmlthr
GUN NUT NINJA WISHES YOU A HAPPY BIRTHDAY

Date: 2008/09/07 09:58:44, Link
Author: dnmlthr
In a couple of hours: At the gates on their final tour!

Date: 2008/09/07 16:32:10, Link
Author: dnmlthr
Quote (Erasmus @ FCD,Sep. 07 2008,16:05)
if it hadn't been for George W Bush handing me back some cash I wouldn't have been able to go.

It was great! I've never seen a death metal band in such a jolly mood before.

Edit: They opened with slaughter of the soul(!)

Date: 2008/09/08 12:48:17, Link
Author: dnmlthr
This forum could use a mascot, imho. And here's a suggestion

Date: 2008/09/08 12:57:56, Link
Author: dnmlthr
Quote (J-Dog @ Sep. 08 2008,18:52)
Quote (dnmlthr @ Sep. 08 2008,12:48)
This forum could use a mascot, imho. And here's a suggestion

It's BEAUTIFUL!  I am sure that ID will try to co-opt it.

They are hardy little critters too, they've even survived the harshness of space. Not unlike the unsinkable rubber duckies of ID, as intellectual vacuum doesn't seem to become them in the least.

Date: 2008/09/10 17:11:03, Link
Author: dnmlthr
I assume you've heard of Spore, behold Poe's Law in action.

Date: 2008/09/13 03:22:26, Link
Author: dnmlthr
Quote (Lou FCD @ Sep. 13 2008,01:39)
So uh, Crazy Larry is apparently having a seizure over at Kevin Vicklund's place.

Maybe he wants the bottle?

Date: 2008/09/15 01:35:14, Link
Author: dnmlthr
Quote (Ftk @ Sep. 15 2008,05:12)


Yeah, Levi looks like a guy who'll hate raising his kid.


And here' a few choice quotes from the guys myspace page.

 
Quote

On his MySpace page, Johnston boasts, "I'm a f - - -in' redneck" who likes to snowboard and ride dirt bikes.

"But I live to play hockey. I like to go camping and hang out with the boys, do some fishing, shoot some s- - - and just f - - -in' chillin' I guess."

"Ya f - - - with me I'll kick [your] ass," he added.

He also claims to be "in a relationship," but states, "I don't want kids."


Quote

Oh, and the rape thing?  If I was raped and became pregnant, I'd have the baby.

And because YOU say you would, you'd like to force every pregnant rape victim to, too. I'll remember that the next time you think we are mean to Casey Luskin.

Date: 2008/09/15 12:24:35, Link
Author: dnmlthr
Quote (Ftk @ Sep. 15 2008,18:15)
Hmmm....I thought I already did.

But what is your position with regard to policy?

Date: 2008/09/19 11:39:16, Link
Author: dnmlthr
Quote (Ftk @ Sep. 19 2008,04:59)
 
Quote
It benefits us because it's one more piece in the vast jigsaw puzzle of the history of how we got here.


So, it benefits us in an historical sense.  It helps us try to solve the puzzle about how we may have evolved from a primitive human via some apeish type ancestor.

Right?

Okay, what else.  How does finding this jawbone benefit us other than in an historical sense.

The argument from final consequences
Using perceived consequences (usually negative ones) of a statement as an argument against the truth value of that statement.

For example "evolution let to Hitler's holocaust, therefore evolution is false". Even if that statement were to be true, it has no bearing on the argument whether evolution is a valid theory or not.

Just to spell it out for you, ftk, questioning the usefulness of a line of research does not in any way act as a valid argument against the findings of that line of research.

Date: 2008/09/19 16:48:03, Link
Author: dnmlthr
Quote (Tom Ames @ Sep. 19 2008,22:43)
Quote (Ftk @ Sep. 19 2008,14:21)
So, are you saying that without the assumption that every organism found in nature today evolved from that first primitive molecule that made it's way out of the warm pond, we could not have constructed relatively accurate  phylogenetic charts?

No, I am not saying that. I'm not saying that at all, and I don't understand how you could have read that into my response.

My post was answering your question about what material value there is in learning the details of primate evolution, as exemplified in your example of finding a pre-human jawbone.

I'd like you to notice that I took a great deal of care in responding sincerely and respectfully to your question, and that I assumed that you were looking for an actual answer. Please do your best to return the respect that I showed you. If you care to respond, kindly do so with regard to my actual argument.

Thank you.

You must be new here.

Ftk: Can you order a cup of coffee without resorting to a logical fallacy?

Date: 2008/09/22 10:36:38, Link
Author: dnmlthr
Quote (Ftk @ Sep. 22 2008,16:25)
Wes, I said I wasn't trying to make a point...meaning I wasn't trying to support either side of the debate.  I read the article and thought that the issues being discussed early in history were interesting.  I don't care who benefits from the article.  Sheesh....

I also found it interesting that creationists had such a big part in charting the beginning outlines of the geologic table.  From what is said here, you'd think that creationists have no interest in understanding the world around them at all.  "God did it" and all that...

Somehow I doubt the people involved in mapping the geologic column IGNORED 200 years of scientific discoveries. That's a marked difference to todays creationists, don't you agree?

Date: 2008/09/22 16:36:25, Link
Author: dnmlthr
Preemptively moved to the bathroom wall.

Quote (Louis @ Sep. 22 2008,22:30)
I remember* my time as an undergraduate, and I'd like to formally apologise to any and all academics at all points in history.

Louis

*Well, "remember" is something of an exaggeration.


Being an undergraduate myself, I'm assuming you remember the retelling of your various exploits by shocked and disgusted bystanders?

Date: 2008/09/23 00:44:36, Link
Author: dnmlthr
Quote (Reciprocating Bill @ Sep. 23 2008,02:11)
Quote (Ftk @ Sep. 22 2008,20:58)
Guess what?  I don't give a flying f*ck how "science works".

Clearance on signature items, today only!

I think I just might take you up on that!

Date: 2008/09/23 14:31:35, Link
Author: dnmlthr

Date: 2008/09/23 14:53:25, Link
Author: dnmlthr
Quote (keiths @ Sep. 23 2008,20:39)
Every time I see that photo, I think for a minute that he's holding a pair of handcuffs.

I love it so!

Date: 2008/09/27 07:54:02, Link
Author: dnmlthr
FTK: For future reference, the gish gallop doesn't translate well into text.

Edit:
Here's a programmer's take on the retrovirus argument, I'm no biologist by any stretch of the imagination.

For the common design argument working in the context of ERV's in the genome of humans and chimps the following would need to be true:

- Retroviral DNA would have to be inserted in the same place in germ cells of both chimps and humans
- Mutations in the inserted retroviral DNA would have to be synchronized in both lines (which don't interbreed) up until a point where they start to differentiate
- From that point on, the differentiation would continue according to the mutation rates of chimp and human populations

You can either postulate a so far evidence-less mechanism that synchronizes mutations in originally retroviral DNA between species that don't interbreed, which is a major premise to just chuck into the discussion - OR you can look at a mechanism (that would be common descent) that explains the phenomena and as a bonus has extraordinary amounts of physical evidence to its name. Occam's razor.

I would love corrections from the more biologically literate members of this board

Edit2: Speling. Edit3: Clarification.

Date: 2008/09/27 08:33:55, Link
Author: dnmlthr
Quote (afarensis @ Sep. 27 2008,14:32)
Quote
Suffice to say, Luskin should really refrain from talking.


There, I fixed it...

I disagree. With friends like Luskin, who needs enemies?

Date: 2008/09/29 14:43:06, Link
Author: dnmlthr
Quote (Arden Chatfield @ Sep. 21 2008,03:26)
I'm not sure why, but I laughed until tears were rolling down my face to this one.

I listen to stuff like that. Without laughing.

I highly recommend Nasum, they were great.

Date: 2008/10/02 02:44:57, Link
Author: dnmlthr
Quote
"We should teach students 21st-century science, not some watered-down version with phony arguments that nonscientists disingenuously call 'weaknesses,' " said Sahotra Sarkar, a professor of integrative biology at UT. "Calling 'intelligent design' arguments a weakness of evolution is like calling alchemy a weakness of chemistry, or astrology a weakness of astronomy."

Nice and accurate zinger. As an added bonus, the most upvoted comments to the article were favourable to the argument Sarkar brought forth as well.

Of course, many other comments delved into the classics: teach the notroversy, just a theory etc.

Edit: Formatting.

Date: 2008/10/03 16:05:55, Link
Author: dnmlthr
Quote (Tony M Nyphot @ Oct. 03 2008,21:56)
If, as you say, she is a good representative of who you are...Do you think you would make a competent VP?

Date: 2008/10/03 16:32:02, Link
Author: dnmlthr
Quote (Ftk @ Oct. 03 2008,22:21)
Elitist!


Is this a respectable source?

Quote

Stein says that as mayor, Palin continued to inject religious beliefs into her policy at times. "She asked the library how she could go about banning books," he says, because some voters thought they had inappropriate language in them. "The librarian was aghast." That woman, Mary Ellen Baker, couldn't be reached for comment, but news reports from the time show that Palin had threatened to fire Baker for not giving "full support" to the mayor.


Censorship is pretty elitist, don't you think? Granted, she wasn't able to pull it off, so I guess that doesn't count...

Date: 2008/10/03 17:11:10, Link
Author: dnmlthr
Quote (Arden Chatfield @ Oct. 03 2008,22:37)
No, no, NO. I can see you don't understand this whole elitism thing at all.

Reading a lot MAKES you elitist, so in fact Palin was attempting to prevent elitism in future generations. For this I can admire her.

I stand corrected.

Just goes to show that if we work hard enough we might just have a cure for literacy within our lifetime.

ETA: GO TEAM!

Date: 2008/10/06 11:03:40, Link
Author: dnmlthr
MIT has the material for 40+ undergraduate biology courses available online through the opencourseware program. This includes written material (from the site) and many lectures in both audio and video format (from iTunes U).

The "introductory biology" course of spring 2005 seems to be complete with both video lectures and PDF transcripts of the same.

This makes for a perfect opportunity to test your assertion that obvious falsehoods are taught as fact at the college level.

Date: 2008/10/06 16:07:14, Link
Author: dnmlthr
Quote (Louis @ Oct. 06 2008,21:54)
It's things like this which demonstrate most clearly why I think any approach to discussion with FTK at anything above the high school level is futile. She simply doesn't have the understanding or knowledge to participate in any discussion at any level beyond that.

Hence why, in all seriousness, I asked her three incredibly simple questions a few pages back which she has yet to answer (even though I've answered them for her). These answers would require her to make one simple post containing about 10 words in total. Vastly less than she has wasted Blipey's wickedness.

Louis

I think it's pretty obvious by now that ftk isn't at all interested in any form of substantive exchange. She's just been trolling for quite some time. Perhaps it's always been like that, I guess I haven't been around for long enough.

Date: 2008/10/06 16:52:27, Link
Author: dnmlthr
Quote (oldmanintheskydidntdoit @ Oct. 06 2008,22:31)

I'd better PM you the link to my last post then, just in case you "miss" it.


As a sidenote, in a course I'm currently taking on programming paradigms, bioinformatics has been a recurring theme. So far we've done some simple calculations such as distance matrices and building phylogenetic trees based on those. Interesting stuff.

I know this isn't the thread for it, but do you know of any resources where I could look up amino acid and DNA sequences? We've got some test data to play with, but I don't know if it's the genuine article...

Date: 2008/10/06 17:08:25, Link
Author: dnmlthr
Quote (Louis @ Oct. 06 2008,23:03)
Wow, my thread has been successfully spammed with porn. I'm so impressed.

Louis

Not only that, the spambot quoted you as well. I didn't know you used to post things like that!

Date: 2008/10/07 01:16:28, Link
Author: dnmlthr
Quote (oldmanintheskydidntdoit @ Oct. 06 2008,23:12)
Quote (dnmlthr @ Oct. 06 2008,16:52)
       
Quote (oldmanintheskydidntdoit @ Oct. 06 2008,22:31)

I'd better PM you the link to my last post then, just in case you "miss" it.


As a sidenote, in a course I'm currently taking on programming paradigms, bioinformatics has been a recurring theme. So far we've done some simple calculations such as distance matrices and building phylogenetic trees based on those. Interesting stuff.

I know this isn't the thread for it, but do you know of any resources where I could look up amino acid and DNA sequences? We've got some test data to play with, but I don't know if it's the genuine article...

At some point I'll get my OpenGL skills out and program something (simple) along those lines, but at the moment I'm more into 3D and trying to learn about the GPGPU powerhouse I have sitting in my PC. GTX 280 don't ya know

This seems to be what you want
http://www.bioscience.org/urllists/protdb.htm
but many of the links appear dead. I've nothing more specific I'm afraid, I'm only an interested amateur. :D

EDIT: the specific pages linked to are out of date, but the domains are usually there.

EDIT EDIT: Yay, DNA! http://rsat.scmbb.ulb.ac.be/rsat/ GATGTGTTACACATGCATCAACTATTTACATCTATCCTTGTTCACCCAAGCATGTCACTG

Nice, thanks!

Date: 2008/10/08 13:26:16, Link
Author: dnmlthr
Quote (Jkrebs @ Oct. 08 2008,19:10)
I'm in agreement with FtK here, for the most part.  FWIW and YMMV.

Oh my, if this isn't sig-worthy I don't know what is, context be damned.

Date: 2008/10/08 14:57:21, Link
Author: dnmlthr
Quote (Ftk @ Oct. 08 2008,20:07)
You folks try to convince us that there are virtually no supporters of creation science, yet look how much money they raised for something they thought was important.  So, think of all the cash you folks could generate seeing as there are millions upon millions of supporters of "good" science.

That's not at all we are saying. We (meaning non-antievolutionists) are saying that there is no EVIDENCE in favour of it.

Date: 2008/10/09 01:29:44, Link
Author: dnmlthr
Quote (dheddle @ Oct. 08 2008,17:37)
But don't ask me about McCain anymore. I don't particularly like McCain. I'm voting for Palin.

If you don't mind me asking, is it because you think she's a good candidate or the least bad or for some third reason?

Date: 2008/10/09 10:32:27, Link
Author: dnmlthr
Quote (dheddle @ Oct. 09 2008,12:35)
Quote (dnmlthr @ Oct. 09 2008,01:29)
 
Quote (dheddle @ Oct. 08 2008,17:37)
But don't ask me about McCain anymore. I don't particularly like McCain. I'm voting for Palin.

If you don't mind me asking, is it because you think she's a good candidate or the least bad or for some third reason?

It is because I think she is a great candidate. Obama is a good candidate. McCain is a mediocre candidate. And Biden is a loser.

What in particular led to that conclusion? I guess what I'm going for is what quality she (and possibly Obama, to a lesser extent) possesses that the rest lack that makes you so enthusiastic.

Date: 2008/10/09 13:39:08, Link
Author: dnmlthr
1-3, 5: I have nothing to say about those.
4: Detailed present knowledge might be overrated, however an INTEREST in the same is not. A distinct lack of the former points to the latter.
6. And I would prefer to be mauled by a cute bear than an ugly one.
7. We simply have to agree to disagree on this one. Appeals to tribalism or a willful suspension of disbelief is not an admirable quality in a political leader IMO.
8. As a matter of principle, I'm not opposed to this point. However, being separated from the action by way of a rather major ocean, the only knowledge of her leadership skills that have filtered through does not exactly make your point. I'm thinking specifically about (as Palin herself later calls it) the rhetorical question of censoring books at the Wasilla library.

As for my own stance, I've never met (or seen or heard) a politician that I didn't harbor a deep rooted distrust for, so I have to admit that the very thought of enthusiasm for a candidate is alien to me.

Edit: I'm with Louis 100% in that the process is interesting and specific choices are not.

Date: 2008/10/09 14:59:38, Link
Author: dnmlthr
But first, please fix these logical problems: conclusion as premise, straw man argument, false dichotomy

Date: 2008/10/09 16:10:33, Link
Author: dnmlthr
Penile dysfunction drug spammer in the telic thoughts thread

ETA: Two fake-quoting spammers within a day or two, must be a new bot around.

Date: 2008/10/10 17:47:24, Link
Author: dnmlthr
Quote (Louis @ Oct. 10 2008,21:01)
Yawn, when's this farce over so the world can get back to standard dullness as opposed to whiny partisan anti-intellectual dullness?

Don't fret Louis, here's something you can vote for

Date: 2008/10/11 11:59:37, Link
Author: dnmlthr
More spam

Should I stop linking to the spam here, or is it a good idea?

Date: 2008/10/11 14:22:43, Link
Author: dnmlthr
Point taken. I had succeeded in completely missing that link all this time(!)

Date: 2008/10/11 18:02:12, Link
Author: dnmlthr
Quote (carlsonjok @ Oct. 11 2008,23:54)
Okay, which one of you assholes is Terry Fillups?

I predict a swift bannination with a side dish of loudspeaker + ensuing post-ban discussion among the UD regulars.

I also predict that the sun will rise tomorrow.

ETA: grammar

Date: 2008/10/13 08:42:25, Link
Author: dnmlthr
dheddle: How does one vote for a VP?

1. Vote on the presidential candidate hoping he/she croaks before his/her term in office is over?
2. Vote for the VP directly?
3. ?
4. Profit!

Date: 2008/10/13 09:26:38, Link
Author: dnmlthr
Quote (dheddle @ Oct. 13 2008,15:00)
When I  get to the ballot, it will read something along the lines of "Electors for President and Vice President of the United States" and one of the choices will be John McCain (Arizona) and Sarah Palin (Alaska). I'll mark that one.

Does that mean #1? ;)

Quote

FACT: The number of middle fingers in a "progressive" crowd is directly proportional to the number of PhD degrees in the ten-block radius.

FACT: Islamic radicals would be more welcome on the Upper West Side than American patriots.

The "liberals" always extend their sympathy for being bullying and rejected... not to the American patriots... but to America's enemies.

"Liberal" elites believe that all ideologies are morally equal... except the one that supports capitalism and individual liberties... ... the only ideology that makes their lavish lifestyles possible. ... and so they're driving it out of town, tarred and feathered.

Republicans in New York: less equal than others.

When leftist politicians are promising you to bridge the divide... ... they are "selling you a bridge."

The leftist idea of unity is, and has always been... THE ELIMINATION OF DISSENT


Seriously though, that video is pretty lame. Jeering and suggestive gestures = nazi germany or throwing people to the lions? No matter your ideology, that type of hyperbole is just silly. Did you even watch the whole thing?

I'm studying for the midterms atm, so it provided a welcome distraction from the only uninteresting math class I've ever taken.

Date: 2008/10/13 12:14:48, Link
Author: dnmlthr
Quote (stevestory @ Oct. 13 2008,18:03)
Quote (Zachriel @ Oct. 13 2008,12:17)
Quote
tragic mishap: Can’t get a better sound byte than this: Obama lied about his place of birth to cover up the fact that he’s ineligible to be POTUS. Game over.

"Game over"? This is like antievolution all over again. A few total idiots making up their own reality on the internet, imagining heroic victories, while the regular world continues without them.

Davescot is quite fond of conspiracy mongering.
Does anybody remember DCA, a chemotherapeutic agent sold as a drug for 150lbs "pets" without clinical trials?

Date: 2008/10/13 14:04:00, Link
Author: dnmlthr
Quote (Daniel Smith @ Oct. 13 2008,19:17)
How can one make a prediction without assuming their own conclusion?

When scientists make predictions based on the TOE, they're assuming that the TOE is correct and basing their predictions on that assumption.

Your prediction, and the test of that prediction, is based on a negative, which is a backwards way of going about things. What your are basically saying is "meet my demands or goddidit". You are making the claim, the onus is on you to provide the evidence.

Quote (Daniel Smith @ Oct. 13 2008,19:17)

I am basing my prediction (that no solution will ever be found for the OOL) based on the assumption that we live in a God-centered universe.

What would it take to invalidate your prediction?

Contrast that with the prediction that preceded the find of Tiktaalik.

Date: 2008/10/13 14:32:28, Link
Author: dnmlthr
Quote (dheddle @ Oct. 13 2008,19:43)
It appears that there is, oh, a 99% chance that "change" is coming and a 1% chance that "reform" is coming.

I don't believe either. I'll stick to good 'ole divinely inspired scripture. There's nothing new under the sun.

I think you enjoy playing the little contrarian a little bit too much since the only thing you're actually doing is drive-by linking and little to no discussion.

Do you stand by the text in the video you linked? Do you consider booing and rude gestures the same as throwing people to wild animals and/or murdering them by the millions?

Here's my take on the people that made the video: How fucking sheltered does one have to be to make comparisons like that? Utterly pathetic.

Date: 2008/10/13 14:56:54, Link
Author: dnmlthr
Quote (dheddle @ Oct. 13 2008,20:46)
I don't know what your point is. Nor does the quote seem to match your comment. I don't "stand by" anything in that video other than the fact that it proves there are jackasses on both sides of the aisle. Obama supporters can be as rude, stupid, belligerent, ignorant, and crass as lowlifes from other groups. That was my point.

People are assholes, is that supposed to be news to anyone?

There's posting links and then there's posting links and ignoring the ensuing discussion, don't you think?

 
Quote (Video @ Youtube)

FACT: The number of middle fingers in a "progressive" crowd is directly proportional to the number of PhD degrees in the ten-block radius.

FACT: Islamic radicals would be more welcome on the Upper West Side than American patriots.

The "liberals" always extend their sympathy for being bullying and rejected... not to the American patriots... but to America's enemies.

"Liberal" elites believe that all ideologies are morally equal... except the one that supports capitalism and individual liberties... ... the only ideology that makes their lavish lifestyles possible. ... and so they're driving it out of town, tarred and feathered.

Republicans in New York: less equal than others.

When leftist politicians are promising you to bridge the divide... ... they are "selling you a bridge."

The leftist idea of unity is, and has always been... THE ELIMINATION OF DISSENT


The above is text from the video. What do you think of it?

Date: 2008/10/13 16:11:03, Link
Author: dnmlthr
I am completely unfamiliar with these email lists. Were they about voicing opinions or simply punishing the media outlets by drowning them in form emails?

Date: 2008/10/13 17:29:46, Link
Author: dnmlthr
Are they really even trying? I've read only a few of their arguments and all they've got so far is circular reasoning and bible passages.

Date: 2008/10/14 13:58:38, Link
Author: dnmlthr
The pseudoscience questions surprised me as well. How does astrology fit into the existing scales?

Or do they have an imaginary axis that isn't reported to the submitter?

I'll get me coat.

Date: 2008/10/16 12:49:03, Link
Author: dnmlthr
A racist party, born out of the ashes of a movement in the 80s whose name roughly translated into "keep sweden swedish" are in some polls edging closely to the 4% needed to get into parliament. Granted, they've had to put a slight "wink wink nudge nudge" face on their racism, but I fear a resurgence of naked racist rhetoric like we've seen in for example austria and the netherlands (and here in the 90's as well).

Date: 2008/10/16 13:07:41, Link
Author: dnmlthr
Quote (dheddle @ Oct. 16 2008,19:01)
That made me think of this:


- Come in, my child, join the party.
 
- Let me see, you would be from Austria. Am I right?
                 
- No, I am Inga from Sweden.

- Sweden? But you're wearing Lederhosen.
 
- Je, for sure, from Sweden. Please, help me with my rucksack.


 
And now I can't stop.

Pre-emptive bork bork bork deployed

Date: 2008/10/18 17:43:59, Link
Author: dnmlthr
Quote (bystander @ Oct. 18 2008,23:21)
I just voted and it is suspiciously 50%/25%/25%. I wonder if it has been reset.

How sad isn't rigging your own poll, if that's what they've done? Sadder than this.

Date: 2008/10/20 01:47:15, Link
Author: dnmlthr
Quote (Dr.GH @ Oct. 20 2008,06:24)
In the first draft of my dissertation I tried to invent the notion of "over determined" as opposed to "under determined."

One professor really liked the idea. I cannot remember exactly what I meant.

Was it similar to the mathematical use of the term?

Date: 2008/10/20 11:13:05, Link
Author: dnmlthr
One midterm down, another coming in 40 hours.

Alright, alright I'll get off your lawn, no need to point that thing at
me!

Date: 2008/10/20 14:19:18, Link
Author: dnmlthr
Quote (Henry J @ Oct. 20 2008,19:58)
Quote (Venus Mousetrap @ Oct. 20 2008,08:21)
and the top link goes to this wacky site about neo-darwinism, Gaia and stuff. Maybe I should take them away... I already had to remove a creationist model of the hydrogen atom from there :p

Why would a creationist model a hydrogen atom differently than anybody else?

Their model contains tiny tiny jesuses instead of quarks.

Date: 2008/10/22 08:19:42, Link
Author: dnmlthr
Quote (Quack @ Oct. 22 2008,12:00)
I really wonder how long the secular paradise we have here in Scandinavia will survive. With constant, and probably even increasing immigration from remote cultures and religions, I believe we eventually may reach a condition where a dramatic shift may take place.

In 1900, Sweden had a population of 5136441 people.
Between 1900 and 2007, 3010947 immigrants came here, 2064730 emigrated and 11977865 were born while the overall population grew to 9182927. I do not consider that a dramatic shift in demographics.

The largest immigrant group is people from finland by the way, traditionally not a very religious country.

I also don't agree with your assertion that scandinavia (though I'm only aware of how things are in sweden) is or has ever been some sort of paradise, secular or otherwise. One of the incumbent parties right now are the "christian democrats" and they are effectively blocking gender-neutral marriage laws, just to make an example.

Source: Statistiska centralbyrån

Edit: Speling, grammar, formatting.

Date: 2008/10/24 12:58:42, Link
Author: dnmlthr
I hope this isn't off topic, being a politics thread and all, but this video broke something in me: a member of Iraq veterans against the war getting stomped in the face by a police horse.

I've seen riots up close and personal and that guy certainly doesn't seem like someone who can be credibly called a threat to the police officers present from what I can see.

Date: 2008/10/25 11:30:05, Link
Author: dnmlthr
Quote (Louis @ Oct. 25 2008,17:27)
Hmmmmm perhaps I shouldn't post after 6 pints of Guinness and a loss to Cardiff Blues by the Tigers. It seems to make me mean.

Pfffff it matters not.

Louis

Louis a mean drunk? I would never have guessed it!

Date: 2008/10/26 10:13:37, Link
Author: dnmlthr
Quote (dheddle @ Oct. 25 2008,22:00)
I listened to her speech again and I concede, there is no way to put a positive spin on it.

The world would be a better place if words like these were said more often.

Date: 2008/10/26 12:21:54, Link
Author: dnmlthr
Quote (stevestory @ Oct. 26 2008,17:56)
Philip Berg's kook lawsuit w/r/t Barack Obama's birth certificate has been thrown out. The wingnuts all responded that the judge, R. Barclay Surrick, must be a reasonable fellow and so much for that then. Just kidding!

http://www.therobingroom.com/Judge.aspx?ID=698

Does election season always bring out the internet tough guys?

Date: 2008/10/31 02:49:26, Link
Author: dnmlthr
Quote (bystander @ Oct. 31 2008,08:17)
If the mind is separate, does he explain why we get drunk? or sleep?

I guess it's the duality of the gaps. Whatever hasn't been explained by neuroscience yet, that's the soul dontchaknow.

Date: 2008/11/01 15:04:32, Link
Author: dnmlthr
Daniel Smith: Not to mention the fallacious reasoning at the core of your argument - that evidence against evolution would constitute positive evidence for your pet theory by default.

Date: 2008/11/01 20:19:23, Link
Author: dnmlthr
Quote (Dr.GH @ Nov. 01 2008,23:37)
I get the notion that D'Tard is about to get dumped. Events will tell.

But where will he be able to pull off his internet tough guy routine then? Will he have to go back to shilling for DCA on Oracs blog?

Only time will tell.

Edit: Removed offtopic rambling.

Date: 2008/11/05 03:52:48, Link
Author: dnmlthr
Quote (CeilingCat @ Nov. 05 2008,09:12)
If your brain couldn't change, you'd be brain dead.  Err..

Aha! Take that atheist darwinist nazi neuroscience! Waterloo!

Date: 2008/11/05 13:38:18, Link
Author: dnmlthr
Quote (Maya @ Nov. 05 2008,16:35)
Billy, if you really want to make some cash, have a public falling out with the Discovery Institute and re-invent yourself as a skeptic.  You can just reverse all the unsubstantiated "I used to be an atheist" testimonials and sell tell-all books to the rational community.

Since ID has the predictive power of Sylvia Browne, he could always try fortune telling.

Edit: Fixed incomprehensible grammar.

Date: 2008/11/12 16:27:22, Link
Author: dnmlthr
Quote (Louis @ Nov. 12 2008,20:40)
He did turn me into a newt, but luckily I got better.

Aaaw, good for you.

Date: 2008/11/13 16:29:13, Link
Author: dnmlthr
Oh well, at least we will always have paris the tard.

Date: 2008/11/13 17:14:38, Link
Author: dnmlthr
Hope you had a good, possibly drunken, one!

Date: 2008/11/23 04:14:43, Link
Author: dnmlthr
Congratulations!

Date: 2008/11/27 17:50:23, Link
Author: dnmlthr
You can save space by comparing a hash (using sha1sum or md5sum or something similar) of the latest downloaded file to that of the incoming one.

Less to read through as well.

Date: 2008/11/28 02:10:43, Link
Author: dnmlthr
Quote (Reciprocating Bill @ Nov. 28 2008,03:09)
Quote (stevestory @ Nov. 27 2008,19:11)
BTW, to anyone with Linux or Mac, this might be really easy. You might already have wget preinstalled. Try pulling up a command line and just typing wget. If you've got it, you're halfway there. The rest is easy.

The Mac ships with Curl installed rather than Wget. It's powerful, with a zillion options. Pointing it at www.uncommondescent.com with no options pulls down the top level (a steaming pile of html) directly into the terminal.

I don't often venture down to the Mac BSD cellar (aptly named "Darwin") so it will take a bit of squinting and a furrowed brow to get down a level.

Unless somebody here has some guidance...

[eta] I see the option for saving to a file...

I use MacPorts when there's some piece of UNIX software that I need.

Date: 2008/11/28 05:16:20, Link
Author: dnmlthr
With the recent wget/curl discussion on the UD thread I figured a dedicated thread to computing woes might be in order.

Date: 2008/11/28 11:24:15, Link
Author: dnmlthr
Quote (Henry J @ Nov. 28 2008,17:03)
So how does one compute a woe, and what's the unit of measurement for those? :p

I believe it's measured in Dells.

Date: 2008/11/29 05:51:13, Link
Author: dnmlthr
Yay, one final down, one to go. Time to get drunk.

Date: 2008/11/29 08:10:51, Link
Author: dnmlthr
Quote (Lou FCD @ Nov. 29 2008,13:35)
Quote (dnmlthr @ Nov. 29 2008,06:51)
Yay, one final down, one to go. Time to get drunk.

Go you!

Seem like it went well?

It was definitely the easiest I've had so far, which was a nice change of pace.

What does your semester look like?

Date: 2008/11/30 10:44:39, Link
Author: dnmlthr
Quote (oldmanintheskydidntdoit @ Nov. 30 2008,16:34)
 
Quote
So, my designer is an unknown entity who possesses knowledge and capabilities far beyond human understanding.  Let's just call him "God" Satan shall we?


There, fixed that for you Danny boy. How do you know it's gawd and not the zub?

I tell you, sometimes my knee hurts something rotten. Makes more sense that the "perfect" designer had nothing to do with it and his bad sheep brother had everything to do with designing the awfulness that is the human spine, knees, waste/reproductive system etc.

Tell me again about the elegant design of the positioning of the human reproductive system.

Here are a few other candidates.

Date: 2008/12/04 13:51:59, Link
Author: dnmlthr
Quote (JLT @ Dec. 04 2008,19:21)
Sometimes I get the feeling that in reality there're two parallel universes, one in which people like StephenB live, and ours. It's only by some glitch in the fabric of the universe that we can read UD.

Do you suggest some sort of tardum tunneling phenomenon? That given enough energy, tard may tunnel through a rationality potential barrier instead of bouncing back into the UD echo chamber.

Date: 2008/12/04 14:26:34, Link
Author: dnmlthr
Quote (Bob O'H @ Dec. 04 2008,20:11)
Basta is Swedish for sauna.

Over here in Finland it is well known that basta is of inferior quality, and so we should feel sorry for Prof. Olofsson.

<know-it-all-jerk>
Basta is the verb form, that is "to use a sauna". Bastu is the noun.
</know-it-all-jerk>

Date: 2008/12/05 12:23:18, Link
Author: dnmlthr
One way of doing it would be to subscribe to the comment feed that exists for each post.

Just add /feed to the url of the post.

Date: 2008/12/05 13:52:36, Link
Author: dnmlthr
Quote (Zachriel @ Dec. 05 2008,19:34)
Quote
PaV: I don’t care to learn all about Bayesian analysis–of what use is it to me?

Prof_P.Olofsson: Just a crazy thought I had: since you have so much to say about Bayesian inference, you might want to learn what it is. I’m probably way out of line here.

I think I better save the page...

Quote
Prof_P.Olofsson: You have the following very interesting comment to make, regarding Bayesian inference:

Quote
PaV: And…..I don’t need to learn it to come to the same conclusion that Bill has come to.


Prof_P.Olofsson: In fact, it’s so revealing I won’t even comment, just let it sit there for everybody to ponder!   :)

The probability of bannination is quickly approaching 1.

Date: 2008/12/05 16:57:54, Link
Author: dnmlthr
At least the guy is consistently a crank, got to give him that.

 
Quote

The ACLU (The American Communist Lawyers Association, no, I'm sorry, it's the Anti Christian Lawyers Association)


Acronyms - you're doing it wrong.

Date: 2008/12/06 12:00:16, Link
Author: dnmlthr
When in doubt, go for lolcatspeaks's.

Date: 2008/12/07 08:52:33, Link
Author: dnmlthr
Quote (Erasmus, FCD @ Dec. 07 2008,13:46)
God watched my little boy poop in his pants this morning.  That bastard didn't try to do anything to stop it either.  He never does.

Those kind of things take a few years to deal with, but she'll get there eventually. Lot of pant-pooping kids to tend to y'know.

Date: 2008/12/09 10:23:11, Link
Author: dnmlthr
Thought you guys might find this little evolving cart simulation interesting.

Date: 2008/12/17 08:47:56, Link
Author: dnmlthr
Do text book authors in the US get paid by the word? We use "Fundamentals of physics" by Halliday et. al in a physics course now and man do they consistently take the long road...

Date: 2008/12/18 14:23:52, Link
Author: dnmlthr
The last one of this batch of finals has been dealt with. I need a drink.

Date: 2008/12/18 14:45:25, Link
Author: dnmlthr
It buuurns, it buuurns! Is it possible to fake being that obtuse in order to deny a point against one's position? Because that is pants-on-head stupid.

Date: 2008/12/18 15:38:41, Link
Author: dnmlthr
Quote (Lou FCD @ Dec. 18 2008,20:54)
Quote (dnmlthr @ Dec. 18 2008,15:23)
The last one of this batch of finals has been dealt with. I need a drink.

Yay you!

Yay me, too. I hit my last one this morning. My Spanish teacher sent our results and our course grade to us already.

I got a 100 on the Final, and a 100 for the course, too. I'm very tickled.

Nice!

Date: 2008/12/20 18:22:41, Link
Author: dnmlthr
Quote (Louis @ Dec. 21 2008,00:16)
Quote (Lou FCD @ Dec. 20 2008,22:00)
Well, you know what they say, "Always make 'em walk around a dirty horse".

{Points to quote}

Not what Carlson says....

Louis

P.S. Right I think that's everyone dealt with.*

* Isn't that {insert someone's mother's name here}'s favourite saying?**

** Ok so I'm phoning them in, we need a new line in mum jokes.

Oh, I thought you were phoning HER* in.

* Someones mother that is.

Damn, these barbs really lack the necessary bite.

Date: 2008/12/21 03:12:13, Link
Author: dnmlthr
It gets even worse and worse still.

Date: 2008/12/23 11:03:56, Link
Author: dnmlthr
Quote (Wesley R. Elsberry @ Dec. 23 2008,16:56)
The http://toarchive.org/ link is working again, one email support ticket and six "please hold" calls to tech support later. I was told on three separate occasions that my ticket was being "escalated" to administrator attention. The email I got at the close of the ticket had something about "fixing" the domain's zone record... something that makes no sense, since the hosting service is not the domain registrar for the toarchive.org domain and has no ability to change SOA or DNS records for the domain.

Nice!

Date: 2008/12/25 12:06:15, Link
Author: dnmlthr
Quote (Lou FCD @ Dec. 25 2008,18:03)
I have to admit, I'd never realized just what a pompous ass KF really is...

...mostly because I've never wasted the time to read his pompous crap.

You and me both. He/she seems to be the kind of person that replies to a yes or no question with a 2000+ word essay.

Date: 2008/12/25 20:49:21, Link
Author: dnmlthr
Quote (stevestory @ Dec. 26 2008,02:43)
I never read 2,000 word comments on blogs. Like the man said, brevity is the soul of wit.

Argumentum ad tedium. An argument which takes the following form.

Prima: "Your argument is flawed due to x, y and z"
Secunda: "<Mountains of text, none of which actually refutes Prima's argument> Waterloo!"

Edit: It's nearly four in the morning over here, it seemed funny when I wrote it. Reading it after posting, not so much. G'night.

Date: 2008/12/29 15:27:48, Link
Author: dnmlthr
Quote (J-Dog @ Dec. 29 2008,21:17)
I think kf is also the type that went to the Bad Power Point Presentation School....

Print too small, bad graphics, 150 slides where there could be 20...

And worst of all he probably doesn't move when the light turns green.

Don't forget comic sans and printed and rescanned clip art!

Date: 2009/01/05 14:27:52, Link
Author: dnmlthr
Quote (midwifetoad @ Jan. 05 2009,20:25)
Is there a hidden ID metaphor in that drawing?

Ask Ken Ham.

Date: 2009/01/06 13:49:56, Link
Author: dnmlthr
Quote (Daniel Smith @ Jan. 06 2009,19:38)
Either your links don't work or I'm missing something.  
I found no detailed evolutionary pathways mentioned in any of the messages (or subsequent links) you referred to.

Let the movement of goalposts begin!

Date: 2009/01/09 14:41:17, Link
Author: dnmlthr
Quote (stevestory @ Jan. 09 2009,03:40)
LOL. Maybe I should have said "Stop acting like a retard. You wanna end up at Uncommon Descent?"

You can call it the Tarded Straight Program.

Speaking of assembly, I have to say that the 68k instruction set is by far the nicest I've ever been in contact with, it's what I originally learned to program on way back when. NIOS II by Altera (an FPGA maker) was pretty nice too, albeit extremely limited.

Don't get me started on the x86 however, you'll never hear the end of it...

Date: 2009/01/09 15:35:10, Link
Author: dnmlthr
Quote (Louis @ Jan. 09 2009,21:30)
No need to apologise my friend, this place is positively infested with Americans, the presence of a Frenchman will only improve the place.

Louis: Don't you mean freedomman?

Schroedinger's dog: Welcome!

Edit: Fixed beer induced punctuation error.

Date: 2009/01/09 17:07:34, Link
Author: dnmlthr
Quote (stevestory @ Jan. 09 2009,22:55)
Is it just me or is there a rash of people using the wrong punctuation mark for apostrophes lately?

"He who would trade accuracy for some temporary speed, deserves neither accuracy nor speed."

That's my story and I'm sticking to it.

Date: 2009/01/09 17:56:52, Link
Author: dnmlthr
Ahem. In this thread, a series of asterisks was used as a synonym for "Ben Stein's body". Just a friendly heads up.

Date: 2009/01/09 19:26:48, Link
Author: dnmlthr
Here's a yahoo pipes thing you can use to continually get all comments from at least the most current UD threads in a single rss.

http://pipes.yahoo.com/pipes....der=rss

Simple to do and I figured it might be useful to keep track of memory holed comments.

Date: 2009/01/10 14:33:21, Link
Author: dnmlthr
Coming here trolling for hits on what seems to be a half assed home video like so many others on youtube is sadder than a million dead puppies. Don't you have any real friends you can spam with this stuff?

Date: 2009/01/11 04:02:47, Link
Author: dnmlthr
Front loading. What are the implications for free will, I wonder.

Date: 2009/01/15 15:46:34, Link
Author: dnmlthr
Quote (Lou FCD @ Jan. 15 2009,18:29)
Quote (Henry J @ Jan. 15 2009,13:26)
Quote
The rules of ID already strongly resemble MC.


ID has rules?

Just one: "Don't say God".

Thou shalt fleece the rubes
Thou shalt love it so

Date: 2009/01/18 12:45:02, Link
Author: dnmlthr
Happy birthday

Date: 2009/01/23 08:43:07, Link
Author: dnmlthr
Happy birthday, dawgs

Date: 2009/01/24 08:24:29, Link
Author: dnmlthr
A bit too close for comfort. Needless to say I've learned my lesson and will never again browse AtBC in bed.

Date: 2009/01/24 08:40:15, Link
Author: dnmlthr
I didn't mean that Lou looked anything like Fuller but rather that that picture is a wee bit too big for me to feel completely comfortable.

Date: 2009/01/24 10:39:27, Link
Author: dnmlthr
Quote (Louis @ Jan. 24 2009,15:41)
 
Quote (dnmlthr @ Jan. 24 2009,14:24)
A bit too close for comfort. Needless to say I've learned my lesson and will never again browse AtBC in bed.

LOL did it cause shock and loss of wood?

That's a question best answered by your mother.

ETA: Speling, grammar. Probably still in shock.

Date: 2009/01/25 03:57:59, Link
Author: dnmlthr
Quote (stevestory @ Jan. 25 2009,08:46)
dnmlthr (How am I supposed to pronounce that, btw?) put up the Yahoo pipes thing in the computer thread Jan 9. I referred to it here yesterday at 22:50. Since then there have been 6 comments made on UD, none of which has shown up at the Yahoo Pipes thing. Is Yahoo Pipes slow to update? Or are the UD people so hell-bent on censoring their site that they shut Yahoo's access down within minutes of us noting it on the UD thread?

stevestory: I believe pipes is pretty CPU-intensive on yahoo's side, so it'd make sense from their point of view to cache it.

The thing works like this: the main UD rss feed is downloaded, then the (comment) rss feeds of all the posts referenced in the rss feed are downloaded one at a time and combined to a single rss output.

So there are a few things that might prevent this from working:
1. Yahoo pipes is broken in some way
2. Yahoo pipes refuses to run often enough for this to work
3. The delayed publishing due to moderation on UD messes up the way yahoo processes their feeds.
4. The discussion you're after happens in entries not in the main rss feed of the site.
5. I messed up somehow, but I've rechecked the pipe and it seems to work.

Date: 2009/01/25 04:03:10, Link
Author: dnmlthr
Quote (Louis @ Jan. 24 2009,18:02)
Fuller's photo caused my mother to lose wood?
Just what was she doing to you?

Oh it was horrible, simply horrible.

Trash talk 101 by Steve Albini

Date: 2009/01/25 04:36:17, Link
Author: dnmlthr
No, I didn't. Wonder if it could have been something with the sorting. I've changed it around so that all comments are sorted by date.

Date: 2009/01/26 10:10:52, Link
Author: dnmlthr
Zachriel: Kudos for being able to take that level of the argument regarding design. I cannot even read UD anymore. It's simply too much.

I believe there's some kind of saying involving a barrel and fish that might be appropriate...

Date: 2009/01/27 03:33:01, Link
Author: dnmlthr
Quote (Arden Chatfield @ Jan. 27 2009,06:06)
It sounds like something they sing at the Bible camp where Daniel sends his kids.

Is that the one where they pray to the likeness of Dear Leader GWB, I wonder.

Date: 2009/01/27 08:58:02, Link
Author: dnmlthr
Just trying to get past the pagination bug. Going once...
ETA: Remove at will.

Date: 2009/01/27 11:20:23, Link
Author: dnmlthr
No comments on the Attenborough post as of yet, but with nuggets like these I have high hopes.

Sibley is referring to this article where Attenborough talks about receiving hate mail.

Quote
There is no excuse for Christians to send hate mail to anyone, not least because Attenborough can milk it for all its worth and avoid drawing attention to the real hate campaign against those who reject the orthodox Darwin dogma - such as has been exposed in the Expelled film. Even those who suggest that children’s beliefs should be respected in the classroom find themselves on the sharp end of the Darwinists’ Doctor Martins, such as Michael Reiss who was booted out of his position from the Royal Society for this reason.

He makes it sound like a mere tactical error.

Quote
He freely admits that he had no religious instruction in his upbringing "It never really occurred to me to believe in God - and I had nothing to rebel against, my parents told me nothing whatsoever." It shows!

What? Perhaps I'm out of the loop, but Attenborough has always seemed like a perfectly friendly and accomplished character to me. Besides, I thought ID wasn't supposed to be religious?

Quote
It is the work of intelligent design supporters that exposes the falsity of evolutionary pathways that Attenborough and his friends want to keep off our screens and out of the classroom. There is some irony that Attenborough’s new programme is called “Charles Darwin and the Tree of Life” (BBC One, 9pm, Sunday, February 1) when the New Scientists has boldly proclaimed ‘Darwin is Wrong’ on the question of the tree of life. I guess the New Scientist could have timed its front cover a little better, but perhaps Attenborough can tell us which one to believe and include in textbooks? His version or the New Scientist version?

This jab at the end concerning the New Scientist cover, which seems to be as far as the average UD denizen reads anything, was a nice touch too.

A bit more on the cover story in question is available here.

Edit: fixed spelling, formatting. Three times. I are teh suck.

Date: 2009/01/28 10:15:07, Link
Author: dnmlthr
Quote (Kristine @ Jan. 28 2009,15:03)
Yeah, and when did Darwin ever say that "if it could be shown that any change in an organism was harmful, then his theory would be overturned"?

“If it could be demonstrated that any complex organ existed which could not possibly have been formed by numerous successive slight modifications, my theory would absolutely break down.” - Charles Darwin

They're probably thinking of Charles Strawrwin. Easy mistake.

Date: 2009/01/28 11:54:51, Link
Author: dnmlthr

Date: 2009/01/28 12:46:56, Link
Author: dnmlthr
Wesley, I believe it has been moved here. Can't seem to recall a reason for it though.

Date: 2009/01/31 03:05:11, Link
Author: dnmlthr
Quote
Jeffrey Dach MD is founder of TrueMedMD, a clinic in Hollywood Florida specializing in Natural Medicine and Bio-Identical Hormones.


The word 'natural' immediately makes my woo/quack/snake oil/charlatan alarm bell go off.

From Dach's website
Quote

TrueMedMD was founded with the idea of offering medical services ignored or not offered by mainstream medicine.

Included in this list are:

1) Bio-identical hormone replacement.
2) Natural thyroid for low thyroid.
3) Natural occurring supplements rather than patented drugs.


ETA: I have nothing to add.

Date: 2009/01/31 08:33:23, Link
Author: dnmlthr
Quote (stevestory @ Jan. 31 2009,09:28)
Mystery: why do non conservatives exist.

Along with a breakdown of the causes:

Quote
 Statistical Analysis

(Estimates)

       * 30%: did not hear about conservative principles, their logic and full benefits until after they made up their mind and, perhaps due to pervasive societal bias, refuse to reconsider
       * 15%: lack of desire to find the truth, and a greater desire in gaining attention, praise by liberal teachers, getting along by going along, and not standing up to liberal bullies
       * 15%: refuse to let go of their past, especially their past mistakes and image
etc etc...

It's as hard as usual to distinguish poe from non-poe on conservapedia, however it would seem that the original author of that article is at least not a drive-by parodist.

Date: 2009/01/31 19:02:51, Link
Author: dnmlthr
Quote (stevestory @ Feb. 01 2009,00:23)
Quote (bystander @ Jan. 31 2009,19:17)
UD is so predictable. I can imagine the discourse.

proposed FAQ:The probability of structure x evolving is 10^60000000

Rationalresponse: That assumes that all of the proteins came to gether randomly in one go. Evolution acts incrementally. Here are some precursors to the structure and the fact is the structure can work without all of the proteins.

UD: Give me the maths. You don't understand probability. Tell me the exact probability of the structure evolving. Show me how the first cell came from nothing. You are stupid and biologists  know nothing. Atheists are immoral and eat babies if they could. Buy my book. You are insulting and are banned. See the Darwinists have nothing.

for the 35,402 comments we've made, UD really does pretty much boil down to that.

Don't forget shame by proxy. When someone at UD (or otherwise) says something immediately disprovable and stupid, like they are fond to do, I feel a sharp tinge of shame on their behalf. This has completely dominated my UD experience for awhile now. Is it common?

Date: 2009/02/02 09:54:53, Link
Author: dnmlthr
Quote (Louis @ Feb. 02 2009,15:32)
I was reading something about R. A. Fisher (renowned evolutionary biologist and a practising christian) recently and noted this quote:

Quote
The custom of making abstract dogmatic assertions is not, certainly, derived from the teaching of Jesus, but has been a widespread weakness among religious teachers in subsequent centuries. I do not think that the word for the Christian virtue of faith should be prostituted to mean the credulous acceptance of all such piously intended assertions. Much self-deception in the young believer is needed to convince himself that he knows that of which in reality he knows himself to be ignorant. That surely is hypocrisy, against which we have been most conspicuously warned.


I just thoght this might be relevant for some reason.

Louis

I predict the ... wait for it* ... Not A True Christian™ argument will be deployed shortly.

* No matter how much I scrub the dirt from using this expression doesn't seem to wear off :(

Date: 2009/02/02 13:22:34, Link
Author: dnmlthr
Quote
Try thowing a pile of motorcycles parts into a box willy-nilly and see how many times it takes to get a functioning Harley.


This analogy is flawed for at least the following reasons.

1. It assumes a fixed end result, that is a Harley Davidson motorcycle. It ignores other functional configurations of the existing parts or modifications thereof. Are you really so arrogant as to assume yourself some sort of goal for all of life as we know of it to have existed?



2. It assumes only one box. There is life pretty much everywhere on the planet, making evolution truly a planet-wide process.

3. I don't think you appreciate geological timescales.

Date: 2009/02/02 13:59:49, Link
Author: dnmlthr
Quote (David @ Feb. 02 2009,18:44)
I thought it would be fun to mix it up here politely on the merits, but this is fast looking like a place I don't have time for.

Have fun.

Truly a performance worthy of a slow clap

ETA: 22 minutes from introduction to flounce, is that a new record?

Date: 2009/02/03 10:43:12, Link
Author: dnmlthr
Quote (carlsonjok @ Feb. 03 2009,15:53)
Does anyone else find it interesting that FtK re-appeared on Groundhog Day?

Good catch, unfortunately it looks like we're in for six more weeks of winter :(

Date: 2009/02/04 10:15:37, Link
Author: dnmlthr
Quote (nuytsia @ Feb. 04 2009,11:57)
ETA - I have been touched by loveliness.


In a good way. In a good way!!!  :angry:

Is there any other way?

Date: 2009/02/04 11:23:28, Link
Author: dnmlthr
Quote (Louis @ Feb. 04 2009,17:05)
So in about 20 weeks time (we're obviously about 20 weeks in) I'll be the father of a bouncing baby boy***, all things being equal. This, I have decided, is Good News.

Congratulations and the best of luck! If you in 21 weeks time start engaging in near-delirious late night posting sprees we now know the reason.

Quote (Louis @ Feb. 04 2009,17:05)
Any parenting tips will be gratefully received and of course ignored as advice generally is by everyone, we'll just have to make mistakes like everyone else does.

I hear there's a blogger, "four three kids" I think, that provides excellent parenting and bird watching tips. You might want to check her blog out.

Date: 2009/02/05 11:02:27, Link
Author: dnmlthr
Disjointed conspiracy mongering will get you nowhere. No fly zones have nothing to do with evolution. Black helicopters have nothing to do with evolution. In fact, precious little of what you've written so far is even tangentially connected to evolution.

You need to focus for your writings to make any sense at all to a third party.

ETA: Because despite what you may think, WE ARE NOT INSIDE YOUR HEAD.

Date: 2009/02/06 12:47:46, Link
Author: dnmlthr
Hey now, no need to be mean.

Date: 2009/02/06 18:39:17, Link
Author: dnmlthr
Quote (Louis @ Feb. 07 2009,00:29)
Ah I didn't not know that already. Not my bad. Hail and well met, Brother (not that either of us exist you understand).

Dang it, now I'm going to have to go and flashy thing* myself.

Louis

*MIB does get credit for the best description of memory wiping device ever.

This is far too complicated after a drunken night with friends and their sugar-high offspring. I may need to bring out my best FtK impression to get past this one.

ETA: You sons of something something, grumble grumble.

Date: 2009/02/07 08:45:53, Link
Author: dnmlthr
A mathematician is a device for turning coffee into theorems. An UDiot is a machine for turning ideology into illogic.

Date: 2009/02/10 17:15:31, Link
Author: dnmlthr
Swedish creationists have managed to squeeze out a couple of editorials the last couple of weeks, mimicking their us counterparts down to the "from darwin to hitler"/expelled references and appeals to authority from - you guessed it - an engineer, an md and a mathematician.

I'll let you know if they come up with anything new. So far it's been standard creationist canards form 1A.

Date: 2009/02/13 06:35:49, Link
Author: dnmlthr
Quote (Louis @ Feb. 13 2009,11:10)
Hence, amazingly, and I may have said this before, why I recommend a little basic learning BEFORE these people bloviate about science. They aren't ready for science when they cannot manage basic thought.

Considering the willingness to, ahem, creatively quote sources, I seriously doubt anything of substance would stick.

Needless to say, you are clearly a much more generous person than I.

Edit: Tried to turn it into english.

Date: 2009/02/13 12:02:10, Link
Author: dnmlthr
Your stories remind me of "Utrota varenda jävel" by Sven Lindqvist. Available in an english translation named "Exterminate All the Brutes". You should not feel flattered by this.

Date: 2009/02/14 12:37:01, Link
Author: dnmlthr

Date: 2009/02/16 17:10:43, Link
Author: dnmlthr
Perhaps punctuated equilibrium deserves a mention? The seventies look kind of empty.

Date: 2009/02/18 10:40:11, Link
Author: dnmlthr
Hyvää syntymäpäivää, hope I didn't mangle your native tongue too badly!

Date: 2009/02/18 15:26:32, Link
Author: dnmlthr
That thread is a veritable lolmine.

Sayeth bFast:
 
Quote

71

bFast

02/18/2009 2:43 pm

B L Harville:
 
Quote

   bFast:
 
Quote

       Is it not true that all engineering is reduceable to physics?


Unless you’re going to be specific about the methods used by these engineers you’re making a statement about history, not forming a scientific hypothesis.


I saw a show a while back where scientists were using available tools to reproduce the arrowheads that they had found. Now, are you saying that there were no scientific theories about where the arrowheads came from until the scientists did this work?

The ID position is as follows:
1 - Engineering is capable of producing the class of complexity that we see in nature.
2 - Non-engineering methods, we claim, are unable to produce the class of complexity that we see in nature.
3 - Therefore either the complexity we see in nature is the product of engineering, or the theory is falsifiable by demonstrating that a non-engineering method can do the job.

If engineering can do the job, the scientist is certainly called to seek out who the engineer(s) is/are. However, science is pretty darn lame if it can’t detect design without first identifying the designer. Is your science lame?


Emphasis mine. Oh man.

Date: 2009/02/20 03:49:43, Link
Author: dnmlthr
William Wallace spotted in the wild

 
Quote
Interesting

I was just talking to my wife about sorting and the TSP, a couple of topics computer scientist professors like to use while teaching [Why attempt to solve hard problems? It's just too much like hard work.]. She has a background in math and computer science. I told her that the difference between a young computer scientist and an experienced engineer is the computer scientist will spend man-weeks figuring out how to find an optimal solution, and an engineer will spend a couple of hours estimating and implementing a solution that is good (fast-, close-enough-to-optimal, etc.) enough. E.g., bubble sort is perfectly fine for sorting small lists. [It also runs in quadratic time and thus degrades much faster than other EASY TO IMPLEMENT sorting algorithms like heapsort. Also, how do you know your lists will stay small?]

To be fair, even young engineers will spin their wheels making things more complicated than necessary for the task at hand. And to be fair to younger engineers, many engineers, young and old, let resume envy drive solutions to new problems (e.g., when the next programming language comes out, many engineers see every problem as a nail custom made for the new hammer they want so badly to use.) It is enough of a problem that I always try to ask, when a new toolset is being proposed, why, what's wrong with the tools we already have? [Hammers and screwdrivers are good for different jobs], whether it is me or others proposing a new tool. I am being paid to solve problems, not pad my resume, after all.[Is he paid to bloviate, I wonder]


Bolded comments mine.

Date: 2009/02/20 12:19:28, Link
Author: dnmlthr
I'm always happy to hear of new developments in mammalian reproduction by means of division! The alternative is both too implausible and frightening to ponder.

Date: 2009/02/20 12:30:59, Link
Author: dnmlthr
I'm far too clumsy.

Date: 2009/02/20 19:13:46, Link
Author: dnmlthr
Thank you for telling me when I'm too much of a jerk, Louis. It's hard to balance when expressing yourself in a foreign language!

Edit: It wasn't meant to sound like a weak excuse. Sucking at english is no excuse, really.

Date: 2009/02/21 06:39:44, Link
Author: dnmlthr
HA, HA this is me:

Date: 2009/02/21 11:11:52, Link
Author: dnmlthr
Well well well, how about those questions? Quit stalling.

Date: 2009/02/21 13:05:22, Link
Author: dnmlthr
Alright, hold on, let me get this straight. You willingly state that you don't know much about science, yet you are still convinced that an important part of mainstream science has to be wrong.

Don't you see the disconnect here? A yes or no answer will suffice.

Date: 2009/02/21 13:14:47, Link
Author: dnmlthr
Quote (hereoisreal @ Feb. 21 2009,19:09)
Quote (oldmanintheskydidntdoit @ Feb. 21 2009,12:20)
Quote (RFJE @ Feb. 21 2009,12:18)
Obviously something has guided the physical universe into being

How would you differentiate between a universe that had been guided into being and one that had not?

IMHO, in the one that had not, there would be no desire or need to pursue the question.  Chance never asks questions nor does it have direction, purpose or meaning.

Zero

Your willingness to pursue a hypothesis is not evidence for that hypothesis.

Date: 2009/02/21 13:36:40, Link
Author: dnmlthr
Louis, you beat me to the punch. On the topic of relying on denialist sources, I only have this to add.

Date: 2009/02/21 13:55:51, Link
Author: dnmlthr
Quote (RFJE @ Feb. 21 2009,19:47)
Quote (Louis @ Feb. 21 2009,13:27)
1) It's not Mr Louis.

2) I'll answer your questions when you answer mine.

3) You're currently studying chemistry? And STILL asking the sorts of questions you are? Get a better teacher.

Louis

I am told to not come on here preaching about things I "nothing" about.  Preaching would imply--you think you are an authority on this issue.

So I question things--not science--but hypotheses that have a purpose of explaining our origin without a designer.

I am then told my questions are stupid.  So your saying just shut up and join us.  Is that the way the entire scientific establishment does to those who deviate from THE THEORY?

Even if I become an MD or a PhD, you'll never acknowledge me as a scientist because I believe in God.  You probably would have mocked Issac Newton (who believed in God), though he co-discovered calculus.  You would probably mock my doctor who has Bible verses on his office wall.  Maybe they should take away his credentials.  That's the same reasoning you're using.  A Phd, or a MS, or a BS who works or writes articles in defense of intelligent design, and hence has an affiliation with ICR is not a scientist.  LUDICROUS!

That's quite an accusation. Back it up.

ETA: Because you would never throw accusations around without being able to back them up sufficiently, would you?

Date: 2009/02/21 15:25:49, Link
Author: dnmlthr
RFJE: You still haven't provided any evidence to back up your accusations earlier in the thread. Please do.

Date: 2009/02/21 15:31:01, Link
Author: dnmlthr
Well, you have been throwing around a fair amount of straw, not to mention unfounded accusations. I believe there's some kind of guideline regarding such behaviour in a book you've claimed to have read. I may very well be wrong however, I have never been much into scriptural studies myself.

ETA: Grammar

Date: 2009/02/21 15:35:07, Link
Author: dnmlthr
Quote (olegt @ Feb. 21 2009,21:28)
Wait, it gets better!
 
Quote
27
StephenB
02/21/2009
4:11 pm

—-Rob: “Being the honorable fellow that he is, I’m sure that StephenB will tell me what I said that he disagrees with, or retract his charge of “mindless criticism”.

I agree that the charge of “mindless criticism” is grossly unfair and borderline rude. As it turns out, though, I did not make that charge nor did I write that post @18. I noticed those comments as well, but I have no idea how they appeared there or how they arranged themselves into such an insulting formulation. Please stop accusing me of that which I did not do.

My EF tells me that StephenB is a deep-cover sock puppet.

Whoa! I've spent a fair chunk of time in the tard mines, but that's extraordinarily weak, even for UD.

Date: 2009/02/22 04:24:18, Link
Author: dnmlthr
Quote (Henry J @ Feb. 22 2009,07:32)
Quote

Just like if radiometric was called into doubt or disproved, alot of your theory would come crumbling down.


Not really. Radiometric methods given ages with considerably more precision than simply measuring the thickness of layers of rock. But rock layer thicknesses would still give the general idea, even if the margin of error might be fairly large.

Henry

Every time I read IDCists longingly wish for a day when radiometric dating has been discredited, I cannot help but to associate that with newly beaten villains from comic books of old.

You win today science, but just you wait, REVENGE WILL BE MINE!


ETA: Cat pic.

Date: 2009/02/22 08:35:51, Link
Author: dnmlthr
Quote (carlsonjok @ Feb. 22 2009,14:18)
Okay that is all for now.  The sun is up, it is going to be a beautiful day, and I have horses to ride.

Thanks for the write-up!

Date: 2009/02/22 16:26:03, Link
Author: dnmlthr
Quote
For the most part, everyone was well behaved and respectful.  Well, there was this one chick.......

Like this?

Date: 2009/02/23 02:35:54, Link
Author: dnmlthr
That thread won't make any sense at all to anyone not familiar with /b/ and ed.

Date: 2009/02/24 06:18:24, Link
Author: dnmlthr
Louis: Before calling it quits The Hellacopters made a suitable soundtrack.

The Hellacopters - Same lame story

ETA: Language.

Date: 2009/02/24 08:00:18, Link
Author: dnmlthr
Quote (Louis @ Feb. 24 2009,12:40)
Quote (dnmlthr @ Feb. 24 2009,12:18)
Louis: Before calling it quits The Hellacopters made a suitable soundtrack.

The Hellacopters - Same lame story

ETA: Language.

DAMN YOU GODS OF SWEDISH ROCK!!!!!! DAMN YOU!!!!!!

Still, I reckon the song I would have written would have been better and you can't prove otherwise so there! ;-)

Louis

An iron clad line of reasoning, I stand corrected and very much look forward to the awaiting gold records, world tours and inevitable implosion due to fights over drugs and groupies differences of opinion over wholly artistic decisions.

Any day now. Waterloo!

Date: 2009/02/24 08:57:59, Link
Author: dnmlthr
Congratulations!

Date: 2009/02/24 09:01:00, Link
Author: dnmlthr
How about this:

"False" in big letters, followed by
"Correction available upon request"

Date: 2009/02/24 15:09:21, Link
Author: dnmlthr
Quote (AmandaHuginKiss @ Feb. 24 2009,20:53)
Quote (sparc @ Feb. 25 2009,03:35)
Quote
I think that I am permanently on moderation as well.

Isn't that the normal state at UD?

I must have pleased them for a little while because my messages were going straight through.

Perhaps they thought you were another FTK? UD is a bit of a sausage fest after all.

*Ducks and runs*

Date: 2009/02/24 15:16:57, Link
Author: dnmlthr
Quote (Paul Flocken @ Feb. 24 2009,15:40)
Michael Behe is speaking in town Thursday* and I get to be in the heckle crowd.  I was hoping for some advice.  Should I go with the meat and dairy group and take the rotten eggs or should I skip the protein and stick with the classic rotten lettuce and tomatos?

*http://library.uncw.edu/web/outreach/evolution/

There are a few tips less likely to get you prematurely Expelled™ here:
http://www.antievolution.org/cgi-bin....y137256

Date: 2009/02/24 16:18:27, Link
Author: dnmlthr
Hey, when I'm being a jerk I expect to be called on it  :angry:

Date: 2009/02/24 16:44:05, Link
Author: dnmlthr
[Graffiti moved to Bathroom Wall. - Lou FCD]

Quote (csadams @ Feb. 24 2009,22:22)
I'm wondering if the male/female split is due to more technophobia among females in our* particular age group.  If AmandaHuginKiss is earning $ (or whatever currency is used Down There) fixing computers she's certainly more tech-savvy than most women I know of that age.

(*By "our" of course I mean mine and AmandaHuginKiss.  It's well known that men of that chronological age are really still just 19-year-olds in disappointing** disguises.)

(**LouFCD is of course exempt 'cause he's hawt.  Or would that be Louis?)

Using a forum doesn't need that much in the way of tech savvy, is that as much of a barrier these days? And does the requisite tech savvy divide along gender lines, I'm not so sure.

For full disclosure, I've only worked and studied in self selected groups of really geeky people for all of my adult life so I think it's safe to say that I might be a tad out of touch when it comes to these things.

ETA: This might be a discussion that while interesting is more suitable for the BW.

Date: 2009/02/25 03:48:25, Link
Author: dnmlthr
Quote (Lou FCD @ Feb. 25 2009,09:06)
 
Quote (sparc @ Feb. 25 2009,00:37)
Is there some hidden code CSI in Dembski's tie?

ETA: replaced cody by CSI

Yes. I have calculated the CSI of that tie at 4.2 X 1042. It's a special number in Science as I'm finding it occurs frequently in nature when calculating CSI. I'm going to call it "Lou's number".

If my result is incorrect, I'd be happy to have Dr. Dembski give a correction and explain how he came to his answer. Also, it'd be peachy if he could supply me with a standard unit of measurement. Otherwise, I'm going with the metric standard of "obfuscations", symbolized with the Hebrew* letter Shin (almost like a w with a dot over on the right side).





*because all the cool Greek letters have been snapped up.

I love hebrew letters in mathematics. Still find them hard to write*, but it's hard to beat the coolness of for example Aleph.



For starters, it looks like it belongs on the cover of third rate ninja movie. As if that wasn't enough, it denotes the cardinality of infinite sets, which is pretty sweet any way you look at it.

* Except with LaTeX of course. Sweet sweet LaTeX.

ETA: This is aleph null of course, couldn't instantly find a good looking aleph without subscript on google images.

Date: 2009/02/25 04:42:46, Link
Author: dnmlthr
We are digressing here, but I didn't find an aleph without a subscript unfortunately.

ETA: Thanks for pointing it out!

Date: 2009/02/26 12:41:03, Link
Author: dnmlthr
Quote (carlsonjok @ Feb. 26 2009,18:15)
Quote (deadman_932 @ Feb. 26 2009,11:39)
You called it...here's a sample of the writer's (one "Russell Huebsch" ) skills:

Interestingly there is a Russell Heubsch on Facebook and his friends include a Joshua Jackson Marks.

Also interestingly, Robert Marks personal website indicates he has a son named Joshua.

A design inference!

Date: 2009/02/26 12:49:42, Link
Author: dnmlthr
Quote (carlsonjok @ Feb. 26 2009,02:56)
Don't tell Chatfield, but I killed a gopher tonight. The college student that keeps a horse with us called from out at the barn and said she got bit by a gopher and it was heading across the backyard.

Does this mean six more weeks of winter, rain or what? I'm confused.

Date: 2009/02/27 05:39:49, Link
Author: dnmlthr
A day for delicious cake!

Date: 2009/02/27 06:36:25, Link
Author: dnmlthr
Quote (CeilingCat @ Feb. 27 2009,12:15)
I agree with you except that I don't think Wells can be counted amongst those who do or used to know how to do science.  He's a Moony pastor who was sent back to college to get a PhD by Reverand Moon Himself* solely so he could attack evolution.  To the best of my knowledge, he's never done any independent research beyond working as a member of a post-doc team.  And if I remember right, he screwed that up.

*Himself capitalized because Reverand Moon is Jesus Christ, returned to earth.  We have His word on that.

Is it even possible to get a phd without publishing anything, with or without the backing of Moon hisself?

ETA: speling

Date: 2009/03/01 13:11:06, Link
Author: dnmlthr
The entire ID argument is based on fallacious reasoning. If irreducible complexity, aka "We don't know, therefore I know", isn't a poster child for an argument from ignorance I don't know what is.

Date: 2009/03/01 13:17:01, Link
Author: dnmlthr
Hey! Don't bash the 'tash/don't knock it until you've tried it etc.

Date: 2009/03/01 13:20:02, Link
Author: dnmlthr
And now for something completely different
'Radioactive' sex offender on the run, says The Telegraph.

Date: 2009/03/02 01:01:35, Link
Author: dnmlthr
From Backyard Phenomena, the force argument regarding design is strong with this one.

 
Quote
Explore all aspects of the paranormal, from eyewitness sightings to controversial topics such as the connections between paranormal phenomena. From Bigfoot to UFOs, evolution to alternative history, every realm of the unexplained comes within your grasp here. Find connections you didn't know existed. Venture into the murky territory where phenomena merge, a zone in which many researchers fear to tread.

Evolution paranormal, unexplained, what?

It's... getting dark... don't know... if I can go on...
Quote
Both sightings and historical evidence suggest hairy hominids share a connection with UFOs. While no one can say for certain what the connection is or what it means, a few researchers like BPI's Lisa A. Shiel have posited theories about the connection. Many Bigfoot researchers seem to feel ignorance truly is bliss, as they prefer to ignore the problem of Bigfoot and high strangeness. Yet, from glowing orbs to flying saucers, UFOs have played a part in the Bigfoot enigma from the beginning. In ancient times, people carved or painted images of hairy hominids and UFOs onto cave walls, cliff faces, and other hard-to-access spots. Should we dismiss the simultaneous depictions as mere coincidence, or interpret it as something more? Other high strangeness, such as missing time or electronic beeping sounds, have surfaced in modern times.

Date: 2009/03/02 01:12:29, Link
Author: dnmlthr
Quote (JAM @ Mar. 01 2009,21:00)
Quote
If irreducible complexity, aka "We don't know, therefore I know", isn't a poster child for an argument from ignorance I don't know what is.

That's not what IC is. IC is simply a definition that does a fine rhetorical job of obscuring Behe's actual hypothesis--that structures that meet the ever-changing definition of IC must have been designed because they could not have evolved. That hypothesis makes predictions (the hypothesis, not the people pushing it).

The IC argument relies on our ignorance, as it falls back on a default explanation as soon as a phenomena is unexplained by other means. How is that supposed to be tested?

Date: 2009/03/02 05:42:07, Link
Author: dnmlthr
Quote (Louis @ Mar. 02 2009,11:29)
There is no pissing contest between myself and anyone, including Arden. I'll say this clearly so everyone gets it:

IT IS A JOKE.

There's a swedish saying that goes like this: "kärlek börjar alltid med bråk", roughly translated "love always starts with fighting".

Come to think of it, that would explain a lot about swedish mating rituals.

But I digress. I for one am appalled* by friendly banter on the interwebs.

* Not really.

Date: 2009/03/02 05:46:29, Link
Author: dnmlthr
Quote (Laminar_ @ Mar. 02 2009,10:50)
Quote (midwifetoad @ Mar. 01 2009,16:28)
 
Quote
Human designers do appear to produce features that could be mistaken for common descent.


Designers can do all sort of thngs. My comment is directed to to fact that humans frequently do transgenetic engineering, whereas the Designer does not. Hence, analogies to human engineering argue against ID as the source of pre-ge organisms.

Humans make internal combustion engines, digital computers, space rockets, wheels, light bulbs, electric motors.  Lots of the things that we make are things that are also arguably 'irreducibly complex', in other words they can't evolve - which is probably why we don't see them in nature!

ID'ots keep banging on about how they can't say anything about the nature of the designer (because there is no evidence to base any claims on) but given all the things that human designers do that nature doesn't I think there are plenty of things to talk about here!

You might find the Evolvable Systems Group at NASA interesting

Date: 2009/03/02 06:52:35, Link
Author: dnmlthr
Quote (Louis @ Mar. 02 2009,12:43)
So by pulling Arden's pigtails I'm in love with him? That's too far even for me!

If that had been the only thing of Arden's that you've been pulling, I'd see your point.

I fought the temptation, I really did. However, the setup was too much for my post-midterm nerves. I fought the temptation and the temptation won.

Date: 2009/03/02 10:32:42, Link
Author: dnmlthr
Can it be that Novella's long series of whippings have started to get to Egnor?

 
Quote
Your organization has now gone on record as opposing academic freedom in public schools. The formal alignment of several organizations of professional scientists — of which you are the most recent — with censorship of scientific discussion is an ominous development.

Science is not settled in the high school classroom. Is requiring teachers to stick to the curriculum when in the classroom trampling on their freedom of expression?

 
Quote
They have a quaint notion that science depends on the freedom to ask questions, and their insistence on academic freedom is catching on.

Think-poof, settling on an answer before even formulating the question. Apparently a fruitful way to conduct inquiry, who knew?

 
Quote
You guys are utterly dependent on taxpayers, most of whom are creationists of one stripe or another, and most of whom rank Darwinists on an ethical scale somewhere below Caribbean hedge fund operators. They think you’re a bunch of atheist brownshirts — can’t imagine why.

Because third reich wehrmacht soldiers wore "Darwin mit uns" on their belt buckles?

 
Quote
Evolution is  worthless to experimental biology and worthless to medical research.

Man, I'd hate to come to Egnor with a resistant bacterial infection.

ETA: Snark.

Date: 2009/03/02 11:16:12, Link
Author: dnmlthr
Quote (carlsonjok @ Mar. 02 2009,16:56)
Quote (dnmlthr @ Mar. 02 2009,10:32)
Quote
Evolution is  worthless to experimental biology and worthless to medical research.

Man, I'd hate to come to Egnor with a resistant bacterial infection.

ETA: Snark.

Egnor is a neurosurgeon, so he would be mucking about in your brain, not treating your strep.  Hey, but don't fret none about coming out of surgery as a changed person. He'll put your soul in his shirt pocket before operating, so it's all good.

Carlsonjok: You're right, I just figured he still has rights to prescribe  medication. Have you read his back and forth with Novella btw?

Anyway, the guy claims to speak for an oppressed 200 million head strong majority, yet he freaks out over a moved conference?

I don't get it.

Date: 2009/03/02 11:59:02, Link
Author: dnmlthr
Quote (deadman_932 @ Mar. 02 2009,17:46)
So what can we conclude about Densey's inability to get things right?

Do you know anyone who is as able to be hilariously wrong as O'Leary? If so, I want a link dammit!

Date: 2009/03/02 16:19:58, Link
Author: dnmlthr
Quote (CeilingCat @ Mar. 02 2009,21:30)
There's another name for giving up on bad alleys, but I can't remember it right now.  (Bad cold, can't think.)  Here's an example: if you're using GA to write a chess program and you test a move that gets you checkmated on the next move, you don't test the next move after that.

I've never written a GA, but it sounds a bit like backtracking as used together with exhaustive searches.

Date: 2009/03/03 07:19:55, Link
Author: dnmlthr
Quote (Dr.GH @ Mar. 03 2009,07:55)
Her cancer has returned 5 years following a second mastectomy, and is unfortunately now considered incurable.

I hate to hear that.

Quote
We are hopeful that with the anti-science swine out of the White House, medical research will catch-up in time to save her, and millions of other women's lives.

Indeed. Makes you wonder about the power of ideologically induced blinders and 'won't happen to me'-ism.

Date: 2009/03/05 07:02:50, Link
Author: dnmlthr
Quote

3. A human being is merely a collection of atoms. As such, he is utterly malleable.

What does this even mean? I'm certainly not malleable in the sense that I can be convinced by this sort of tripe but I guess I'm soluble with a suitable cocktail of chemicals. Has anyone been able to make any sense of this statement?

Date: 2009/03/05 07:05:50, Link
Author: dnmlthr
Dr.GH: Might be due to some issue with the authentication cookies. The same thing happened to me, I logged out and logged in again and now it works.

Date: 2009/03/06 02:13:25, Link
Author: dnmlthr

Hope you had a nice one!

Date: 2009/03/06 11:03:58, Link
Author: dnmlthr
Quote (olegt @ Mar. 06 2009,16:41)
Empirical evidence of tard quantization comes from kairosfocus.  He emitted 18 tardons this morning.  He called them bleats, but I think he was being too modest.

I prefer not to think of kairosfocus' morning glories tardons, thank you very much.

Quantized tard, wouldn't that lead to the phototardic effect? Absorbtion of tard of a high enough potency lead to the emission of dick jokes, or dickatrons. Would explain a lot.

Date: 2009/03/06 13:01:44, Link
Author: dnmlthr
Quote
ARGONNE, Illinois — In the basement of a nondescript building here at Argonne National Laboratory, nickel particles in a beaker are building themselves into magnetic snakes that may one day give clues about how life originally organized itself.

These chains of metal particles look so much like real, living animals, it is hard not to think of them as alive. (See exclusive video below.) But they are actually bits of metal that came together under the influence of a specially tuned magnetic field.


Swim my darlings, swim!

Date: 2009/03/06 15:59:01, Link
Author: dnmlthr
Quote (JLT @ Mar. 06 2009,21:43)
Quote
40

uoflcard

03/06/2009

10:25 am

Adel DiBagno, your opinion is certainly welcome here, unlike on blogs like Pharyngula, where I was recently told to “get the **** out” once I defended my Christian worldview after a couple attacks.


Oh yes, thank you! I really need a dose of TARD just now.

According to google, uoflcard is lying about being told to "fuck off".

I am shocked, shocked!

Date: 2009/03/06 17:29:32, Link
Author: dnmlthr
Kairosfocus cocks his gun, aims and blows his foot off.
Quote
First absolute skepticism self destructs — to claim that knowledge is impossible is to claim to know something. Oops. [KF is never above chucking some straw, ed.]

What is often done instead is to play at the selective hyperskepticism game: object to any arbitrary degree to what you don’t want to accept; while accepting things that you do want to be so on a much lower standard. The inconsistency is its own refutation.


Delicious.

Date: 2009/03/06 18:16:59, Link
Author: dnmlthr
By slapping together a simple markov chain text generator and web scraper I've built an UD of my own.

Right now the corpus just consists of the hundred or so latest comments, but I'm working on a way to further automate that process.

Would you call Poe on these comments?

Quote
All of this nature are quite useless in the universe, even if they take a strong stance against social and moral relativism.


Quote
So, processor behaviour as that of a processor and its accompanying flavor of skepticism (not forgetting that is evolutionarily-related to plastids, see if it has a long way to go and as mutations and variation made the patch more concave, the perceieved direction of insisting that evolution started somewhere in the debate of the supernatural.


Quote
Anyone who does not have been widely understood for Hegel to make a point of contention on both sides; negated often by the pseudoscience of creation science since they tend to agree with Pournelle on one point: the biggest danger today is the way they would actually learn what is metaphysically possible.

Date: 2009/03/06 18:32:25, Link
Author: dnmlthr
This is way too much fun.

Quote
(At least, I'm assuming it was intelligently designed until we learned EXACTLY how it was he who stands firm to the inference that most people continue to distruss such assertions and fairy tales for 150 years of the universe.


Quote
In this case the feeling was not unlike the experience of pleasure), but not necessarily vice-versa.


And my personal favourite:
Quote
It's like if we are using terms in quite common and standard ways.

Date: 2009/03/07 08:31:04, Link
Author: dnmlthr
Quote (Bob O'H @ Mar. 07 2009,14:12)
(sorry, only just saw this: I spent yesterday on a day trip around the Helsinki health services)

Nothing serious I hope!

Date: 2009/03/07 10:21:57, Link
Author: dnmlthr
Quote (Amadan @ Mar. 07 2009,16:15)
Before I was banned and obliviated, and while posing as UD's resident atheist ID supporter*, I suggested that the wide range of opinions that found expression in the great Dr Dr D's elegant theses could be compared to Dr Who's small but all-containing time machine.

Thing is, I *ahem* couldn't recall the name of the dratted thing. Someone, can't remember who, helpfully chimed in to say "Ooooh, askmeteacheraskmeaskme it's the Tardis!"

So for a while I could soberly discuss the importance of the ID Tardis, support for the ID Tardis, etc etc. Eventually DaveT (who at that time had the keys to the asylum) cottoned on and all my lovingly crafted posts vanished in a fragrant cloud of electrons.

Aber es war schoen.

Well played, masterful baiting.

ETA: You don't happen to have logs of the event?

Date: 2009/03/07 12:15:47, Link
Author: dnmlthr

Date: 2009/03/07 16:23:16, Link
Author: dnmlthr
This is the last round of markov-generated UD-isms, promise.

Quote
It's an interview, Denyse, not an intelligent agent.

Quote
They go so far as actual program code goes, I am convinced of its anti-intellectual orientation.

Quote
Does heat have some way of examples and Webster definitions.

Quote
For example, Dawkins is fond of talking about fairies and goblins - (clearly mythical beings that can output binary strings.

Quote
But that is shiny and hairless thus somehow matching someones definition of pseudo-science or anti-science.

Date: 2009/03/07 16:58:25, Link
Author: dnmlthr
Erasmus: It's interesting to see how fast the output improves with a larger corpus to draw from.

The programs are really rough around the edges right now, but cleaning them up should be pretty easy to do once I'm through with the midterms.

Date: 2009/03/09 14:08:04, Link
Author: dnmlthr
Optimizing compiler settings with GA

Date: 2009/03/10 17:56:25, Link
Author: dnmlthr
Mostly a bunch of podcasts these days.

Skeptics' Guide, a must
Amateur Scientist, dick jokes and sciency news
Quackcast, well researched handling of all things quackery
The math factor, puzzely mathy goodness
Math mutation
Travels in a mathematical world, varying quality
365 days of astronomy, very varying quality

Anything I should add?

Date: 2009/03/13 15:18:22, Link
Author: dnmlthr
Quote (J-Dog @ Mar. 13 2009,20:38)
OOPS!  Clive has REALLY stepped in it now!

In response to someone prompting a Resurection of Bob O, Clive asks how someone would know that Bob would be willing to come back???!!



The last couple of days seem to have seen a thermotardular meltdown over at UD.

Date: 2009/03/13 15:19:36, Link
Author: dnmlthr
Oh fucking hell.

Date: 2009/03/14 05:41:07, Link
Author: dnmlthr
Quote (digitus impudicus @ Mar. 14 2009,06:56)
Yah know, I am just surprised that no one has LOL cat'ed Louis' back, crack, and sack.

There has to be something out there, but I am just not brave enough to research it.

:O

Like this?

Date: 2009/03/15 11:53:26, Link
Author: dnmlthr
davescot, once again skinniest kid at fat camp?

Date: 2009/03/17 10:40:32, Link
Author: dnmlthr
ETA: Removed whining. Sorry about that.

Date: 2009/03/19 15:04:14, Link
Author: dnmlthr
Post break up stress. Midterm stress. Homelessness stress. I'll be back.

Date: 2009/03/19 15:18:28, Link
Author: dnmlthr
Quote (Richardthughes @ Mar. 19 2009,21:06)
Quote (dnmlthr @ Mar. 19 2009,15:04)
Post break up stress. Midterm stress. Homelessness stress. I'll be back.

Erm, sorry, goodluck, hope you find a place.

Having patient friends with couches is definitely a plus. It'll work out eventually. Alas, the situation leaves precious little time for AtBC.

Date: 2009/03/19 18:35:12, Link
Author: dnmlthr
Quote (carlsonjok @ Mar. 19 2009,22:28)
Quote (dnmlthr @ Mar. 19 2009,15:04)
Post break up stress. Midterm stress. Homelessness stress. I'll be back.

And here I was going to complain about the tragi-comedy of a business trip I was on.  Nevermind, you win the misery contest hands down.  I'll just sit here quietly and wait for my plane.

Hey guys, don't worry. It's not like I'm stuck in a fucking airport somewhere... :)

Date: 2009/03/29 06:46:19, Link
Author: dnmlthr
Off-brand erectile dysfunction medication is clearly part of the evil darwinist agenda.

Date: 2009/03/30 12:15:21, Link
Author: dnmlthr
Quote (deadman_932 @ Mar. 30 2009,17:34)
Oh, JAD's for real, all right -- he's real and he's a spectacular loony, in the crankiest sense of the word.

He *can* be funny at times, though.

JAD also makes candy? I LOVE IT SO

It rots your teeth and brain at the same time.

Date: 2009/03/30 16:47:09, Link
Author: dnmlthr
Quote (khan @ Mar. 30 2009,22:41)
The Designer™ does, of course, have a penis.

Well duh, it's designer, not designerette!

Date: 2009/03/30 16:47:48, Link
Author: dnmlthr
Congrats!

Date: 2009/04/06 04:40:56, Link
Author: dnmlthr
Quote (Hermagoras @ April 05 2009,19:16)
I just ran the latest version of Zachriel's Weasel with my 12 year old son.  He got it immediately.  We played around with it.  He was really interested in what happened if you changed the population or the mutation rate.  He thought it was interesting that when the population was really low or the mutation rate really high, the program would seem to run indefinitely.  He was also interested in why the results were different in different runs, even if the conditions were the same.  

He then proceeded to change the target phrase and see what the results were.  (He's interested in programming, so it was fun for him to tweak.)

It wasn't hard for him to understand.  Also, he thought it was pretty cool.

Awesome, warms my cold, hard programmer heart.

Date: 2009/04/06 11:20:31, Link
Author: dnmlthr
Quote (Maya @ April 06 2009,17:06)
Quote (Louis @ April 06 2009,10:04)
Oh no Maya, it would be oh so right!

Careful and responsible exercise of power is always appropriate. Using your Jedi powers to gain control of a website is fine, as long as it generates Teh Funneh.

Louis

Will you teach me to sashay?

Short skirt and batting your eye lashes won't work on CS geeks. You might have more luck with spock ears though.

Date: 2009/04/15 17:27:59, Link
Author: dnmlthr
Status update, in case you were wondering.

Homelessness: still on a variety of couches, but it looks like there's a real possibility of at least a stable year on the horizon.

School: All midterms done. Couple of papers done. Still fairly much to do, but definitely less than previously.

Work: Got a fairly large order for the summer and a job willing to fill up the rest. Looks like 2010 will be student loan free as well.

All in all things are looking a lot better than a month ago.

Date: 2009/04/15 17:37:38, Link
Author: dnmlthr
Quote (Richardthughes @ April 15 2009,23:31)
Quote (dnmlthr @ April 15 2009,17:27)
Status update, in case you were wondering.

Homelessness: still on a variety of couches, but it looks like there's a real possibility of at least a stable year on the horizon.

School: All midterms done. Couple of papers done. Still fairly much to do, but definitely less than previously.

Work: Got a fairly large order for the summer and a job willing to fill up the rest. Looks like 2010 will be student loan free as well.

All in all things are looking a lot better than a month ago.

You dynamic go-getter, you!

Oh, snap!

Date: 2009/04/16 15:46:43, Link
Author: dnmlthr
Quote (Steviepinhead @ April 16 2009,21:09)
Surely SOMEONE hear must've heard some good music or acquired a scintillating and irresistable new ax since August of last year...right?

Despite the ongoing, er, global contraction (breathe, honey, breathe!).

If so, let us know.   ;)

I got myself a Roland RE-201 Space Echo some time ago, albeit away on loan at the moment.

Date: 2009/05/06 16:10:07, Link
Author: dnmlthr
Congratulations!

Date: 2009/05/06 16:12:06, Link
Author: dnmlthr
Quote (k.e.. @ May 06 2009,18:33)
Quote

This comment has been removed to protect the guilty.

......I knew it!!!!

SO YOU ARE ARDENS MOM!!!!

I am Ardens Mom*!

* Actually, Spartacus, but who's counting?

Date: 2009/05/06 16:31:41, Link
Author: dnmlthr
Quote (Louis @ May 06 2009,22:25)
But in some way, aren't we all Arden's mum?

You could say she's the better angel of our nature.

Date: 2009/05/07 16:51:57, Link
Author: dnmlthr
Quote (Kristine @ May 07 2009,16:33)
This year has really sucked. Can I just say? Sucked with a capital SUCK. I'm on leave from school - I had to drop a class so that I don't have to many credits and be forced to graduate too early and get an ALA-unaccredited degree. (I'll graduate next year and we're sure to get the accreditation then, so it's not the end of the world - just annoying.) That means no study abroad this summer either. Rev. Barky may get laid off. Sucky. The only thing good that happened to me this year is that I was made part-time, with health benies. I think I would have lost my mind otherwise. Sucky 2009. :angry:
Okay, I'm back again.

I know this is going to sound pretty crappy, but you're solving your problems, which to me sounds like a good thing.

Date: 2009/05/07 16:53:07, Link
Author: dnmlthr
New page issue?

Date: 2009/05/16 03:40:24, Link
Author: dnmlthr
"The Princeton Companion to Mathematics", edited by Timothy Gowers awaits after this batch of finals.

Not really an encyclopedia and not really something you read cover to cover but I'm really looking forward to dig into it.

Date: 2009/05/24 12:08:22, Link
Author: dnmlthr
Quote (Lou FCD @ May 24 2009,12:45)
And I see the standard "The End Times are upon us" meme is still going strong... 2000 years we've been in THE END TIMES, when are they going to y'know, ... end?

The end times theorists haven't left the steady state model behind, it would seem.

Date: 2009/05/26 05:44:31, Link
Author: dnmlthr
Last of the finals coming up later today.

This spring has kicked my ass thoroughly, just this last little fucking thing (and a couple of paper presentations, but that's easy) left. Honestly, I don't really care how it goes, just want to get it over with.

Date: 2009/05/26 11:24:21, Link
Author: dnmlthr
Quote (dnmlthr @ May 26 2009,11:44)
Last of the finals coming up later today.

This spring has kicked my ass thoroughly, just this last little fucking thing (and a couple of paper presentations, but that's easy) left. Honestly, I don't really care how it goes, just want to get it over with.

Passed it.

Date: 2009/05/26 13:09:07, Link
Author: dnmlthr
Thanks guys!
If anyone needs me just look in a gutter somewhere.

Date: 2009/05/31 14:29:00, Link
Author: dnmlthr
Obvious sock is obvious. As for your statements, FtK has not been banned, davescot threatened to hack the forum and afdave was before my time so I have no idea of his whereabouts.

May future posts of yours be more factually correct. Välkommen.

ETA: clarification wrt afdave's status.

Date: 2009/05/31 15:23:16, Link
Author: dnmlthr
Congrats!

Date: 2009/06/01 16:04:21, Link
Author: dnmlthr
Quote (Bob O'H @ June 01 2009,18:26)
Quote (afarensis @ May 31 2009,18:28)
Quote (Louis @ May 31 2009,15:29)
Right, is it just me that doesn't speak Swedish?

Louis

I don't speak Swedish either. I think you have to know the difference between Alpine and Nordic skiing before they allow you to learn Swedish. I could be wrong though...

As long as you know what "Systembolaget" means, you'll be OK.

All of us are named either "Inga" or "Sven", might complicate things a bit.

Date: 2009/06/03 04:28:34, Link
Author: dnmlthr
Hey, congratulations! Glad to hear mom & kid are doing well.

Date: 2009/06/06 22:16:56, Link
Author: dnmlthr
All kidding aside, the puns in this thread make me die a little inside.

Date: 2009/06/06 22:18:29, Link
Author: dnmlthr
Oh man, it's 05:11, back home after a really weird night. People are fucked up y'all, haha.

Date: 2009/06/06 22:22:36, Link
Author: dnmlthr
Quote (Richardthughes @ June 07 2009,04:19)
Quote (dnmlthr @ June 06 2009,22:16)
All kidding aside, the puns in this thread make me die a little inside.

In your soul? Or like someone laced your food with arsenic? Is it more stabbed with a stilleto? Come on, cat got your tongue?

This post was sandelously bad.

ET TU TARDUS?

Date: 2009/06/06 22:30:56, Link
Author: dnmlthr
Quote (Richardthughes @ June 07 2009,04:25)
Quote (dnmlthr @ June 06 2009,22:18)
Oh man, it's 05:11, back home after a really weird night. People are fucked up y'all, haha.

... come on, give us the skinny.

It started out with a nice solo gig by Joel Gibb from The Hidden Cameras (http://www.thehiddencameras.com), I can tell you that much.

After that things got strange. Entertaining, but strange nonetheless.

Date: 2009/06/09 09:02:11, Link
Author: dnmlthr
Quote (Albatrossity2 @ June 09 2009,13:14)
Quote (Wesley R. Elsberry @ June 09 2009,07:03)
Yep, loads of fun over there, right?


Wow, that's a load of bollocks, for sure! The paragraph right after the one Wes quoted is even more of a hoot. Note how Casey has to explain his analogy for the tards (can't leave anything to chance!!!), and then fantasizes about his heroic role in this saga!  
Quote
(On the other hand, there is the rebellion against the Empire.  Small, understaffed, often outgunned and outmanned, but not outsmarted.  However, the rebellion has the people of the galaxy behind them, and most importantly, the Force.  Of course not all of us in the rebellion believe in the "force" (the analogy is God), but what unites the rebellion is the common belief in the problems with the current establishment, and the desire to replace it with something better.  When we introduced ourselves in the class, I should have said I was Luke Skywalker, but I suppose I was under the control of her powers at the time so I just said I was Casey, an earth sciences major.)

Casey Luskin - Poe on legs.

Quick Casey, use the schwartz!

Date: 2009/06/09 19:11:09, Link
Author: dnmlthr

Date: 2009/06/10 04:27:00, Link
Author: dnmlthr
Quote (jswilkins @ June 10 2009,02:40)
Where did you find that?

Shoulder tattoo generator (warning, annoying banners with audio)

Date: 2009/06/15 08:25:34, Link
Author: dnmlthr
ALRIGHTY THEN.

Quoted below is carlsons linked post, the link worked fine for me. Fear my 31173 haxx0r sk!llz.

Quote (carlsonjok @ Jan. 28 2009,19:58)
Quote (sparc @ Jan. 28 2009,13:34)
     
Quote
27 January 2009
Missile Guidance Systems and Darwinian Logic
GilDodgen

Seemingly nobody informed Gil that the most effective weapon of the ID movement is BS carpet bombing.

That is probably because no one is paying attention to Gil anymore. His repertoire is rather limited:

Pick one these:
     
Quote

a) I am a musician and evolution can't explain music and art
b) I program computers and DNA is a program
c) You can't simulate evolution without making random changes to the computer
d) I can divide 1 by a really larger and get a really small number
e) I used to be an atheist

and one of these:
     
Quote

1) therefore Darwin is wrong.
2) so I am Richard Dawkins worst nightmare
3) and anyone can see the probability is greater than the number of particles in the universe.

Concatenate the two together and you have the entirety of Gil's contribution to ID.

Date: 2009/06/16 16:02:15, Link
Author: dnmlthr
THE CAKE IS A LIE (by which I mean congratulations)

Date: 2009/06/17 03:41:50, Link
Author: dnmlthr
Clive uses the classic "I know you are but what am I?" defense.

Quote

142
Clive Hayden
06/17/2009
2:49 am

SingBlueSilver,
——”I have a question: What does ’supernatural’ mean?”

Good question. What does ‘natural’ mean?

Date: 2009/06/22 07:21:56, Link
Author: dnmlthr
Quote (Advocatus Diaboli @ June 22 2009,10:05)


I'M JERRY TARDACUS!

Fixed that for you.

Date: 2009/06/25 10:54:45, Link
Author: dnmlthr
Bah, I can't believe noone has posted this car before.



ETA: The only car actually worth posting.

Date: 2009/06/26 04:54:39, Link
Author: dnmlthr
Quote (didymos @ June 26 2009,08:24)
What is wrong with him?  I can only postulate that he actually suffers from some sort of undiagnosed delusional disorder.  Even pathological liars don't usually come up with crap this obviously wrong.  Plus, they'll often admit they're full of shit when confronted.

Whenever I read StephenB's postings, I can't help to hear this track inside my head.

He's just flailing at this point, the puffed up posturing of someone who has too much time invested in the truthiness of ID and lacks the guts to take his fingers out of his ears for a minute or two.

Date: 2009/06/27 06:38:01, Link
Author: dnmlthr
Quote (oldmanintheskydidntdoit @ June 27 2009,12:33)
I wonder why Clive did not open up his haunted house to the masses, take a picture or otherwise call media attention to the ghostly goings on?
 
Quote
And it was my dad’s cousins, who were all adults, including my grandparents, my dad himself, my mom, my brother, and my uncle. Over and over. If this disappoints you, I’m sorry, the truth is difficult when you’re fettered to materialist chains.

Wooooooo

Crank magnetism is alive and well.

Date: 2009/07/05 12:59:57, Link
Author: dnmlthr
Congratulations, don't do anything I would!

Date: 2009/07/05 14:52:05, Link
Author: dnmlthr
Quote (keiths @ July 05 2009,20:46)
Brave Sir Joseph hobbles, hobbles away:
Quote
I, for one, would love the opportunity to tell evos exactly what I think of them to their faces.

Nakashima:
Quote
When is it convenient for you to meet? I have always been interested in meeting someone from UD face to face.

Joseph:
Quote
I just had ACL reconstruction so it will be a while before I go anywhere.

But I will keep that in mind…


ETA: I see that didymos beat me to it...

Simply delicious and clearly worth repeating.

Date: 2009/07/08 11:15:33, Link
Author: dnmlthr
Quote (sparc @ July 08 2009,04:10)
BTW, WMAD updated the OE domain registration recently. The new expiry date is June 3, 2010. I am afraid it won't help much:
Last comment 7 weeks and 5 days ago
Last user point increase: sometimes between December 14, 2008 and December 18, 2008 Denyse O'Leary was credited the last 10 points. Her total of 2709 points equals 41% of all user points ever awarded at OE.

Had it expired in 2012 instead all the mystery mongering new age bullshit would have made perfect sense.

Date: 2009/07/09 15:33:32, Link
Author: dnmlthr
Quote (k.e.. @ July 09 2009,21:25)
Who wants to see their genome.?

Keep your "genome" it your pants, mister.

Date: 2009/07/21 11:35:25, Link
Author: dnmlthr
Fuzz testing now evidence of ID or what is his point? Mo' rons, mo' problems.

Date: 2009/07/22 15:53:32, Link
Author: dnmlthr
Congratulations! If the "cake" flows I hope the hangover will be mild.

Date: 2009/07/28 01:16:40, Link
Author: dnmlthr
Quote (Lou FCD @ July 28 2009,06:45)
Quote
Note that Cornelius is talking about evolution, not changes in allele frequencies.


TARD.

Sock.

Date: 2009/08/02 09:38:05, Link
Author: dnmlthr
Quote (midwifetoad @ Aug. 02 2009,15:25)
But for superior crank medicine, it's no match for coffee enemas.

Don't give him any ideas

Date: 2009/08/14 09:39:39, Link
Author: dnmlthr
I cannot even take the repetitititititititive guy by proxy anymore.

Date: 2009/08/26 16:31:47, Link
Author: dnmlthr
The inability of the UD denizens to understand the concept of algorithms is impressive. Perhaps they'd like to see the original code implementing Euclid's algorithm as well?

For a supposed bunch of computer programmers they are quite oblivious to computer science. Goes without saying I guess, what with the science part of the name and all.

Date: 2009/09/01 16:06:38, Link
Author: dnmlthr
Quote (dheddle @ Sep. 01 2009,21:05)
Do you think this student passed his quiz?

Of course not. "Linked list" is not supposed to be hyphenated.

Date: 2009/09/01 16:11:32, Link
Author: dnmlthr
Aquinas on policy issues.

Quote

I answer that, With regard to heretics two points must be observed: one, on their own side; the other, on the side of the Church. On their own side there is the sin, whereby they deserve not only to be separated from the Church by excommunication, but also to be severed from the world by death. For it is a much graver matter to corrupt the faith which quickens the soul, than to forge money, which supports temporal life. Wherefore if forgers of money and other evil-doers are forthwith condemned to death by the secular authority, much more reason is there for heretics, as soon as they are convicted of heresy, to be not only excommunicated but even put to death.


That's all I've got to say on the topic, now back to your regularly scheduled tardgramming.

Date: 2009/09/04 16:08:21, Link
Author: dnmlthr
Quote

But hey! At least we aren’t in their bedrooms. Right? Why are they in ours?


Is he (I'm guessing here) in prison? That's the only way I can make even superficial sense of that statement.

Date: 2009/09/10 06:55:22, Link
Author: dnmlthr
I thought you might find this post by Joe Nickell funny.

Date: 2009/09/15 15:05:00, Link
Author: dnmlthr
Alright, who lives here?



My design inference says Louis, but you can never be sure.

Date: 2009/09/22 10:57:16, Link
Author: dnmlthr
Quote (Erasmus @ FCD,Sep. 22 2009,06:52)
i think you guys are getting to him!!!!

 
Quote
MONDAY, SEPTEMBER 21, 2009
The Gossip is in and it is never disappointing
Gossip factory AtBC (another tired baby crying) is still cranking out the gossip.

oldmanwithadickuphisass is gossiping about me.

The Rich Hughestard has joined in. Tards of a feather type of thing.

What the oldmanwithadickuphisass doesn't understand is that the computer code is not readable except with a computer.

The code is NOT the disc. The code is not reducible to the matter that makes up the disc.

Then a couple of comments down the oldmanwithadickuphisass gets on me for using his type of tactics against is type of ilk.

When people make bald assertions I respond accordingly.

And seeing that is all those mother-friggers have are bald assertions my responses of "Prove it" are right in line with their grade-school antics.

But anyway I am more than willing to take on any one of those fruitloops in a debate.

We can both put up some money and see who knows best.
posted by Joe G @ 2:17 PM   0 comments  

Code isn't readable without a compiler? Strange, I'm reading code in a text editor as we speak. And I've done so with cat, grep, echo and a whole slew of other commandline tools as well. Guess I've must've used an implicit compiler all these years, who knew?

And all those interpreted languages, they're not readable either I guess. I thought that only applied to Perl, but I digress.

It's all the great assembler of the gaps. The usual UD fare in other words.

Date: 2009/09/22 17:37:47, Link
Author: dnmlthr
Quote (oldmanintheskydidntdoit @ Sep. 22 2009,17:54)
Quote (dnmlthr @ Sep. 22 2009,10:57)
Code isn't readable without a compiler? Strange, I'm reading code in a text editor as we speak.

I think I've worked out what his "point" is.

Joe G On /
Yes, you can read the bits from the disk. But those bits are simply ones and zeros unless they are "surrounded" by the context of programming languages, machines to execute them, the actual understanding of the programming language itself etc etc.
Joe G Off /

So when Joe G says
         
Quote
The code is not reducible to the matter that makes up the disc.

In one way he's right. You need more then the "code" itself to give the information on the disc meaning. In his "mind" however, no doubt the understanding required to understand the code resides in a human mind which is non-material and therefore it's impossible that the code is reducible to matter.

But so what, all it means is that he says "everything required to understand the code on the disc is not reducible to less then that which is required to understand the code on the disc" really saying nothing at all.

Unless of course the disc is a disc that contains instructions on how to understand the rest of the disc? Starting from the simplest mathematical axoims...

Douglas Hofstader wrote about this, in a way, in Le Ton beau de Marot. I'm sure I'll mangle it, but where does the information and the way the information is instantiated begin and end? Would a record sent into space where grooves physically represent sound waves be any different to a CD-ROM containing the same music but digitised? Does the language a poem is in change the meaning of the poem?

So in way Joe has an interesting point. In a way. Of course saying "The code is not reducible to the matter that makes up the disc" is like saying a space rocket is not reducible to the instructions that tell you how to build a space rocket. You still need some other bits and pieces. Bolts, stuff like that. People.

It's just a shame he's too chicken to come here and debate his grand idea.

But information exists regardless of meaning to the current observer, or perhaps I'm not following your line of reasoning.

Granted, Big Joey G-funk probably defines information in a different way than Kolmogorov-Chaitin (at least according to my all-too-brief exposure to information theory). If only my exposure to UD was as brief.


Mark Chu-Carroll writes more and better about this topic than I'm capable of.

Date: 2009/09/22 17:51:38, Link
Author: dnmlthr
Quote (drmabus7777 @ Sep. 22 2009,22:38)
we're pulling the plug on this bit of blasphemy called *Pharyngula*


and on the article on me you FAIL to mention the link to which it refers...

you deluded fucker

_

btw, this HAS been sent to entire university of morris - and the FBI and police as well:



http://www.sotoman.info/freethinking/index.php?topic=1198.0





http://www.randi.org/site....re.html


"However, I'd like to consider another aspect that is rarely discussed: the events were never in any way predicted by any of the self-proclaimed psychics or future-seers out there. While some have claimed that the vague words of Nostradamus or some other cryptic phrase contains clues, the fact is that nobody, no professional nor amateur psychic gave any indication that there would be a major terrorist attack in New York City or Washington in September 2001."


VAGUE, eh?

Your meds. Eat them.

Date: 2009/09/22 18:49:53, Link
Author: dnmlthr
Quote (Arden Chatfield @ Sep. 23 2009,00:42)
David, I see that you have two different login IDs, 'drmabus7777' and 'davidmabus3797'. Are you opening new IDs for each of your personalities?

You're not gonna start having arguments with yourself, are you?

Well, at least davidmabus3797 contains a prime number. That's reason enough to change, don't you think?

Date: 2009/09/22 18:52:54, Link
Author: dnmlthr
Quote (oldmanintheskydidntdoit @ Sep. 23 2009,00:03)
Quote

But information exists regardless of meaning to the current observer, or perhaps I'm not following your line of reasoning.

I don't have the words to describe it, but yes, agreed 100% that  information exists regardless of meaning to the current observer.

I'll get back to you after reading that link!

I meant to write "to any given observer" btw.

Date: 2009/09/22 18:57:50, Link
Author: dnmlthr
It really, really irks me when design proponentsists step into my area of expertise (you might have guessed which one that is by now), I can only imagine what their ramblings do to actual biologists.

Needless to say, you have my deepest sympathies.

Date: 2009/09/27 11:04:12, Link
Author: dnmlthr
Quote (Richardthughes @ Sep. 27 2009,16:08)
Spacebunny is on high alert for any rationals that might have crossed their boarders.

The minutemen of tard.

Date: 2009/10/05 16:53:18, Link
Author: dnmlthr
Friends don't let friends post dox. Cue the inevitable "HALP! I'm being suppressed!" tirade from BarryA.

Date: 2009/10/06 11:19:06, Link
Author: dnmlthr
Congrats!

Date: 2009/10/07 16:53:15, Link
Author: dnmlthr
Louis: on the same note, seeing denialist abuse of logic has been illuminating to me, if for no other reason than that it has given me a "as it happens" perspective on a number of informal logical fallacies.

Pretty much like solving a problem with a classmate giving another perspective on a mathematical principle as opposed to reading the proof in one sitting.

Plus, there are numerous people on this forum that I'd like to have a beer with, should the temporal and geographical opportunity arise. Sorry FL/Clownshoes, you're not included in that group.

Date: 2009/10/13 14:34:00, Link
Author: dnmlthr
Quote
A mathematician is a device for turning coffee into theorems.
-- Paul Erdös (or perhaps Alfréd Rényi)

Mathematics violates SLoT, clear as day.

Date: 2009/10/15 14:48:29, Link
Author: dnmlthr
Awesome Lou!

Date: 2009/10/15 14:49:19, Link
Author: dnmlthr
Quote (Quack @ Oct. 15 2009,20:42)
Srsly, back to business, that is fun too!

Will I regret googling that term?

Date: 2009/10/17 07:33:09, Link
Author: dnmlthr
It only took 50 pages for you to end up at Pascal's wager - a notoriously bullshit argument - still only using assertions.

Are you a child, Floyd?

Date: 2009/10/18 13:57:17, Link
Author: dnmlthr
Quote (Jasper @ Oct. 18 2009,19:16)
I would like to suggest a new name for this thread:

Schadenfloyde.







Edit: Sorry, once it popped into my brain, I just couldn't resist.

Post of the timeframe until another post is named post of the timeframe until another ...!

ETA: speling.

Date: 2009/10/19 11:08:09, Link
Author: dnmlthr
Louis' albatross model of creationist debating tactics still applies. Boy am I surprised.

Date: 2009/10/19 18:35:37, Link
Author: dnmlthr
Quote (FloydLee @ Oct. 19 2009,17:59)
   
Quote
My core beliefs are not YOUR business, Floyd. Nor was it ever relevant to the debate until you lyingly claimed to know about my religious belifs despite admitting I told you they were irrelevant to the issues (and still are).

What "lying"?  I said I know that you're not a Christian, and even now you sit there pinned to the wall, unable to say the one little bitty sentence---"Yes I have accepted Jesus Christ and he is the Savior and Lord of my life" ---that would immediately refute me and force an instant retraction.

I also said I don't know your exact beliefs (because when asked, you chose to hide them.  Fear factor.)  

So, those are the two things I know for sure.  No lie on my part, that's for sure.  Wanna disprove me?

The bolded parts represent mutually exclusive statements. Both cannot be true at the same time (just as A and ¬A). Yet you posted them in the same comment. Either you don't care about the quality of the argument or you don't understand the distinction or you do know but try to pull a fast one. Either way it's bad form.

Date: 2009/10/19 18:36:43, Link
Author: dnmlthr
And deadman, why a lawsuit when you can have a lolsuit right here?

Date: 2009/10/23 12:01:57, Link
Author: dnmlthr
Quote (cogzoid @ Oct. 23 2009,17:09)
My guess is Gordon Mullings of TKI doesn't have many friends outside of church.

Fixed that for you.

Date: 2009/10/27 07:06:21, Link
Author: dnmlthr
Have a good one, don't do anything I would do.

Date: 2009/10/29 13:46:06, Link
Author: dnmlthr
Quote (dvunkannon @ Oct. 29 2009,18:13)
Thank you all!

I hope to post a suitable, fully clothed and bejewelled picture of said supermodel in the near future.

Are you sure you've sobered up yet? I'm not 100% sure that's a good idea...

Date: 2009/10/30 03:45:47, Link
Author: dnmlthr
Quote (Richardthughes @ Oct. 29 2009,23:59)

I'll christen these PUNRUNS, if that's okay.

I prefer the term punorrhea. What? Too technical?

Date: 2009/11/04 11:45:22, Link
Author: dnmlthr
JoeG/idguy/Captain America. A rose by any other name...

Date: 2009/11/06 11:51:12, Link
Author: dnmlthr
I have to disagree with you guys on the topic of calculators. For pure calculation, yes, but certainly not for readability. There's a reason any function can be turned into an infix operator in Haskell, after all.

Do you by any chance also like LISP?

Date: 2009/11/06 12:28:03, Link
Author: dnmlthr
Quote (Henry J @ Nov. 06 2009,18:09)
Quote (dnmlthr @ Nov. 06 2009,10:51)
I have to disagree with you guys on the topic of calculators. For pure calculation, yes, but certainly not for readability. There's a reason any function can be turned into an infix operator in Haskell, after all.

Do you by any chance also like LISP?

When there's a display of the entire expression, and a way to edit it to correct mistakes, then infix and parenthesis are useful. When the display is limited to one number at a time, having to remember where you are is a nuisance. Well, for me it is, anyway.

Henry

You're right, I (wrongfully) assumed everyone used multiline/graphing calculators.

Date: 2009/11/08 15:44:26, Link
Author: dnmlthr
This has got to be something from the onion: Freedom Tray. Right?

Date: 2009/11/08 15:47:49, Link
Author: dnmlthr
My brain gets a stack overflow when I try to parse that pyramid of text.

Date: 2009/11/09 13:13:22, Link
Author: dnmlthr
Quote (Maya @ Nov. 09 2009,18:29)
Quote (Erasmus @ FCD,Nov. 09 2009,12:11)
Quote (Maya @ Nov. 09 2009,12:17)
 
Quote (Erasmus @ FCD,Nov. 09 2009,01:18)
jesus god yall are a buncha damn nerds.  you make black powder reloaders look like pimps

You calling my daddy a pimp?

shoulda thought about that a bit longer

the overlapping demographic group might be a dangerous lot!

Daddy is the nicest, most mellow retired Marine officer you could ever hope to meet.

(What's the opposite of "damning with faint praise"?)

He does not by any chance own a floating command center house boat and enjoy cheetos a tad too much?

Date: 2009/11/09 13:39:47, Link
Author: dnmlthr
Quote (J-Dog @ Nov. 09 2009,19:31)
Quote (Maya @ Nov. 09 2009,13:15)
No, thank you very much.  Daddy actually served with honor.

like this...

Good Marine

NOT this...

Bad Marine

Date: 2009/11/10 10:29:07, Link
Author: dnmlthr
Quote (Robert Byers @ Nov. 10 2009,11:20)
Quote (deadman_932 @ Nov. 08 2009,04:35)
Quote (Robert Byers @ Nov. 08 2009,04:18)
Everyone here. By high science I mean where knowledge is gained by the scientific method or the search for knowledge.
The other is where professions use some 'science' in their doings but the job is the end result.
So Engineers or Astronauts do science things but they are not scientists.
Science is a search for knowledge and scrunity of method before firm conclusions can be made. so the reward from this, prestige, calls out a different type of person. A more rare person.
Subjects that simply use science but have "regular" results call out a more general type of person. so any analysis of "scientists' will show in modern North America skewed demographic ethnic/sex/political affiliation/coolness factors.

Regarding the bit of your post I've bolded above: "Any" analysis? Any analysis of any specialized group might well lead to "skewed demographic results" -- but I'd still like to see the data you've used to come to your "conclusion" -- for all the factors you mentioned, especially "coolness" (LoL !).

Start with anthropologists, please. They use the scientific method, especially in paleoanth and archaeology. Do that now.

its my assertion and i insist its true. This particular field for example i bet are all liberal democrats.
I don't need to prove my point by lists. Those who know the makeup in these areas know its not close to a cross section of the nation.
Thats my point.

Assertions are not evidence, however forceful.

I could for example assert something terrible and shameful about you personally, yet that wouldn't make it true now would it?

Date: 2009/11/10 17:12:29, Link
Author: dnmlthr
I happened to run across an unfinished manuscript for a book, thought you might be interested. Unfortunately I could only find the first five chapters.

Quote

Elements of tard
Densey O'Leary

I. Introductory
This book is intended for use in English journalistic writing in which absolute ignorance of the subject matter at hand is of utmost importance.


II. Colloquialisms
Pepper your text with local or even individual colloquialisms such as "Coffe!!" or "Hull" thus confusing the reader, making resistance futile. Coffee!!

Remember: the journalistic endeavour is not about communicating ideas but rather Hull do not worry about clarity oh god I dun write too gud.


III. Referencing sources
External sources should be omitted if possible. Instead, build up an extensive network of blogs and reference your own writing instead.


IV. Style concerns
Coffee!! Repetition is repetition is key. As is repetition.


V. Dealing with feedback
Under no circumstances are you to correct or even proof-read your writings. This is vitally important! Should a third party by any chance find a flaw in your reasoning you must immediately retreat and release a flurry of articles, drowning out the opposition. The culture war will be won in the muddiest of waters, after all.

Date: 2009/11/11 11:07:55, Link
Author: dnmlthr
Congratulations!

Date: 2009/11/11 11:11:10, Link
Author: dnmlthr
Quote (Bob O'H @ Nov. 11 2009,14:49)
Worrying news: afarensis is in hospital.
Quote
This is Afarensis’ youngest daughter.
My dad got sick last week and kept getting worse and worse until finally my mom took him to the ER.
Unfortunately he has Pneumonia and possibly Swine Flu so he won’t be home until Friday.

Damn. Hope he gets better sooner rather than later!

Date: 2009/11/12 10:19:50, Link
Author: dnmlthr
Quote (Joe G @ Nov. 12 2009,15:58)
   
Quote (SLP @ Nov. 05 2009,07:47)

...
EVO:I thought ID was all about thye origin of life and flagella and such?

JOE: Thats right - artificial selection proves that an Intelligent Designer designed the bacterial flagellum!  Duh, asshole!  How about I pay you a little visit so you'll see things my way?

EVO:  Well, I am right here across the stage.  Bring it on.

JOE:  Gotta go.  I'm double parked.

JOE (2 weeks later):  So, evo pussy, chickened out of our little get together, eh?

...
Anytime Scotty.

I could be at Norwich U in a couple of hours.

Hahaha! You are so predictable as to not even need a markov chain to model*!

* By which I mean that you could be replaced by a completely deterministic (very) finite automata and no one would notice the difference.

ETA: speling.

Date: 2009/11/12 14:40:21, Link
Author: dnmlthr
Quote (Richardthughes @ Nov. 12 2009,19:31)
This punrun is like an aerial photo of a ziggurat.

It's the Machu Punchu.

Date: 2009/11/12 15:02:21, Link
Author: dnmlthr
Quote (SLP @ Nov. 12 2009,19:28)
I see nothgin there that indicates that the "plan" is the means by which something is accomplished.

Apparently, some feel the need to simply make up definitions to prop up their fantasies.

At least the flying spaghetti monster has his noodly appendages to work with. Is a similar process used in your model, Joe Gangsta?

Date: 2009/11/12 17:03:20, Link
Author: dnmlthr
Quote (RDK @ Nov. 12 2009,22:52)
Barry on school shootings:

 
Quote
scrofulous, I have personally proven parts of the “official” report to be not only wrong but wildly inaccurate. Thus, a statement in the report does not settle the matter as you seem to imply.


What sort of sick fuck twists the factual happenings of a school shooting - ignoring personal eyewitness testimonies as well as police reports - just to make a point about how a scientific theory leads to immoral behavior according to a 4,000 year old holy book?

Fuck you, Barry Arrington.  I hope you read this.  You're a sick little shit.

Now he can add "ghoul" to his already impressive resume, along with "idiot", "ignoramus" and "liar".

Date: 2009/11/13 03:53:03, Link
Author: dnmlthr
Quote (dvunkannon @ Nov. 13 2009,09:19)
If the Columbine evidence is under seal, how can Barrogant make claims about what is in it?

How could he possibly resist making claims that no one can call him on?

Date: 2009/11/13 04:15:37, Link
Author: dnmlthr
Quote (Robert Byers @ Nov. 13 2009,09:49)
Evolutionary biology does not study biology since anything its talking about is extinct and only a cast of it remains.
Its speculation and most of evolutionary biology would make the same conclusions if it never saw anything move or squirm.
I say biology is about moving life and not just pictures of it. Not the same thinking or tools of actual biology.
So evolution can not claim the knowledge and prestige of modern biology to make its case. Same genus? but surely different non breeding species.

This is blatantly false, and easily proven so.

Take for example Lenski's E. coli experiment .

Try again.

Date: 2009/11/15 10:24:52, Link
Author: dnmlthr
Quote (Maya @ Nov. 15 2009,15:53)
It's a lovely Sunday morning, I go for a run, come back ready to study, but I check AtBC first which leads me to this from Sal:
   
Quote
The model is not run on a computer or requires source code.

The animation makes vizual a simple inference.

For IDiots, pictures of gingerbread men "defeat Darwinism"?  I really didn't need my faith in humanity shattered so quickly today.

PS:  A lawyer writes and spells like that?

ID research
- "Yup, looks designed to me"

ID peer review
- "Does this look designed to you?"
- "Yup. Buy my book"

Date: 2009/11/16 13:45:20, Link
Author: dnmlthr
Mark Chu-Carroll on the Dembski-Marks-RationalWiki affair.

Date: 2009/11/18 16:11:59, Link
Author: dnmlthr
Quote
Featuring Vox Day, Internet Superintelligence, AWCA

No hubris at all, no siree.

Date: 2009/11/21 20:40:39, Link
Author: dnmlthr

Date: 2009/11/22 07:32:57, Link
Author: dnmlthr
CAEK!11
ETA:

Lex Luthor is clearly an evilutionist.

Date: 2009/11/22 07:38:02, Link
Author: dnmlthr

Date: 2009/11/24 18:30:07, Link
Author: dnmlthr
Quote (deadman_932 @ Nov. 24 2009,23:55)
I've been trying to get a new chew-toy over at PZ's , but no luck so far: http://scienceblogs.com/pharyng....ous.php

He's single-mindedly obsessively focused on PZ. I think it's a one-sided bromance.

Not to forget: eloquent like Guts.

Date: 2009/11/26 04:52:37, Link
Author: dnmlthr
John Graham-Cumming on the so-called CRU hack smoking gun.

Short story: people are up in arms over an unused variable.

Date: 2009/12/02 14:49:33, Link
Author: dnmlthr
Quote (Dr.GH @ Dec. 02 2009,19:33)
I am told that Schermer has really improved his public speaking and debate skills since the Hovind encounter.

ERV, don't frown- it gives you wrinkles, ;-}

Wrinkles are an indicator of character. At least that's what I tell myself when store clerks don't recognize me on my 8 year old driver's license.

Date: 2009/12/10 11:02:26, Link
Author: dnmlthr
Aah, Tardhalla. Where the socks die only to be reborn the very next day and tardwarriors feast on single malt whiskey, COFFEE!!! and cheesy poofs until tardnarok.

Date: 2009/12/13 07:44:46, Link
Author: dnmlthr
Quote (Lou FCD @ Dec. 13 2009,00:03)
That'd be a barrel of laughs. I'm sure there'd be a drinking game involved.

As long as a homeopath mixes the drinks...

Date: 2009/12/17 03:30:21, Link
Author: dnmlthr
Quote (Rrr @ Dec. 17 2009,08:41)
But I guess this makes it more difficult to touch&type? Then again, some people may be more used than others to wearing socks both here and there ...
:p

Heal well.

Browsing UD while typing with one hand, I'd guess that to be kairosfocus' specialty.

Date: 2009/12/22 11:27:31, Link
Author: dnmlthr
Just adding some padding, nothing to see here, move along.

ETA: Huh, strange. Looked like a classic pagination bug.

Date: 2009/12/27 18:15:20, Link
Author: dnmlthr
Quote (Richardthughes @ Dec. 27 2009,22:36)
Quote (steve_h @ Dec. 27 2009,13:22)
* Automatically add a word count to mullins' posts.

My computer only has 4 gigs, will this be an issue?

If you are worried about RAM usage (I'm assuming the 4GB is a reference to RAM, though that is nearly 60 times the hard drive space I had in my first computer that had a hard drive. Not to mention 4+ BILLION times the RAM of my first computer proper), having ample swap space is necessary anyway.

By my calculations he will approach a googolplex characters per post sometime in 2011.

Date: 2010/01/12 13:10:25, Link
Author: dnmlthr
Get well soon!

Date: 2010/01/26 01:44:04, Link
Author: dnmlthr
Quote (Badger3k @ Jan. 26 2010,02:43)
So, does that make the abbreviation for the Tard Acquisition and Repository Department T(ard)ARD?

Otherwise how will we tell the difference (barring context, natch)?

Recursive acronyms have a long and proud history in the computing world.

Date: 2010/01/29 18:48:42, Link
Author: dnmlthr
Every UD poster is the Baghdad Bob of IDC, but StephenB the most so.
Edit: The Baghdad Bobiest of them all if you will.

Date: 2010/03/02 13:12:08, Link
Author: dnmlthr
How can you reach something approximating adulthood without knowing about Pavlov? I'm amazed and appalled.

Hope you're feeling honoured Joe Gangsta, I delurked just for you darling.

Ding ding ding.

Date: 2010/03/02 13:28:37, Link
Author: dnmlthr
Quote (Louis @ Mar. 02 2010,18:18)
Hey, it's something to do when waiting for the next generation of clueless backwoods godbots to pour old creationist wine into supposedly new bottles.

I've always thought the creationist beverage of choice was whine.

Date: 2010/03/31 16:00:02, Link
Author: dnmlthr
Quote (Louis @ Mar. 31 2010,09:19)
Anyway, you're right. I am the incarnation of evil. Hey, it's something to do at weekends.

I am so stealing that phrase for my band if you don't mind.

Date: 2010/03/31 16:09:07, Link
Author: dnmlthr
I'm convinced! After all it comes from chairman StephenB's little book of because I said so.

Date: 2010/04/01 08:41:37, Link
Author: dnmlthr
Quote (Louis @ April 01 2010,00:20)
Quote (dnmlthr @ Mar. 31 2010,21:00)
Quote (Louis @ Mar. 31 2010,09:19)
Anyway, you're right. I am the incarnation of evil. Hey, it's something to do at weekends.

I am so stealing that phrase for my band if you don't mind.

I expect royalties in the form of beer tributes.

Louis

Done. Just so you know, our earnings (beer or otherwise) are exactly 0 so far.

Date: 2010/04/22 14:08:55, Link
Author: dnmlthr
I used "a winner is you" in a business meeting once. It went down surprisingly well.

That was all.

Date: 2010/05/03 12:06:37, Link
Author: dnmlthr
Bachelor's thesis status: submitted.
Next stop: oblivion. See ya!

Date: 2010/05/05 18:07:57, Link
Author: dnmlthr
Quote (Richardthughes @ May 05 2010,22:34)
Grrrr. I'm going to have a nice relaxing poo to see if that will help calm me down.

Fight shit with shit and the whole world will be b^rown and s^melly.

Date: 2010/05/17 14:15:19, Link
Author: dnmlthr
Quote (Jkrebs @ May 17 2010,20:00)
Excellent research.  The tower thingy is a much simpler explanation.

And the simplest solution is always correct (as long as you discard contradictory evidence) - Occam's eraser baby!

Date: 2010/05/20 07:30:24, Link
Author: dnmlthr
Quote (BillB @ May 20 2010,10:02)
Thanks all ... anyone know a good cure for a hangover?

None that can be administered after the fact I'm afraid.



Whether your head is pounding or not, I'm impressed!

Date: 2010/05/22 12:35:23, Link
Author: dnmlthr
Quote (Lou FCD @ May 22 2010,18:15)
Quote (khan @ May 22 2010,12:38)
Rumor is that LouFCD is now officially a graduated person.

The rumor mill is correct, after a fashion.

Awesome!

Date: 2010/05/24 09:18:24, Link
Author: dnmlthr
Hey, congrats!

Date: 2010/05/24 10:24:59, Link
Author: dnmlthr
You seem to have more elaborate graduation ceremonies in the states. I'm getting my BSc this summer - alas robeless without even having to disrobe :(

Date: 2010/05/26 14:14:34, Link
Author: dnmlthr
Use this to make UD look the way it deserves

Date: 2010/06/07 17:12:40, Link
Author: dnmlthr
What do you make of this list? According to it the US has more than twice the murder rate of the UK and more than 7 times the murder rate of Norway.

According to numbers from BRÅ[1] (the "crime prevention organization" of Sweden, a source of crime statistics) it's also around 5 times the murder rate of Sweden. I cannot speak for Norway, but according to an article citing information from the central police authority in Sweden around 1 in 4.6 people  [2] have a firearms license. I could however not find a source for how many firearms that are owned by private citizens.

The numbers have nothing to do with my main point however, which is this: the reason I find guns unnerving is the ease with which they facilitate the escalation of conflict. Any reasonably healthy (physically) person could bludgeon another person to death with any number of things typically found in a normal home, but it'd take a lot more than the mere twitch of a finger.

Edit: Speling.

Date: 2010/06/09 11:07:03, Link
Author: dnmlthr


Hope it's not contagious.

Date: 2010/06/09 11:08:23, Link
Author: dnmlthr
Quote (fnxtr @ June 08 2010,01:50)
Is it broken down into murders involving/not involving guns?

Nope. Which makes it pretty much useless.

Date: 2010/06/14 16:53:46, Link
Author: dnmlthr
Quote (JLT @ June 14 2010,00:35)
Or worse, they could be forced to watch an American football game.

I guess I'm showing my juropeean ignorance here, but when you say american football, do you mean handegg?

Date: 2010/06/16 17:29:32, Link
Author: dnmlthr
There's too much running around and silliness for my taste, but I really enjoy all the sports shows showing vuvuzela concerts.

Date: 2010/07/20 15:48:42, Link
Author: dnmlthr
Quote (BillB @ July 20 2010,21:41)
Quote (Alan Fox @ July 19 2010,13:35)
*another point we haven't talked about, fatwa...

DAMM YOU TO *HELL

There I was at the IEEE World Congress on Computational Intelligence, checkin e-mail and AtBC during a coffee break when I get a face full of naked Burqua babes - whilst behind me a room full of eminent professors from all nations looked on in  wonder and awe ...

*(metaphorically)

Yeah, my thoughts exactly. What the fuck? I'm just glad I haven't had the time to check out atbc at work for the last week or so.

Date: 2010/07/22 19:47:06, Link
Author: dnmlthr
Just stepped between three idiots wanting to fight each other. I'm getting too old for this town!

Date: 2010/07/31 09:16:28, Link
Author: dnmlthr
Quote (Joe G @ July 31 2010,15:08)
Let x = $10 and y = $20

The set {x,y} contains $30

the power set { {}, {x}, {y}, {x, y} } also contains $30.

$30 = $30


Does anyone disagree with that?

If you disagree can you provide a valid resource that agrees with you?


The sum of the elements of the set {x,y} as you defined it is $30.

A set does not equal the result of a computation performed on that set.

ETA: What you're saying is that a bag containing the ingredients for a cake and a cake are the same thing.

Date: 2010/08/03 23:46:31, Link
Author: dnmlthr
Quote (Amadan @ Aug. 03 2010,21:15)
Evvydens uv Dzine!


Date: 2010/08/05 13:35:56, Link
Author: dnmlthr
The set theory according to JoeG thread damn near made me break my nose facepalming. A more naked display of the Dunning-Kruger effect in action is hard to imagine.

Fuck. I get angry just thinking about it.

Quote
Now I am become Tard, the destroyer of brains.


ETA: Removed quotes.

Date: 2010/08/06 19:59:20, Link
Author: dnmlthr
Quote (CeilingCat @ Aug. 06 2010,23:56)
Slavery = "deadbeat dads".  O'Leary's Christian morality at its finest.  What a despicable person.  

I'm shocked, shocked I tell you to find that O'Leary is as ignorant of the history of slavery as of anything else her keyboard touches.

I guess europeans didn't enslave other europeans way before the atlantic triangle slave trade and that racist justifications for the slave trade were a fairly modern invention after all.

Date: 2010/08/07 08:28:03, Link
Author: dnmlthr
Quote (carlsonjok @ Aug. 07 2010,12:50)
Besides *our* Vikings are much more fearsome (and not extinct) than the Yurpean version.


I rest my case.

Except for the extinct part of course!

Date: 2010/08/22 10:22:57, Link
Author: dnmlthr
JAD sighting in the wild, doing the same old song and dance (with VMartin in tow, of course).

Date: 2010/08/22 11:37:12, Link
Author: dnmlthr
Quote (dnmlthr @ Aug. 22 2010,16:22)
JAD sighting in the wild, doing the same old song and dance (with VMartin in tow, of course).

He's quoting himself now, but not "loving it so" as of yet.

It's sad really, spending his autumn years trolling for attention when nobody cares more than to ban his ass for being a nuisance.

Date: 2010/08/23 12:23:16, Link
Author: dnmlthr
It's classic JAD over there, including threatening to smear the blog owner, loving it so and quoting himself.

Date: 2010/08/23 13:04:09, Link
Author: dnmlthr
Quote (Richardthughes @ Aug. 23 2010,18:48)
Quote (dnmlthr @ Aug. 23 2010,12:23)
It's classic JAD over there, including threatening to smear the blog owner, loving it so and quoting himself.

IMPOSTERS!

He doesn't seem to like you very much. How come?

Date: 2010/08/23 20:57:37, Link
Author: dnmlthr
Quote (J-Dog @ Aug. 24 2010,02:50)
 
Quote
Consider me your mortal enemy


That's funny! Who really talks like that!  It's like Professor Emeritus = 12 year old boy, or a character from Lord Of The Rings!

Or a Bond villain. Notice how he got more and more unhinged as the thread went on, basically oscillating between triumphant sneering and white hot rage.

The part where he mistook a sarcastic remark as genuine support was just sad.

Date: 2010/08/24 03:14:39, Link
Author: dnmlthr
JAD reacts to possibly getting cut off from his attention supply.

Date: 2010/08/24 12:03:48, Link
Author: dnmlthr
Aaaand he's out

MarkCC says:
August 24, 2010 at 12:36 pm
Quote
John, you are banned. You were warned plenty of times to stop with the insults. You’re apparently incapable of that, so you’re out of here.

And for the gazillionth time… no one is on trial here. This is a blog for gods sake, not a courtroom, a classroom, or a debate hall. In fact, this is a math blog.

Date: 2010/08/24 16:06:48, Link
Author: dnmlthr
Quote (Richardthughes @ Aug. 24 2010,20:01)
It doesn't get any better than this!

Is that vintage JAD too, or has he evolved his use of language?

Date: 2010/08/24 16:44:39, Link
Author: dnmlthr
Quote (Richardthughes @ Aug. 24 2010,22:22)
Quote (dnmlthr @ Aug. 24 2010,16:06)
Quote (Richardthughes @ Aug. 24 2010,20:01)
It doesn't get any better than this!

Is that vintage JAD too, or has he evolved his use of language?

http://tinyurl.com/234eaqb

;)

Hahaha!

Oh man, I never thought I'd be addressed by the mighty JAD hisself, but apparently dreams can come true.

Date: 2010/09/09 06:50:55, Link
Author: dnmlthr
Taking a class in the philosophy of science this fall and during the first seminar the TA uses creationism as an example of pseudoscience. I love it so!

Date: 2010/09/15 05:59:22, Link
Author: dnmlthr
Quote (Kattarina98 @ Sep. 15 2010,11:40)
First one to guess the answer wins the Internet (no peeking!): Why is biology different?
Granville Sewell
 
Quote
I don’t think that 97% of biologists are anti-intellectual or even materialists, I think they just see how well the usual scientific tools seem to work in other fields, and think, why should evolutionary biology be different? But it is different, the problems evolutionary biologists are trying to solve are not just harder, they are fundamentally different from those faced by other scientists, for reasons I think are made most clear though the argument presented here.

Did you guess?
... "here" links to ... the Second Law of Thermodynamics! Yawn ...

Are you saying that their brains have traveled back in time to before the fall* and frontloaded their arguments? Design!1!oneone

* Dover vs. Kitzmiller

Date: 2010/11/04 08:54:27, Link
Author: dnmlthr
Quote (Louis @ Nov. 04 2010,14:40)
*Luckily it's a small mortgage.

And doubly lucky, the sailors aren't.

Date: 2010/11/16 06:56:40, Link
Author: dnmlthr
I found this funny..

Yes indeed, I am in CS, what tipped you off?

Date: 2011/01/06 16:16:51, Link
Author: dnmlthr
Long time no see guys! I'll be moving to Palo Alto by the end of January, so if you find yourselves in that area thirsting for a pint or ten you know where to turn.

Oh and for the genealogy thing: generation after generation alternating between village priests and soldiers. Then suddenly the only note was "born then and then, dead then and then. Executed. Finn-murderer." No more information whatsoever.

Date: 2011/01/29 23:07:51, Link
Author: dnmlthr
The Mabus works in mysterious (but probably diagnosable) ways.

BTW, I've now resettled to the americas. Palo Alto, CA to be exact. Exchanging snow up to the crown jewels for some sort of perpetual spring/summer wasn't as traumatic as expected. Lasting effects remain to be seen.

Date: 2011/02/19 12:30:04, Link
Author: dnmlthr
I'll just leave this here.



"Healthy sexual relationship" did not turn up once.

Date: 2011/03/15 23:20:31, Link
Author: dnmlthr
They certainly know how to put the short bus special into special pleading over at UD.

Date: 2011/03/30 01:53:44, Link
Author: dnmlthr
California has officially turned me into a hophead.

Stone Ruination IPA or bust!

Date: 2011/10/14 21:56:56, Link
Author: dnmlthr
khan: Google contacts synchronization is the single feature that has impacted my life the most, no joke.

Also, hi guys, long time no see!

Date: 2011/10/15 10:36:20, Link
Author: dnmlthr
Quote (Louis @ Oct. 15 2011,11:21)
Quote (dnmlthr @ Oct. 15 2011,03:56)
khan: Google contacts synchronization is the single feature that has impacted my life the most, no joke.

Also, hi guys, long time no see!

O HAI! You good?

Louis

All is well, mostly getting annoyed by medical tard since I abandoned the old country for California. How about you?

Date: 2011/10/23 23:20:41, Link
Author: dnmlthr
Quote (forastero @ Oct. 23 2011,15:22)
Quote (afarensis @ Oct. 23 2011,17:19)
Okay, define robust.

ha ha thats funny

Mass, density, etc etc..

Hahaha, oh wow.

The concept of island dwarfism disagrees

Date: 2011/10/25 22:07:54, Link
Author: dnmlthr
Quote (Lou FCD @ Oct. 25 2011,19:27)
Watson is the Parris Hilton of skepticism. Famous for ...being famous, and not much else. I guess if you're into celebrity gossip and the trials and tribulations of famous people who occasionally get hit on by unattractive people, she's probably worth reading.

Can't say I'm a fan but credit where credit is due, skepchick.org (and its Swedish offshoot, skepchick.se) has become a platform for some interesting voices.

Date: 2011/10/26 08:13:52, Link
Author: dnmlthr
Quote (Lou FCD @ Oct. 25 2011,23:50)
Quote (dnmlthr @ Oct. 25 2011,23:07)
Quote (Lou FCD @ Oct. 25 2011,19:27)
Watson is the Parris Hilton of skepticism. Famous for ...being famous, and not much else. I guess if you're into celebrity gossip and the trials and tribulations of famous people who occasionally get hit on by unattractive people, she's probably worth reading.

Can't say I'm a fan but credit where credit is due, skepchick.org (and its Swedish offshoot, skepchick.se) has become a platform for some interesting voices.

Eh, I followed Skepchick when it was young, but it soon began to impress me as a site for a whole lot of guys to ingratiate themselves in the comments in the vain hope of getting laid. Reasonable dissent and discussion were shouted down, and many of the comments about Pharyngula today along those lines mirror my feelings about Skepchick then.

I quit reading it a few years ago.

I've heard they've brought in some other women to write, but I can't really spare the time.

And frankly I almost never see Skepchick mentioned anywhere in my travels about the web, though I certainly see other women bloggers highlighted for their writing. ...except of course regarding the non-incident in the elevator. If that's all the impact Skepchick is making on the web, then it's not much of a platform for those interesting voices.

Blog comments are without fail a sycophantic cesspool, but that's the nature of the medium. I stopped reading blog comments in general years ago.

Date: 2011/11/14 14:20:51, Link
Author: dnmlthr
Quote (Joe G @ Nov. 11 2011,06:00)
Sure I worked for an encryption company.

Doing cryptography research? I've worked for a newspaper in the past, doesn't make me a journalist.

Date: 2011/12/01 01:08:13, Link
Author: dnmlthr
Quote (fnxtr @ Nov. 30 2011,17:26)
I understand cognitively that that's just silly, but that understanding hasn't reached the effective level yet. Dunno why not.

It's an image that has been part of the cultural background for all of our lives. A meme on steroids if you will.

On a separate but related note, one of the things I find the most frustrating when discussing feminism (or any question regarding privilege really) is the refusal of the privileged to acknowledge that privilege. The illusion of being self made seems awfully important to people.

I was born a male in a patriarchal society, part of the local ethnic majority, in a stable family living in a middle class neighborhood with a low crime rate and given access to free education. To claim that I'm a "self made man" is laughable.

I don't know where I'm going with this. Don't mind the personal non sequitur and I'll just enjoy the papers that have been posted.

Date: 2011/12/01 01:15:04, Link
Author: dnmlthr
This is a really interesting question.

I'm speaking from a position of absolute ignorance here but are there linguistic markers that you can use to distinguish oral communication from written communication, even if the oral communication has been transcribed?

 

 

 

=====