AE BB DB Explorer


Action:
Author:
Search Terms (separate with commas, no spaces):


form_srcid: afdave

form_srcid: afdave

form_cmd: view_author

Your IP address is 54.205.15.219

View Author detected.

view author posts with search matches:

Retrieve source record and display it.

form_author:

form_srcid: afdave

q: SELECT AUTHOR, MEMBER_NAME, IP_ADDR, POST_DATE, TOPIC_ID, t1.FORUM_ID, POST, POST_ID, FORUM_VIEW_THREADS from ib_forum_posts AS t1 LEFT JOIN (ib_member_profiles AS t2, ib_forum_info AS t3) ON (t1.forum_id = t3.forum_id AND t1.author = t2.member_id) WHERE MEMBER_NAME like 'afdave%' and forum_view_threads LIKE '*' ORDER BY POST_DATE ASC

DB_err:

DB_result: Resource id #6

Date: 2006/04/18 03:32:41, Link
Author: afdave
Thankyou, corkscrew and Henry J for your polite answers.  I would think you other folks would also want to give polite answers if you want others to see the truth of your viewpoint ... just a suggestion!

To answer corkscrew ... I agree with (1) and (2) except that I have never heard of a random mutation that could be considered beneficial.

As for (3), I'm not aware of A SINGLE fossil that can be considered transitional ... my understanding of mesonychids and whales can be found here http://www.answersingenesis.org/home/area/re1/chapter5.asp.  To me the evidence of zillions of dead things buried in rock layers laid down by water all over the earth fits the idea of a global flood quite much better than the alternatives.

I don't quite follow (4)

I would agree with (5) that the evidence for a Designer is not scientific in the sense that you can demonstrate it in the lab.  The reasons I believe there is one are more like the reasons I believe George Washington existed.  

I would also agree that ID is useless by itself because it stops short of identifying a designer.  I am a creationist which means I believe I can identify the designer as the God of the Bible.  This is incredibly useful if you believe as I do that this God wants a relationship with the humans he created and will someday make a new world.  Of course, to arrive at all these conclusions requires much evidence from several disciplines ... science only goes so far.  But contrary to the mudslingers, there is excellent evidence available ... I would never just say something non-sensical like "You just have to have faith".  Many organized religions have done a disservice to lots of people by making statements like this.

A basic outline of my line of reasoning is this (keep in mind I have an Electrical Engineering degree, so I think like an engineer) ...

1)  I see highly sophisticated, biological machines at every level in nature, macro to micro.
2)  I know from my engineering experience that sophisticated, non-biological machines that actually work require enormous amounts of intelligence (not to mention effort) to get them designed well enough to where they will work and continue working for a long time.  I have no reason to believe that biological machines would be otherwise--they are made of the same stuff--it all comes from the same periodic table.
3)  Knowing this, it makes sense to me that there COULD be a designer somewhere--space alien, God, supercomputer in some galaxy--apparently Francis Crick went for the Space Alien/Panspermia idea, so I guess I'm not totally crazy with this idea.
4)  Next, I look at the fossil record with the zillions of dead things buried in rock layers laid down by water all over the earth, and I conclude that there must have been a massive, global flood which buried all those fossils.
5)  Now I pick up a Bible and I find a book that claims that (a) a Designer created life on earth and (b) there was a global flood which buried all these critters I find in the rock layers ... interesting
6)  I'm skeptical of the Bible at first because everyone says "that's just a religious book full of myths", but on closer inspection, I find it to be accurate in every historical detail which is possible to be verified by archaeology.  I read it from cover to cover to give it a fair analysis and I am struck by the accuracy with which it describes human behaviour.  I'm also fascinated with the apparent fulfilled prophecies which involve the rise and fall of major nations and also this incredibly influential person--Jesus of Nazareth.  To be sure, there are things I don't understand, but I'm not so arrogant as to write them off without evidence for doing so.  I know from history that multitudes of people have blindly accepted statements like "that book is just a myth" only to be proven wrong by some guy willing to work hard enough to really examine the evidence.  Of course, many DO turn out to be myths, but I have done my own thorough examination of the Bible, and I have not found it to be a myth.
7)  I put this (and some other factors ... admittedly, this is abbreviated) all together and in my mind and it all adds up to me to make a pretty good case that the Bible is literally true--complete with a real God, the Creation, the Flood, Moses, Jesus ... the whole deal.

I think you will find that there are many folks out there who followed similar lines of reasoning and wound up with the same conclusion.  C.S. Lewis is one prominent individual who was a skeptic for many years, but eventually became a loud proclaimer of Christian tenets.  Lee Stoebel, author of Case for Faith and Case for Christ is another agnostic-turned-Christian.

Date: 2006/04/18 06:51:45, Link
Author: afdave
Quote (Aardvark @ April 18 2006,09:20)
afdave Says:
April 17th, 2006 at 1:16 pm

Quote
My personal opinion is that our educational institutions–from the public schools to the Ivy League universities have been gradually taken over in the past hundred years or so by the anti-God (anti-supernatural if you will) crowd, basically because good, competent people like our present ID people were not very involved and let them do it. The results in the public schools are obvious and similar results are beginning to show at the college level as well.


http://telicthoughts.com/?p=640

Looks like afdave is not so neutral after all.


Who said anything about me being neutral?  I'm an active Creationist and very involved politically.  I am also an Electrical Engineer, former AF jet pilot, very successful business man, and a large contributor to various causes ... maybe yours if you're nice to me and convince me why I should.  But I try to be polite and I honestly like to hear evolutionists state, in their own words, why they believe in macro-evolution.

Date: 2006/04/19 01:00:16, Link
Author: afdave
I didn't say "prove" ... obviously, this would require outside sources ... I said I would like to HEAR your theory in your own words and the 5 top reasons WHY you believe it

To those who have been polite enough to accomodate my request, thanks!  Believe it or not, it is quite rare to find unless you specifically ask.

BTW- does anyone know of a good online chart or tree showing current evolutionary understanding of how life developed which covers it all, from single-celled organism to humans, preferably from a well-recognized source?

Date: 2006/04/19 11:51:01, Link
Author: afdave
Every head bowed ... every eye closed ... repeat after me ... homina, homina ...

Hey I like that ... MC Dave ...

No seriously, I am an honest-to-goodness Creationist (gasp) with a neck shade other than red and I don't live in a trailer in the South ... oh, to the guy asking about which nationality of AF I was in ... USA ... I flew T-38's and I hear all kinds of people in this country say the Bible is a myth ... co-workers, relatives, you name it ... I am not kidding when I say that I appreciate all you people giving me serious answers on why you believe in (oops ... accept) evolution.  I'll take as many as I can get ...

One more question though ... some guy on the main PT site was insulted that I called him a Darwinist ... said that's like calling an African-American a "nigger" ... what's up with that?

Pretty soon I'll reciprocate and give my 7 points on why I'm a Creationist ... hopefully I won't get too many rotten tomatoes

Date: 2006/04/19 11:54:35, Link
Author: afdave
Oops ... I forgot I already posted my 7 points earlier ... I'll try to answer objections soon ...

Date: 2006/04/19 12:30:46, Link
Author: afdave
So what's the proper term?  Evolutionist?

Date: 2006/04/19 17:06:29, Link
Author: afdave
Quote
Too much jesus, too little science. All done.


Steve keeps bebopping into this thread with one-liners because secretly he wants a little more Jesus, a little instruction in capitalization rules, and a little less science ...

Hmmmm ...

Date: 2006/04/24 02:47:35, Link
Author: afdave
Thanks for the explanations ... I wanted to see if there is anything new which might convince me that Macro-Evolution really happened, but there's apparently not ...

Corkscrew had some very thoughtful answers and I was particularly interested in his understanding about whale evolution ... but what I found appears to me to be another case of wishful thinking on the part of evolutionists ... non-existent skeleton parts drawn in to make the skeleton look the way they want it to, etc.  Darwin predicted an enormous number of transitional fossils ... but 140 years later, we only have a handful of disputable examples.  In my opinion, it is too early to draw conclusions about Tiktaalik

http://www.answersingenesis.org/creation/v23/i4/almostwhale.asp

I have not studied the nylon-eating bacteria, but it sounds interesting.  I guess I should revise my terminology regarding 'beneficial mutations'.  It can be very ambiguous to determine what exactly is 'beneficial.'  How about this?  <i>No one has ever shown me a mutation which INCREASES the information in the organism.</i>  This is probably a less ambiguous statement.

I agree that evolutionists' observation of variation within the living world is quite valid and can be very predictive. Creationists also observe this variation, but we realize that there is no NEW information being added to genomes.  There is only LOSS of information, hence the phenomenon of "dead-end" species, such as cardinals.  I had an interesting dialog one time with an evolutionist about Chihuahaus and Great Danes.  He basically said you could breed back a pair of Chihuahuas to eventually get a "mutt" or even a Great Dane and was citing evolutionary theory to support this.  I'm curious to know if there are other evolutionists who believe this?  All my observation tells me that you have to have the Great Dane info in some "mutt" parents rather far back in time in order to breed a Great Dane.  Once you breed down to a Chihuahua, the Great Dane info is gone--artificially selected out.  This understanding of breeding is why I believe it is entirely possible that all "dog-type" animals, for example--dogs, coyotes, wolves, etc. came from one, genetically rich "dog-kind" pair.

I like your link to the Genetic algorithm, but again, this kind of thing is not "Evolution" in the sense that any new information is being added.  The computer program is just selecting EXISTING information, just like what happens in nature.

It is also baffling to me how evolutionists cannot see evidence for a global flood.  One huge piece of evidence to me is the Grand Canyon.  To me it has always seemed absurd to assume that the Colorado river carved the canyon over millions of years.  A much more plausible explanation to me is that the whole region was laid down by water over a short period of time--after all, it is fossil-bearing, sedimentary rock.  Then as the water subsided, the canyon was carved in what was still soft sediments, then subsequently hardened.  What is so convincing about this hypothesis is that Mt. Saint Helens showed us precisely how this happens.  We have a "mini-Grand Canyon' right there at Mt. Saint Helens and it happened in 1980--no speculation needed at all.  How can evolutionists deny this evidence?  Fossil sorting is also interesting:  what we have in the fossil record is exactly what one would expect to find if there was a global flood due to hydraulic sorting.  

I think the whole Creation/Evolution debate is a very intersting topic and I think it involves a lot of science, philosophy, human prejudice and other factors.  I agree that many pro-evolution people are open-minded.  I think explains why so many excellent scientists are jumping the "Darwin ship" and turning into Creationists.

Date: 2006/04/25 02:36:33, Link
Author: afdave
WHALE FRAUD (Is that like Mail Fraud?)

Corkscrew said ...
Quote
Back to the whale evolution. The transition described here looks like:
- Sinonyx
- Pakicetus
- Ambulocetus
- Rodhocetus
- Basilosaurus (note especially that it had land-animal-like feet)
- Dorudon


Sinonyx -- So this is the starting point on the road to a whale?


Pakicetus
Top left:Gingerich’s first reconstruction
Bottom left: what he had actually found
Top right: more complete skeleton
Bottom right: more reasonable reconstruction


Ambulocetus -- The bones in (B) were what was really found (bones in red were 15 feet ABOVE the others), but the drawing in (A) is what the public sees


Rodhocetus -- Other that your link to an artist's reconstruction, here is all I could find on this one ... Wikipedia says ...
Quote
Rodhocetus balochistanensis is in fact believed to demonstrate a direct evolutionary link to artiodactyls (modern examples of which are hippopotamuses and pigs). This has largely overturned previous fossil-based theories that whales were directly descended from mesonychids, though it matches studies of the genetic relations between whales and other animals.

http://en.wikipedia.org/wiki/Rodhocetus

Basilosaurus was fully aquatic, so hardly transitional between land mammals and whales. Also, Barbara Stahl, a vertebrate paleontologist and evolutionist, points out:
Quote
The serpentine form of the body and the peculiar shape of the cheek teeth make it plain that these archaeocetes [like Basilosaurus] could not possibly have been the ancestor of modern whales.


Dorudon -- I was only able to find artist's RECONSTRUCTIONS of this fossil ... do you have any links to pictures of what was ACTUALLY found?

Sorry guys ... all this imaginitive artwork just isn't very convincing to me ... especially considering the other lines of evidence pointing to an Intelligent Creator.

Apparently it's not convincing to others either.  In spite of the virtual monopoly that evolution supporters have in schools, magazines, news media, encyclopedias, etc., the public is still not convinced ...

Quote
U.S. Majority Picks Creationism over Evolution
http://www.angus-reid.com/polls/index.cfm/fuseac…

Which of these views do you agree with the most? 1. Human beings evolved from less advanced life forms over millions of years, and God did not directly guide this process; 2. Human beings evolved from less advanced life forms over millions of years, but God guided this process; or 3. God created human beings in their present form.

Apr. 2006

God created humans in present form — 53%

Humans evolved, God guided the process — 23%

Humans evolved, God did not guide process — 17%

Source: CBS News
Methodology: Telephone interviews with 899 American adults, conducted from Apr. 6 to Apr. 9, 2006. Margin of error is 3 per cent.

Date: 2006/04/25 04:40:14, Link
Author: afdave
So all I get is rotten tomatoes and eggs?

Who is going to be manly enough to answer the obviously embarassing question of why most people in the USA are still creationists in spite of the evolutionists virtual monopoly over US schools, universities, publications and the media for at least 40 years?  

It's a really simple question, guys ...

Come on, you can do it ... Steve Story?  Moses? Lenny?  Anyone?

Date: 2006/04/26 00:44:08, Link
Author: afdave
Supposed Whale Evolution  Hopefully I got it right ... I'm actually trying to give you a fair shake.



Corkscrew--

Thankyou for the information on supposed whale evolution.  While I agree with you that there are some similarities that could be construed from the evidence, the problem (not just for whales, but for human evolution and other supposed progressions) for me has always been that the evidence is just not conclusive enough, and certainly can never be proved enough to teach our kids that it is a fact.  It also can be argued just as easily that the similarities were designed because the Designer wanted them to have similar functions.  No one can "prove" either assertion.

While it is obvious that some of these creatures are similar in form, just as it is obvious that a gorilla is similar in form to a human, there is just no way to prove that one is "more evolved" or "an ancestor or descendant" of the other.  Keep in mind also that fossils that can be considered "transitional" are very few in number.

One glaring difficulty remains for both points of view -- Evolution and Creationism -- we cannot prove either one of them in the sense of the scientific method, i.e. you cannot put a Sinonyx in a lab and observe it evolving into a Blue Whale.  Similarly, I cannot go back in time and observe God creating the universe out of nothing in six days.

However ... and this is VITALLY important ...

You and I make extremely important life and death decisions on a daily basis WITHOUT formal scientific proof ... have you ever thought about that?  If you are like me, you got married to a girl that you are pretty sure is not a mass murderer ... but can you prove she is not?  Well, you could do a criminal background check, I guess, but I didn't on my wife and I don't think many guys do.  So what do you do?  You form a hypothesis that "this is a good girl worthy of marrying." Then you simply collect as much evidence as you can about her (dating) and you make a decision ... to marry her or not.  Driving across bridges is another good one.  I always wonder if those engineers that designed that thing were competent.  Can I prove that they had the proper credentials and knew what they were doing?  Maybe, but it would be a lot of trouble and I don't.  Have there been bridges that broke b/c of poor design?  Yes.  But I drive on it anyway ... going on "faith" if you will.

And on and on we could go with examples of how we operate our lives by putting our "faith" in something or someone that we cannot prove all the facts about.

This is how it is for me with God, and I would have to say that the "God Hypothesis" or the "Creation Hypothesis" is actually one of the best supported hypotheses around.  Does it ultimately come down to faith?  Yes, but almost everything in life does too, so why should this be a surprise?  Evolutionists also exercise faith.  While their "Evolution Hypothesis" may have some support, no matter how much support they think it has, it ultimately comes down to faith also for reasons already mentioned.  Atheists also have "faith" that they will not burn in #### after they die.

So the debate to me really centers on how well your hypothesis is supported.  My hypothesis comes from a "holy book" --- the Bible.  I freely admit this and am not embarassed at all by it.  I hear that being criticized alot around here, but I can't see that it matters WHERE your hypothesis comes from.  What matters is "How well is your hypothesis supported by the evidence we find?"

In another post, I will outline the overwhelming  evidence from many different disciplines for my "Creator God Hypothesis."

Stay Tuned!

Date: 2006/04/26 03:28:46, Link
Author: afdave
Steve Story said--
Quote
Not being aware of any evil being, I have no worry about such a thing.

Sort of like all those people in WW2 that didn't think Hitler was a threat?

Date: 2006/04/26 03:53:35, Link
Author: afdave
Chris Hyland said--
Quote
But the point is that we understand much about the mechanisms of evolution, and they certainly are able to produce the morphological changes that we see in the whale lineage, same goes for humans.

You are correct that "micro-evolution" which I prefer to call "Programmed Adaptability" can produce morphological changes such as long beaks/short beaks, dark skin/light skin, straight hair/curly hair, flat nose/pointed nose, fat body/thin body, hairy body/smooth body, etc. etc.  Indeed, my hypothesis --strongly supported by my observation -- is that God designed creatures with this ability to help them survive in varying environments [no space here to prove this, just hold the thought, OK].   But to my knowledge no one has ever observed a gorilla evolving the ability to speak French, German and English.  I've never seen a female chimpanzee evolve to the point where a red-blooded, male college student would say "hubba-hubba" and ask one out on a date [actually, I've known some college students that just might be desperate enough to ask out a chimp, but that is beside the point].  I don't know of a single case where someone has observed legs dissappearing off a whale's body or wings being formed from scales.  And yes, I can conceive of this possibility theoretically, which is what I think evolutionists do, but it just seems incredibly unlikely, and I don't know of anyone who has observed it, all of which is part of why I don't believe it.
Quote
Is it too soon to link to talk.origin's refutation of standard creationist claims, or do I have to wait for afdave to trot out all the standard old canards first?

I would prefer that you give me YOUR arguments in YOUR own words.  I am learning that you guys don't like me to refer you to AIG, and in the same way I don't like to just be shoved off to TalkOrigins.   :)

Date: 2006/04/26 05:45:39, Link
Author: afdave
Quote
When I say 'understand' I don't mean 'have observed'. I don't expect to observe something occur that takes thousands or millions of years,

Precisely ... DING DING DING.  I think we are finally getting on the same page here ... I have NOT observed "God creating it" and you have NOT observed "Evolution creating it" -- i.e. big morphological changes like scales to wings, new hands where there were no hands, etc.

So ... all I am asking is why can't we agree to just teach the school children something like this ...

"Explaining the origin of life has been attempted by scientists, theologians and philosophers.  The majority of scientists in universities around the world believe life developed from a common ancestor by natural processes over millions of years ... blah, blah, blah.  However, a minority of scientists, a fair number of theologians and philosophers and about half the public believes that life was specially created by a supernatural agent such as the Christian God, the Hindu [whatever--not up on my Hindu deities], the Islamic Allah, etc.  There is much evidence which is routinely marshalled to support both naturalistic and super-naturalistic views, but nothing can ultimately be proven on either side, since the origin of life has never been directly observed.  It is ultimately a matter of personal belief."

Date: 2006/04/26 05:58:50, Link
Author: afdave
OK, fine, Faid, put the chimps at the top of the heap ... or the mosquitos for all I care ...

The logic works anyway ...

Nice try though!

Date: 2006/04/26 06:07:13, Link
Author: afdave
Yeah, and it would be a pretty groovy world as well with Faid's idea of the food chain order ...

Maybe we could then elect chimps to public office ...

[Yes, I know some would say we did in 2000 ... and I would reply that we did in 1992 ... OK ... OK ... back to the topic]

Date: 2006/04/26 11:02:11, Link
Author: afdave
Flint-- It's not a black hole ... it's the light of truth finally being turned on again ... one of your buddies on the main PT blog was lamenting that there were something like 3 conversions from Evolution to Creationism for every 1 the other direction ...

There's a reason for that ...

People are starting not only to see the falsity of blind secularism, but they are also beginning to see its bad fruits.  The 20th century in many ways was a grand experiment in secularism in science and in many other areas and it failed miserably.  Why do you think all these mega-churches are springing up everywhere?  I mean 20,000 people going to ONE CHURCH in a single city!!  These people have heard the Carl Sagans and the Richard Dawkins' and the Stephen Hawkings of the world spout their arrogant, empty atheist tripe and they are just not buying it (Stephen Hawking's own wife didn't buy it).  And its good for YOUR political freedom and mine that they are not.  We've already seen the principles of the "Evolution Religion" implemented in several countries and it was not pretty.  Just think for a moment if people like Faid were rewriting our constitution or making laws ... he thinks the idea of humans sitting on the throne of life is misguided.  Think of the implications of that!

You all are right about one thing ... academia is almost a complete monolith, at least in the area of what you call Science and I call Evolutionary Dogma.  And a such, there is probably no repairing it--replacement is probably required.

But that's OK.

It remains a historical fact that it was BL Creationists (BL=Biblical Literalist) who INVENTED the universities which you and I benefit from today, it was BL Creationists (Newton included) who founded most of the major branches of modern science which you and I also benefit from.  It was BL Creationists who founded Oxford, Cambridge, Princeton, Harvard, Yale, and many others to study and proclaim the Truth of Scripture and of Science.

And it will be the BL Creationists who RE-invent both the universities and the disciplines studied within their walls if and when the current ones become unsalvageable.  Not saying we are there yet, but listening to some of you here makes me think it may not be far off.

Date: 2006/04/26 17:05:28, Link
Author: afdave
Quote
Dave, according to your, um, logic, the perp should have been let go: no one was there to personally witness him/her commit the crime, so we cannot be certain the person in fact is guilty.  Please explain why.

Hmmm ... where did I say that?  No, I agree the perp is guilty ... we have good evidence.  And in the same way, we also have good evidence for the existence of the God described in the Christian Bible even though we cannot see Him or "prove" He is there.  

You also have evidence that leads you to believe that all life derived from a common ancestor over millions of years even though you didn't watch it happen.

Where we differ is that I believe you have come to a conclusion from the evidence which is not as well supported as my conclusion is.  

I'll elaborate tomorrow morning as promised!  It's been fun!  See you then!

Date: 2006/04/27 06:34:48, Link
Author: afdave
AFDave's Creator God Hypothesis

I will use the general outline proposed by someone which shares the majority viewpoint on this blog--the 'Rev Dr' Lenny Flank--so as not to be accused of "setting my own Creationist Rules for scientific endeavor."  Here's what Lenny said ...

1) Observe some aspect of the universe
2) Form a hypothesis that potentially explains what you have observed
3) Make testable predictions from that hypothesis
4) Make observations and experiments that can test those predictions
5) Modify your hypothesis until it is in accord with all observations and predictions

One thing to keep in mind ... I cannot "prove" the Biblical account of origins and that there is a Creator God any more than you can "prove" that all living things evolved from a common ancestor by random mutation and natural selection.  Neither of us were there to observe either one.  But we can both follow the outline above, then make a "faith" decision in both cases about what we think most reasonable to believe.

Another note ... I will only give my outline, then provide links to my support ... while I like to explain things in my own words and like others to also, someone correctly pointed out that limiting oneself to their own words only is not possible in scientific investigation.  The sources that I deem reliable are AIG, ICR and the TrueOrigins.org archive.  I see "Dr. Dino" being refuted alot on TalkOrigins and some of this may be well deserved.  I do not consider him and certain others to be a responsible spokesman for the Creationist viewpoint.  I also do not claim to be a professional geologist, biologist, genetecist or paleontologist.  I have a Bachelor's Degree in Electrical Engineering, flew supersonic jets in the Air Force and have successfully built and sold a telecommunications business which has allowed me to now pursue non-profit endeavors such as posting to this blog, among other things.  

If you want to see if what I look like (surely this guy must have an eye in the middle of his forehead and a severely red neck), check out my own blog site at airdave.blogspot.com.  I have only published a handful of articles, but I hope to become more active from this point forward ... come on over!

Are you ready?  Here we go ...

1) Observe some aspect of the universe
I make observation of Planet Earth and all of Life within it--that is, everything that has DNA

2) Form a hypothesis -- I don't want any criticism of my hypothesis -- according to the rules above, it can be anything I want it to be.  You can save your criticism for my evidence which purports to support it.

(a) There is a God -- My hypothesis is that there is a Super Intelligent, Incredibly Powerful Being -- I choose to call him God -- who has knowledge of scientific laws far more advanced than anything ever discovered by 21st Century humans.  These scientific laws are so powerful that this Being can literally "speak" material things into existence and destroy things with a simple command.  This Being lives "outside of time" and can view what we call "the future" and "the past" with equal ease.
(b) This God created the Cosmos as a specially designed whole, with life and mankind as its fundamental goal and purpose.  This God created mankind with a choice of either doing his will or not doing his will, in a similar way as parents "create" babies knowing full well that their child will either do their will or not do their will.  Christian Theologians commonly call the choice of NOT doing God's will "sin."
© Mankind chose NOT to do God's will very early on (just as all young children choose not to do parents' will), thus prompting God to institute a system for persuading humans to admit their folly and begin doing His will, for "redeeming" humans who choose this path, and for reminding humans that the present physical world is only a "proving ground" or "training camp" for the next world which will be created at a definite point in the future.  These events are commonly called the Fall and the Curse by Christian Theologians.
(d) God allowed the choices of mankind to take their natural course for the most part, intervening in the affairs of men sporadically and briefly.  Most of the "day-to-day management" of Planet Earth was delegated to mankind himself, similar to how modern parents delegate the day-to-day management of their children to a school or a day care center.
(e) The natural result of collective disobedience to the revealed will of God was an extremely corrupt society--i.e. rampant dishonesty, injustice, murder, theft, etc.--which was terminated by God through the agency of a global, life-destroying flood--the Flood of Noah described in Genesis.  
(f) The Global Flood of Noah was an immense cataclysm of enormous tectonic, volcanic and hydraulic upheaval.  It completely reshaped the ante-diluvian world and resulted in massive, worldwide sedimentation and fossilization, mountain range uplift, sea basin lowering, and climate change.  The Flood was survived in a floating ark by 8 humans (four couples) and one or more pairs of terrestrial, air-breathing, genetically rich animals and birds. The diversity we see in the living world today is the result of subsequent geographic separation and isolation of species and natural selection.  
(g) Following the Global Flood, we hypothesize an Ice Age of undetermined duration brought on by the massive climate changes induced by the Flood.  It was during this time that the dinosaurs and many other species died out. Since the time of the Ice Age, the structure of the earth's crust and the climate which followed, has not changed appreciably, and uniformitarian principles may now be applied to geological studies.
(h) We hypothesize a supernatural intervention by God at the Tower of Babel which instantly created several new languages (we think on the order of 12 or so), whereas prior to this event, there was only one language.
(f) The record of these events (except the Ice Age) was dictated to selected individuals such as Adam and Seth and their descendants and carefully recorded on stone tablets, then passed down to successive generations.  Moses eventually received these stone tablets (or copies of them) and composed the book we now call Genesis by compiling these records into one written document.  He then composed his own written record of the events of his own lifetime, resulting in the complete Pentateuch.
(g) God personally dictated the events of the Creation week to the first man, Adam, but then assumed a less active role in the composition of the balance of Genesis and the balance of what is now commonly called the Christian Scriptures.  This role varied from active dictation in an audible voice to less obvious methods--we might call it "planting of thoughts" in the minds of the writers.  This collective process is commonly called the "Inspiration of Scripture" by Christian Theologians.
(h) Many cultures in geographically diverse locations around the world have legends which follow the general outline above.  The reason for the variance we find in the legends is that many of them are simply oral traditions passed down through the generations without the benefit of scrupulous copying of written records that the Christian Scriptures have enjoyed.  Since the Documentary Hypothesis (Graf-Wellhausen Theory) has now been thoroughly discredited, we have good reason to revert to the previously well established hypothesis that Genesis is NOT oral tradition, but rather it is a carefully copied written record of eye-witness accounts.
(i) The Christian Scriptures, i.e. the 66 books of what is commonly called the Holy Bible, are essentially the WRITTEN record of what this Super-Intelligent, Super-Powerful Creator God wanted mankind to know about Himself, His Creation, and His Plans for the Future.
(j) Jesus of Nazareth is the single most influential human being to ever walk Planet Earth.  Also, there are over 300 specific prophecies concerning a supposed "Messiah" figure throughout the Jewish Scriptures -- what Christians call the Old Testament.  These prophecies "just happen" to all converge in the life of one man of history--Jesus of Nazareth. We hypothesize that this Jesus of Nazareth was (and is) the Creator God in human form, just as he claimed to be.
(k) The Christian Scriptures consisting of the Jewish Scriptures plus what is commonly called the New Testament are the most basic and foundational collection of documents for all of mankind's activities on Planet Earth--from scientific endeavor to family activities to government structure.  They also are the only reliable source documents for knowing the future of Planet Earth and Mankind in relation to it.  As such, these Scriptures should be the basis and starting point for all human activities from individual behaviour to family operation to nation building and governance of human affairs to scientific endeavors and the arts.

So now you have the "AFDave Creator God Hypothesis" ... this is my first draft and alomost completely my own words.  While it is true that I have done extensive study, the only sentence to my knowledge "lifted" from an outside source is the first sentence of para (b).  This hypothesis covers many of the main points that I believe should be included, but I would welcome any constructive comments suggesting additions, modifications, or clarifications.

Please remember ... this is MY HYPOTHESIS, and as such, I have only completed Steps (1) and (2) outlined at the first of this post.  Steps (3) - (5) are coming later.

And now ... let the games begin!  (And let the rotten tomatoes fly!;)

I welcome your comments!

Date: 2006/04/27 07:10:03, Link
Author: afdave
I just posted "AF Dave's God Hypothesis"  as a new topic ... check it out ...

This post, and a fairly recent picture is also at my recently revived blog site airdave.blogspot.com ...

I welcome your comments!

Date: 2006/04/27 07:24:40, Link
Author: afdave
Remember ... it's my Hypothesis and it can be anything I want ... the evidence to support it is coming later ...

Return hugs!

Date: 2006/04/27 11:18:14, Link
Author: afdave
Excellent questions ... I think I will be able to answer many of them without recourse to "God works in mysterious ways" type answers ...

Any more questions anyone?

Date: 2006/04/27 12:32:25, Link
Author: afdave
No ... probably won't convince you, Arden, but there are others ... remember a guy named C.S. Lewis?  Probably more skeptical than you and he ended up as a Christian apologist ... ditto for Josh McDowell, Lee Stroebel and a host of others ...

Hmmm ... Arden Chatfield, the next great Christian apologist ... I like it!

Date: 2006/04/27 14:10:51, Link
Author: afdave
No, Arlen, there are mountains of evidence ... maybe not evidence to your liking ... but there is evidence alright, and my guess is you've probably seen alot of it already ...

But that's OK, I'll be giving it again ...

Date: 2006/04/27 16:30:56, Link
Author: afdave
Calm down, Seven Popes, we're not planning on condemning scientists ... we're just planning on putting a little balance back into academia ... you know, like Rush Limbaugh balances the libs in politics?

And can I be an intellectual elite also if I can spell "intellectual" and "categorizing" correctly?

Date: 2006/04/28 01:18:25, Link
Author: afdave
Hey Seven Popes ... here's your documentation you asked for ...
Quote
Comment #98068
Posted by 'Rev Dr' Lenny Flank on April 23, 2006 12:06 PM (e) (This is on the 'Of Storks and Babies' Thread on the main PT blog)

What if a few of the “already-converted” start to think a little more deeply about the human condition and, as a result, start to open their minds a bit?

The costs outweigh the benefits.

As I’ve noted, in 20-plus years of anti-creationist organizing, I can count on the fingers of one hand the sum total of all the creationists I’ve ever seen be “converted”.

And indeed, for every one that gives up ID/creationism, there are three or four more ready to take his place. It just doesn’t matter how many ID/creationists we convert —- that simply will not weaken or cripple their movement. No political movement in history has ever been beaten by converting all its members to another view.

We can only beat them as a political movement, by out-ORGANIZING them.


Quote
Dave, there is no top of the heap.

Wow ... that's TWO people now who think there is no 'top of the heap.'  My mind just WHIRLS with fun possibilities for debating this topic ... maybe soon!

Quote
What exactly do you mean by balance?

What I mean by 'balance' is simply that there IS an alternative for explaining origins (besides evolution) that is very plausible to at least half the public.  To me this requires that universities at least allow students to HEAR some of the more common alternatives, such as ID and Creationism.  I see this is happening at Cornell and this is a good start.

Date: 2006/04/28 04:43:11, Link
Author: afdave
AFDAVE'S CREATOR GOD HYPOTHESIS

TESTABLE PREDICTIONS AND OBSERVATIONS FOR POINT 1

POINT 1:  THERE IS A GOD
My hypothesis is that there is a Super Intelligent, Highly Moral [added], Incredibly Powerful Being -- I choose to call him God -- who has knowledge of scientific laws far more advanced than anything ever discovered by 21st Century humans.  These scientific laws are so powerful that this Being can literally "speak" material things into existence and destroy things with a simple command.  This Being lives "outside of time" and can view what we call "the future" and "the past" with equal ease.

TESTABLE PREDICTIONS FROM POINT 1
(a) A Super Intelligent Being would be expected to design highly sophisticated machines and systems.  So we would expect to find a vast number of wonderful innovations in the universe which at least appear to be designed.  Our expectation of this comes from our own experience ... i.e. "Airliners are complicated machines and we know they are designed.  Our own bodies are much more complicated, so they appear designed, etc." (Dawkins, "Blind Watchmaker", p.3).  Can we test this prediction?  Absolutely.  Even prior to the molecular biology revolution, we stood in awe of bird's wings, bat navigation, eyes, hands and other brilliant innovations.  But since the opening of "Darwin's Black Box," our awe of the wonders of nature has increased exponentially.  There are three absolute "must reads" on this topic--"Darwin's Black Box" by Michael Behe, "Evolution: A Theory in Crisis" and "Nature's Destiny" both by Michael Denton.

(b) An Incredibly Powerful Being would be expected to build systems of mind-numbing size and power, such as a power generation system to supply power to all His innovative machines, maybe a lighting system so his creatures can see to navigate on the planet, perhaps a water supply and filtration system to provide clean water to His little creations, and so on.  Can we test this prediction?  Again, yes.  We find exactly what we predicted.  The sun is a massive power generation and lighting system which has every appearance of engineering brilliance.  Ditto for earth's hydrologic cycle which provides, filters and circulates water for all life on earth.  The sheer size and power of these systems stagger the human mind and are precisely what we would expect if there were such a thing as an Incredibly Powerful Being, such as God.

© A Highly Moral or Ethical Being would be expected to "build in" some Laws of Right and Wrong into his universe.  Can we test this prediction?  Yes.  This is precisely what we find in our experience.  This is a truly fascinating study and my argument comes from "Mere Christianity" by C.S. Lewis, the great Skeptic turned Christian Apologist, author of the books behind the current "Narnia" movie series.  Basically, the argument is that we find this curious "Law of Right and Wrong" or "Law of Human Nature" at work in our every day experience.  If you examine it, you find that it is quite real and applies to all humans regardless of religious upbringing or lack thereof.  Lewis then argues that there necessarily has to be "Something Behind the Law" which caused it to be.  I think he makes his point very well and I agree with him.  Come on, guys, I read Dawkins' stuff, so you can read Lewis' stuff ... let's be fair.

(d) We would expect that IF there were such a thing as a Supernatural Being like  my "God" persona, we would expect there to be many claims that people have received Written Messages from Him.  Can we test this prediction?  Again, yes.  There are many ... the Bible, the Book of Mormon, the Koran to name a few.

(e) We would expect to hear many claims of "Supernatural Experiences" such as people hearing voices, seeing visions of shining beings, out-of-body experiences, etc.  Can we test this prediction?  Yes.  These reports are plentiful and have been reported since the dawn of history.  No documentation needed for that. Note that with (d) and (e), I am not saying that any of these written messages or claims of supernatural experiences are necessarily true (we will examine the truth claims of the Bible separately). At this point, I am only predicting that IF there were such a thing as a Supernatural Being, that there would be many claims of "seeing Him, hearing from Him, etc."

(f) If there is such a thing as a Being who can "speak" things into existence using advanced scientific principles which humans have not yet discovered, then I would predict that there would be some sort of relationship among matter, energy and "nothingness." Do we find such a relationship?  Well I do.  Now I'm going to get lots of rotten eggs on this one, but hear me out. It has now been well established that matter can be converted into energy, and before that it was shown that matter is largely "nothingness."  Now let's dig deeper.  Take a neutron, just to pick a particle.  Divide it in half, what do you get?  Keep dividing and keep answering the question "What do you get?"  Answer?  I don't have a clue.  But if you go far enough and really let your mind bend, you may find that it resembles NOTHING very closely.  And a hundred years from now, we might just discover that all the matterin the universe is nothing more than "Fancily Arranged Nothingness", which would fit my hypothesis quite nicely, i.e. that God Created the World out of Nothing.  I freely admit that this part of my hypothesis requires much further research and testing, but it appears to me that there has been significant progress toward supporting a crazy hypothesis like this in the 20th Century.  Besides, what fun is a hypothesis anyway if it doesn't bend your mind a little? And remember, when I am done walking through the support for my complete hypothesis, there will be some unanswered questions.  I will never be able to completely PROVE my entire hypothesis, but this is true of all hypotheses.  What I can do, though, is make an informed "faith" decision on how to live my life based on what I DO know.

(g) If there is such a thing as a Being who "lives outside of time" viewing the future and the past with equal ease, then I would predict that Time is not an infinite concept, but is something which is not absolute and can be manipulated, possibly even a "created thing" with a beginning and an end.  Can we test this prediction?  Yes.  Time Dilation has now been demonstrated in many laboratory studies which I am sure you are all familiar with.  We now know that if our technology allowed us to travel at 90% of the speed of light, time would slow down a significant amount relative to our original location in the universe. (Did I get that right? ... it's been 20 years since physics class)

Various Questions:  Hypothesis of what?  Answer:  A Hypothesis which attempts to explain the origin of the universe, planet earth and all life that we see here. Cain and Abel? Where did Cain get his wife?  Etc.  Answer:  This is a fun one, and we will get to it.  I have a very good answer. Why is it important to you that the bible be inerrant?  Answer: I am not "married to" inerrancy.  I am quite happy to discard my view of inerrancy the moment someone suggests a credible error that they can defend.  

I have one request.  I have told you about myself and a little about my background.  I am curious to know your backgrounds as well.  If every responder would tell me their educational background and current occupation (and anything else you want to disclose), I would enjoy hearing it.  

OK ... let the games begin!  You can be as mean and nasty or as polite as you like.  I have very thick skin from Air Force barrooms, and I can dish it out with the best of them!  I will point out, however, that in spite of my apparent irrational, lunatic, Creationist beliefs, I am a potential "convertee" such as those referred to by the 'Rev Dr' Lenny Flank.  So if you want me to convert, you might try the calm, rational technique, rather than the "Rant/Rave/Rotten Tomato" technique.

Date: 2006/04/28 05:12:31, Link
Author: afdave
Lenny's not infallible, just assumed to be a good "sample" of majority PT thought ... and I like his title ... Oh, and I forgot ... where should I send my interpretations of certain posts to have them receive the "official, approved PT interpretation"? :-)

Faid said ...
Quote
To be honest, I was a little surprised at first... I didn't know there were actually any people who thought the process of evolution was a struggle to be crowned "King of All Life".

I don't know of anyone like that either.  I don't think this.  I think humans were CREATED as the "rulers" over all other non-human life.

Date: 2006/04/28 06:43:43, Link
Author: afdave
Occam's Aftershave said ...
Quote
You hypothesize that it rained last night
You predict “If it rained,  my driveway will be wet”
You look out the door in the morning and observe a wet driveway.That doesn’t mean that it rained last night – maybe your wife just washed the car there, or your next door neighbor’s lawn sprinkler was mis-aimed.  
You cannot conclude rain just by seeing a wet driveway.
The wet driveway doesn’t preclude your hypothesis, but it does not qualify as something that confirms your hypothesis either.

Quite true that ONLY the wet driveway would not suffice, but I think I am saying that I have "seen the wet driveway, saw the full rain gauge, saw the forecast the night before, etc." ... so to speak ... does that clear it up for you?  And even with all that, I would not say that I could PROVE 100% that it rained last night ... but there is a point at which I have enough evidence with which to feel comfortable and go ahead and make decsions based upon my well-grounded belief that it did rain.  (Very cool profession you have by the way ... love to hear about that sometime)

Eric Murphy--  My hypothesis does not purport to EXPLAIN Time Dilation ... others more competent than I have done that.  If you'll notice, it only PREDICTS THE EXISTENCE of such a phenomenon.

Thanks for the comments!

Date: 2006/04/28 07:12:26, Link
Author: afdave
You're right ... Clinton was a disaster ...

Hey Flint, if you want some good thinking, go look at  my new thread "AFDave's Creator God Hypothesis" where I posted my Testable Predictions for Point 1

Date: 2006/04/28 07:17:32, Link
Author: afdave
Wait ... let me be more specific, Flint, if you want to get that process you were talking about re-started in your own head, go over to my new thread ...

Date: 2006/04/28 17:06:22, Link
Author: afdave
Quote
The real, original Bible, namely the Hebrew Bible, says nothing of the sort, EVEN IF INTERPRETED LITERALLY. You must have been reading some of those sloppy, inaccurate translations of the Hebrew Bible out there, such as the KJV.

I have about 5 different Bible versions, a good friend who is a Hebrew scholar, and my dad is a linguist who knows Hebrew and Greek ... does that count for anything?  Or am I still misguided?  You are actually jumping ahead to Points 9 and 10 I think ... I will get to that soon.  Do you have any comments on Point 1?
Quote
This is what he learned in fundy school

So is UT a fundy school now?  I graduated in '86 and it wasn't then ... hmmm ... maybe they changed ...

Date: 2006/04/29 02:32:03, Link
Author: afdave
AF Dave Explains Cain's Wife

Many people ask the question, "If the the Book of Genesis is true, who did Cain marry?"

It's a very good question and there is a very good, scientific answer.  Before I do that, let me say thanks for stopping by and if you want to hear more, check for other "AFDave" articles on this blog or on my own blog (airdave.blogspot.com).  I spend more time here, though.

The short answer is that with no other information than what the Bible gives, we have to assume CAIN MARRIED ONE OF HIS SISTERS.

This raises some obvious questions like "Huh??" and "Yuk!" and "What about biological deformities?" and the like ...

My answer comes from (surprise!;) ... www.answersingenesis.com ... you can find the whole article here http://www.answersingenesis.org/home/area/tools/cains_wife.asp, but I will extract some of it for you ...

Today, brothers and sisters (and half-brothers and half-sisters, etc.) are not permitted by law to marry because their children have an unacceptably high risk of being deformed. The more closely the parents are related, the more likely it is that any offspring will be deformed.

There is a very sound genetic reason for such laws that is easy to understand. Every person has two sets of genes that specify how a person is put together and functions. Each person inherits one gene of each pair from each parent. Unfortunately, genes today contain many mistakes, and these mistakes show up in a variety of ways. For instance, some people let their hair grow over their ears to hide the fact that one ear is lower than the other—or perhaps someone’s nose is not quite in the middle of his or her face, or someone’s jaw is a little out of shape—and so on. Let’s face it, the main reason we call each other normal is because of our common agreement to do so!

The more distantly related parents are, the more likely it is that they will have different mistakes in their genes. Children, inheriting one set of genes from each parent, are likely to end up with pairs of genes containing a maximum of one bad gene in each pair. The good gene tends to override the bad so that a deformity (a serious one, anyway) does not occur. Instead of having totally deformed ears, for instance, a person may only have crooked ones! (Overall, though, the human race is slowly degenerating as mistakes accumulate, generation after generation.)

However, the more closely related two people are, the more likely it is that they will have similar mistakes in their genes, since these have been inherited from the same parents. Therefore, a brother and a sister are more likely to have similar mistakes in their genes. A child of a union between such siblings could inherit the same bad gene on the same gene pair from both, resulting in two bad copies of the gene and serious defects.

However, Adam and Eve did not have accumulated genetic mistakes. When the first two people were created, they were physically perfect. Everything God made was ‘very good’ (Genesis 1:31), so their genes were perfect—no mistakes! But, when sin entered the world (because of Adam—Genesis 3:6ff, Romans 5:12), God cursed the world so that the perfect creation then began to degenerate, that is, suffer death and decay (Romans 8:22). Over thousands of years, this degeneration has produced all sorts of genetic mistakes in living things.

Cain was in the first generation of children ever born. He (as well as his brothers and sisters) would have received virtually no imperfect genes from Adam or Eve, since the effects of sin and the Curse would have been minimal to start with (it takes time for these copying errors to accumulate). In that situation, brother and sister could have married with God’s approval, without any potential to produce deformed offspring.

By the time of Moses (a few thousand years later), degenerative mistakes would have built up in the human race to such an extent that it was necessary for God to forbid brother-sister (and close relative) marriage (Leviticus 18–20).12 (Also, there were plenty of people on the Earth by now, and there was no reason for close relations to marry.)

Date: 2006/04/29 02:32:03, Link
Author: afdave
AF Dave Explains Cain's Wife

Many people ask the question, "If the the Book of Genesis is true, who did Cain marry?"

It's a very good question and there is a very good, scientific answer.  Before I do that, let me say thanks for stopping by and if you want to hear more, check for other "AFDave" articles on this blog or on my own blog (airdave.blogspot.com).  I spend more time here, though.

The short answer is that with no other information than what the Bible gives, we have to assume CAIN MARRIED ONE OF HIS SISTERS.

This raises some obvious questions like "Huh??" and "Yuk!" and "What about biological deformities?" and the like ...

My answer comes from (surprise!;) ... www.answersingenesis.com ... you can find the whole article here http://www.answersingenesis.org/home/area/tools/cains_wife.asp, but I will extract some of it for you ...

Today, brothers and sisters (and half-brothers and half-sisters, etc.) are not permitted by law to marry because their children have an unacceptably high risk of being deformed. The more closely the parents are related, the more likely it is that any offspring will be deformed.

There is a very sound genetic reason for such laws that is easy to understand. Every person has two sets of genes that specify how a person is put together and functions. Each person inherits one gene of each pair from each parent. Unfortunately, genes today contain many mistakes, and these mistakes show up in a variety of ways. For instance, some people let their hair grow over their ears to hide the fact that one ear is lower than the other—or perhaps someone’s nose is not quite in the middle of his or her face, or someone’s jaw is a little out of shape—and so on. Let’s face it, the main reason we call each other normal is because of our common agreement to do so!

The more distantly related parents are, the more likely it is that they will have different mistakes in their genes. Children, inheriting one set of genes from each parent, are likely to end up with pairs of genes containing a maximum of one bad gene in each pair. The good gene tends to override the bad so that a deformity (a serious one, anyway) does not occur. Instead of having totally deformed ears, for instance, a person may only have crooked ones! (Overall, though, the human race is slowly degenerating as mistakes accumulate, generation after generation.)

However, the more closely related two people are, the more likely it is that they will have similar mistakes in their genes, since these have been inherited from the same parents. Therefore, a brother and a sister are more likely to have similar mistakes in their genes. A child of a union between such siblings could inherit the same bad gene on the same gene pair from both, resulting in two bad copies of the gene and serious defects.

However, Adam and Eve did not have accumulated genetic mistakes. When the first two people were created, they were physically perfect. Everything God made was ‘very good’ (Genesis 1:31), so their genes were perfect—no mistakes! But, when sin entered the world (because of Adam—Genesis 3:6ff, Romans 5:12), God cursed the world so that the perfect creation then began to degenerate, that is, suffer death and decay (Romans 8:22). Over thousands of years, this degeneration has produced all sorts of genetic mistakes in living things.

Cain was in the first generation of children ever born. He (as well as his brothers and sisters) would have received virtually no imperfect genes from Adam or Eve, since the effects of sin and the Curse would have been minimal to start with (it takes time for these copying errors to accumulate). In that situation, brother and sister could have married with God’s approval, without any potential to produce deformed offspring.

By the time of Moses (a few thousand years later), degenerative mistakes would have built up in the human race to such an extent that it was necessary for God to forbid brother-sister (and close relative) marriage (Leviticus 18–20).12 (Also, there were plenty of people on the Earth by now, and there was no reason for close relations to marry.)

Date: 2006/04/29 05:27:30, Link
Author: afdave
Thanks for all the good input ... I do enjoy posting on this site (as opposed to an ID or YEC site) precisely because most people here DO NOT agree with me ... I have yet to find one that does ... my thought is ... why put sugar into lemonade that's already sweet? I enjoy reading, thinking, writing and debating, and trying to persuade people to adopt the right ideas.  I love living in the USA because more than anything else, the USA is an IDEA for whom our founders risked everything.  At our capitol building in Missouri, it has a saying posted prominently something to the effect of "Ideas are Incredibly Powerful" and they are.  My BIG IDEA is that the USA is the most successful nation ever in the history of the planet precisely BECAUSE it was founded squarely upon a literal interpretation of by far the best, most accurate (scientifically and historically) and valuable collection of writings ever written--the Christian Scriptures.  For this reason, I am very politically involved, I make financial contributions to Christian activist organizations, and I am actively working to employ several strategies to ensure to continued dominance of the General Christian worldview throughout our government.  By the way, I'm full time now at non-profit activities such as this, so I'm really starting to have fun.  Not to worry, though.  We're not planning on taking America back to medieval Europe when the supposedly Christian popes ruled like tyrants.  No ... my vision is simply to restore the Protestant Christian principles into all levels of government which have proven themselves to be so successful for making happy citizens and allowing all people to enjoy the freedom to practice whatever religion they choose:  Atheists, Buddhists, Muslims, Evolutionists and all other religions are all quite welcome in this country.  We Protestant Christians won't execute you if you don't want to practice Protestant Christianity.  Also, whether we like what is IN the Christian Scriptures or not, the fact is that skeptics have tried for centuries to  do precisely what some people on this blog are trying to do and they have failed.  The Bible DOES in fact appear to be literally true, when one examines it honestly.

Now to answer some objections ...

Occam's Aftershave ... first, you dodged my response to your first objection and now you are bringing up a second.  That's fine, but I would like to hear your answer to my first response.  To respond to your second ... the fact that we observed all these things you mention BEFORE I proposed my hypothesis means nothing.  Remember, we are hypothesizing about something we have never seen.  Someone on this thread said that "we have to explain the phenomenon (God) in terms of other phenomena that are well-understood, and simpler than the phenomenon we are purporting to explain."  He is correct in my view and I think I have done that in my predictions. Further, the Great Founders of Modern Science made many of their great discoveries by doing precisely what I have done in, for example, my Testable Prediction A.  Newton hypothesized that there was an Intelligent Creator and he made the prediction that because of this, we should expect to find order in the Universe.  He then set about to try to support his hypothesis and I would say he was successful, wouldn't you? Had he or others observed order in the universe BEFORE he made this prediction?  Of course, but this did not invalidate his hypothesis or his predictions.  Does this help?  One other thing to keep in mind as we proceed through my Hypothesis ... many modern scientists have basically "booted out" many previously well accepted "Rules for Science" and have erected some of their own rules.  I understand, they haven't booted everything ... I agree that modern scientists have and will continue to do extremely useful work ... I'm all for this ... my business, my health, my food ... many things have benefited from this process.  But this idea of "Science is not science if it even mentions the possibility of a 'god'" is just foolish.  Theology actually used to be called "The Queen of Sciences" in the Western world and I predict that it will soon go full circle and ascend the throne once more.  Michael Denton's fascinating conclusion to his book, "Nature's Destiny" makes this prediction.  Lastly, I invite you to do two things (a) go ahead and propose your own hypothesis and try to defend it as you have suggested and (b) imagine for a minute IF THERE REALLY WAS a God as described in the Bible and there REALLY IS the possibility of Heaven and He11 and all those other things ... I think you at least have to admit that it's LOGICALLY possible that it's true.  This being said, why would anyone simply make statements like "Well, it can't be true" (I hear this alot here at PT) or the converse "It's in the Bible so it has to be true" (I'm accused of this some in spite of the fact that I don't say this) without any attempt at verification whatsoever?  Both statements seem like utter foolishness to me. To me, it is the Evolution Dogmatists that are flying in the fog bank and leading many unsuspecting young students to think like they do.  I am trying to lead those students into some clear air before it's too late.
Quote
Utter rubbish
Don't know how to respond unless you get more specific.
Quote
My Flood is nonsense
(even before seeing my evidence) Another quite original response similar to the one above--I'll show you plenty of evidence in good time -- Points 5 & 6 of my Hypothesis -- we're only on Point 1 right now
Quote
Cain's wife
A very common question and a good one ... I give my answer here ... http://www.antievolution.org/cgi-bin....;t=1956
Quote
"Speaks" is a temporal act
Unfortunately, humans are limited with a finite number of words and I am further limiting myself to a subset of all possible words called the English language.  Of course, I don't mean that God spoke the world into existence in the human sense of the word.  If you have a suggestion for a better way to propose that piece of my hypothesis, I am open to it.
Quote
Have I ever read a book on evolution?
Yes ... many of them.  How can I NOT?  They are EVERYWHERE!  I have to work real hard to find my kids some science books that DON'T have some form of the Evolution Religion worked in.  By the way ... I have trouble finding museums for my kids that don't preach "Evolution and Millions of Years" also, but that's about to change!  See this link ... http://www.answersingenesis.org/museum/
Quote
Further, it completely abuses the principle of parsimony, which leads us to accept for consideration the hypothesis that asks us to make the fewest and the best supported assumptions.
I think I have observed this principle well ... how have I not?  Can you be specific?
Quote
Beliefs such as yours cannot be BOTH honest and rational; attempting to pretend to rationality only undermines your honesty while adding nothing rational to your beliefs. Is this what you really want?
If modern Dogmatists of the Evolution Religion are the ones setting the rules for what is rational and what is not, then, of course, it follows that they would think people like me are NOT rational or logical.  If however, we return to some of the Pre-Darwin principles of science which in my opinion have been WRONGLY booted out, then I think I would be considered to be both rational and logical.
Quote
I don't anticipate that you'll get much traction here with the evidence you present and I can't imagine you expect to; nor, however, do I expect this will deter you. So, before the ritualized but necessary debunking begins,
That's a very good description -- "Ritualized Debunking" -- it almost conjures up images from Dan Brown's novel of Sophie's grandfather and his secret ritual dance.  Obviously, that would be a stretch, but it interesting to watch some of the same "rituals" we saw in organized religion--the medieval Roman Catholic Church--being carried out today by another bastion of power--Acedemia.
Quote
Please don't try to present evidence for a young earth or a global flood, it's not funny any more.
I will soon, but you don't have to listen if you don't want to.
Quote
Why oh why does anything about god matter in even the slightest bit to humans?
Funny isn't it?  There were almost 500 responses to "The God Meter" thread on the main PT site.  People love to talk about God and I think I know why!  I would like to officially propose to the moderators of PT that they start many more "God" topics.
Quote
Looks pretty ad hoc to me.
 Wonderful.  How and why?
Quote
The Old Testament was passed down orally through generations. The four Gospels were all written long after the death of Jesus, differ in details.
No. THIS is the oral tradition that has now been thoroughly debunked.  Go read Josh McDowell's "Evidence That Demands a Verdict, vol 2" and his "New Evidence That Demands a Verdict" and Lee Strobel's "The Case For ..." books.  No one has ever found any JEDP documents and writing is now known to have occurred LONG before Moses, which was the basis for the Documentary Hypothesis in the first place.  Dan Brown is actually doing Christian apologists a HUGE favor by getting people to examine many of the lame assertions such as this which have been put forward by skeptics then debunked for centuries.
Quote
Also, how well does your hypothesis survive this test: if the various religious texts are indeed the Word of God, wouldn't we expect them to largely agree with each other?
No. We must critically examine each of them as they arise.  Many Christian apologists have done this through the centuries.  I'll try to give you some reading sources for this soon.
Quote
If I were creating a hypothesis about how the universe came to exist, the last thing I would predict would be personal greeting cards from its creator to individual humans.
 Really?  Why not?  Can you imagine you and your wife (or husband) having some kids, then giving them some greeting cards at Christmas and at Birthdays?
Quote
Most engineers I know try to design simple systems.
 Really?  So you think an Boeing 777 is simple?  Is the Space Shuttle simple?  How about a Pentium chip?  Simple?  Hmmmm ... don't follow you there ...  
Quote
Would an all-powerful entity, that made an entire universe for one species, waste so much space and energy for nothing? If the sun is an amazing power plant created for us alone, why are there so many others (billionz and billionz of them, as that late evil atheist would say), larger and more efficient, that burn in vain?
 I would not say they are all in vain.  For example, I think all those stars and galaxies are beautiful, don't you?  Is it in vain that my wife likes to decorate my house with pretty things?
Quote
Also, where do you see this sense of "right and wrong" in the universe outside ourselves? Where exactly are these "laws" written in the universe? in the stars? the earth? where?
Good question.  Others had this question also.  I will do a separate post with some explanation of this.  Look for "AF Dave Explains CS Lewis' Morality Laws" soon.
Quote
afdave, I'd say you'd have more fun posting on umcommon descent where people who think like you tend to gravitate
See my "Sugar in Lemonade" remark above.
Quote
Oh and I have read Lewis, he doesn't bring anything new to the table either.  If you have read one Christian apologist you have read them all.  They all play by a different set of "logic" rules, make stuff up as they go along, make extreemly subjective and unproveable claims, all of which kills any chance of a meaningful discussion.
Yes.  They play by rules that we "underlings" with smaller, less-evolved brains can actually understand.  Sometimes modern "intellectual elites" speak in such erudite terms that I sometimes wonder if THEY UNDERSTAND THEIR OWN STATEMENTS THEMSELVES!
Quote
Here is an introductory lesson in critical thinking for you: 1) The fact that many people make the same claim, and have done so for a very long time, is not evidence that their claims are true.  An idea's popularity is not an indication of its validity.
Did I say that my hypothesis is valid because it's popular?  Where did I say that?
Quote
Oh my, wild assertions person meet wild assertions person.
You'd think I was hypothesizing that the moon was made of green cheese.  These aren't wild assertions.  There's a lot of reasonable people (many of them got their PH.D's in secular universities, then rejected Evolutionism because it didn't make any sense to them) who not only have put forward these same assertions, but they have arrived at them independently from their own research.
Quote
Don't you think the authors of the Bible would have changed Genesis if they could have seen this image?
No.  The idea that early humans were somehow dumb and didn't know anything about science is an invention of modern skeptics.  There is now all kinds of good evidence that there was a vast amount of scientific understanding back to 3000BC and before.
Quote
Why did God invest so much effort into this tiny dust speck,  but now interacts with the material world more weakly than a neutrino?
Why would you and your spouse invest so much time and effort into having a tiny baby who screams and yells and totally rearranges your life? One word.  LOVE.  I could give you the Bible verse if you like, but if you are anything like Arlen Chatfield, you probably know it already.
Quote
In the name of religious authority and an overly literal view of the Bible, treatments that may at some point prevent untold further suffering are being blocked.
Can you elaborate?

OK ... fire away again!

Date: 2006/04/29 06:18:24, Link
Author: afdave
Well Faid, as I said on another thread, there are many people coming over to the AIG position, many of them who earned PH.D's at secular universities and were also skeptics like yourself.  Maybe you should talk with them.  And if this does not convince you, maybe you should set up your own "Ministry" to convince people of you and your fellow skeptics beliefs.  Maybe you could get invitations to churches if you were convincing enough.  Rent a sports stadium and have big conferences and promote your view in a big way!  This is America ... go for it!

Date: 2006/04/29 06:18:24, Link
Author: afdave
Well Faid, as I said on another thread, there are many people coming over to the AIG position, many of them who earned PH.D's at secular universities and were also skeptics like yourself.  Maybe you should talk with them.  And if this does not convince you, maybe you should set up your own "Ministry" to convince people of you and your fellow skeptics beliefs.  Maybe you could get invitations to churches if you were convincing enough.  Rent a sports stadium and have big conferences and promote your view in a big way!  This is America ... go for it!

Date: 2006/04/29 11:32:47, Link
Author: afdave
Excellent ... keep 'em coming ... I'll be doing a single mass rebuttal on Monday morning ...

And who knows ... maybe even a retraction or two if your arguments are good enough ... I'm an open-minded guy!

Date: 2006/04/29 11:48:06, Link
Author: afdave
Yes, I've read many of the myths and they help confirm my theory that the Christian Bible is inerrant ... we'll cover that under Point 9 of my "Creator God Hypothesis".  I have also studied the different sections of Genesis and, as you can probably guess, have a different theory than you which I believe has excellent support.

You make a good point, however, that I should add some more information into my hypothesis between Points 2 & 3 which specifically addresses the Cain's wife issue.  I did mention that my hypothesis is a draft and I am open to additions and changes as they become necessary.

Faid, don't be offended by my joke about starting your own "ministry" ... by the way, I do have your detailed questions from yesterday (?) saved and will answer them as I have time.

I appreciate all the comments ... see you Monday!

Date: 2006/04/29 11:48:06, Link
Author: afdave
Yes, I've read many of the myths and they help confirm my theory that the Christian Bible is inerrant ... we'll cover that under Point 9 of my "Creator God Hypothesis".  I have also studied the different sections of Genesis and, as you can probably guess, have a different theory than you which I believe has excellent support.

You make a good point, however, that I should add some more information into my hypothesis between Points 2 & 3 which specifically addresses the Cain's wife issue.  I did mention that my hypothesis is a draft and I am open to additions and changes as they become necessary.

Faid, don't be offended by my joke about starting your own "ministry" ... by the way, I do have your detailed questions from yesterday (?) saved and will answer them as I have time.

I appreciate all the comments ... see you Monday!

Date: 2006/04/29 16:23:24, Link
Author: afdave
Well, Corkscrew had some fairly convincing arguments on this thread ... and we had a good little dialog ...

I'm glad to hear any you might want to put forward ... and I do actually agree with your point about debating ME, not some PhD that was converted to AIGism ...

I would be interested in seeing how YOU would put forward a basic hypothesis for explaining the universe ... people here accuse me of all kinds of logic and parsimony errors and so on, so it would be interesting to see the shoe on the other foot and see how YOU do would do it ...

Cheers!

Date: 2006/04/29 16:50:50, Link
Author: afdave
Quote
Ok, I know to some extent that you are yanking our chains.
No ... I'm really not yanking anyone's chain intentionally ... I actually believe what I have written (yes, I know ... ladies are fainting and men are shaking their heads), but I would be glad to believe what you believe if I could be convinced of it by sound arguments ...

Date: 2006/04/29 17:02:38, Link
Author: afdave
Thanks.  I'll check it out.

Here's a question for people with er ... more of an Evolutionary mindset ...

How many cultures around the world practice a 7 day week and why?  

I honestly have not studied this, but would like to know ... Of course I know why Western Society does, but I'm curious about other cultures ...

Date: 2006/04/29 23:51:39, Link
Author: afdave
Yes.  I do Google searches about 40 times a day ... but I wanted to know what sources YOU would refer me to ... I've never figured out how to make Google do that for me ...

Date: 2006/04/30 00:47:41, Link
Author: afdave
One of the reasons I am here at PT is to try and understand how people think who have a different view of life than me ... it is interesting even if I don't agree

Yes, BBC gave me some new information I had not heard before ... as I said, I'm familiar with the Jewish, Roman, Western society reasons for the 7 day week, but not other cultures ...

Date: 2006/04/30 19:02:44, Link
Author: afdave
Well ... I said I would respond on Monday, but this is too much fun!

I do have to apologize for one thing ... as you might guess, I was reading my "Good Book" and these posts this morning and I was reminded that we are supposed to treat others as we would like to be treated ...

OOPS!  Flubbed that one!  I shouldn't make catty remarks that make it sound like Evolutionists with a lot of education are arrogant and should "get off their high horses." Might be true.  But it's not nice to make snippy remarks about it.  Bad Dave!

OK.  Now that we got confession out of the way, let the real fun begin!

First, it is clear that you all and I are not yet on the same page as to the STRUCTURE for this debate, so I thought I'd clear things up a bit.  People have slammed my logic saying things about A=>B etc, and it is now clear to me that I did not specify clearly the framework for the debate in terms that YOU UNDERSTAND.  I need to clarify that my reasoning about my "Creator God Hypothesis" DOES NOT follow the Deductive framework.  I have stated prior to giving my hypothesis, that I cannot provide a watertight proof for God and I don't believe anyone can, so people are correct in saying that my hypothesis would fail using the deductive schema.  However, we CAN use Abductive Reasoning then draw an Inference to the Best Explanation (IBE), and as Meyer points out below, this gives us powerful support for believing that the "Creator God Hypothesis" may in fact be true.  So there is good news, O Seeker of Truth!  There is massive support for the existence of God and for the literal truth revealed in the Bible.  Stay with me through all 12 (13?) (14?) points and I will show it to you in terms you can understand!  (We are only on Point 1 right now, so relax, grab a drink, and stay awhile)

Here's a little blurb on Abductive reasoning from Stephen C. Meyer.  I would HIGHLY, HIGHLY recommend reading his entire paper (only 23 pages) called "The Return of the God Hypothesis" which can be found here ...

http://www.arn.org/docs/meyer/sm_returnofgod.pdf

ABDUCTIVE REASONING
DATA: The surprising fact A is observed. (The finely tuned cosmos, biological machines, etc.)
LOGIC: But if B were true, then A would be a matter of course. (B is God and His written message, the Bible)
CONCLUSION: Hence, there is reason to suspect that B is
true.  

Stephen C. Meyer notes that "The natural and historical sciences employ such logic [abductive] routinely.  For instance, Peirce argued that skepticism about Napoleon's existence was unjustified although his existence could be known only by abduction: Numberless documents refer to a conqueror called Napoleon Bonaparte. Though we have not seen the man, yet we cannot explain what we have seen, namely, all these documents and monuments, without supposing that he really existed" (Peirce, C. S. 1931. Collected Papers. Eds. Charles Hartshorne & Paul Weiss. Vol. 2. Cambridge, MA: Harvard University Press).

A note on the term 'PREDICTION':  I think the term 'Surprising Fact' might be less confusing than 'Prediction' because 'Prediction' is used with Deductive Logic. I will use this term going forward so as to hopefully not confuse anyone again.

I have to tell you a little secret which I hope at least establishes my honesty with you if nothing else--Prior to writing my hypothesis, I had no fancy name for my framework of reasoning.  If you'd have pinned me down, I would have told you it was the "Common Sense Framework" or some such thing.  Remember, I was first an Electrical Engineer, then an Air Force pilot, then a businessman.  I was never a logician by trade, but that does not mean I can't become one very quickly, especially when I see gross incompetence in the field.  What I really am is an ordinary guy with a pretty good brain for learning most anything who is sick and tired of what appears to me to be absolute nonsense being fed to us from the Evolution Dogmatists.  We can talk all day long about A=>B and Bayesian logic and all the rest, but the bottom line is, the "scientists" have lost their way when speculating about how life began and developed.  It's utter nonsense and I am glad that my "Common Sense Logic Framework" actually DOES have a fancy name, albeit I have to modify my terminology a little.  I was also pleased to see the article referred to above because it is now obvious to me that I am not the only one floating the "God Hypothesis" again.  I am apparently in very good company and the pace is accelerating.

As a side note, I cannot quite figure out why alot of people here gripe so much about the DI saying they don't want to talk about God -- I even had somebody warn me that if I blogged over there and mentioned God, they would send me away.  Meyer talks plenty about God in this article.  Can someone explain that one?


Quote
Imagine if Newton had said:
-I observe that things fall down
-I propose that it's God's Omnipresent Hand that pushes them down
-I predict that, if God's Omnipresent Hand exists, it will push things down everywhere in the world
-I examine the world
-I see that things fall down
-I conclude that my testable predictions have been confirmed, and God's Omnipresent Hand exists. Do you really think that, in that case, anyone would think of him today as anything more than a crackpot?

Yes, I do think we would consider him a crackpot if he had reasoned this way. I am not reasoning this way.  See discussion above.
Quote
then how on earth does this "prediction" derive from your hypothesis? (other that trying to explain what you already see, of course...

"Trying to explain what I already see" IS THE ONLY THING I am trying to do ... I think I confused you by not being clear on the structure of my argument.  See above.
Quote
Somebody said my assumption is that "It is impossible for such a Supernatural Being to exist unless that Being sends written messages."

Really?  Where did I assume that?  I think all I did was make a prediction that IF my God persona exists, we would expect there to be claims of written messages from Him.  Given the discussion above, we can modify this to say the we "see this SURPRISING FACT that there are many written messages claiming to be from 'God'"
Quote
In all of these cases, your observations do not provide confirming evidence for your predictions, because there are other well supported explanations requiring no Supreme Being. ... To confirm your hypothesis, you need other evidence that could be caused by rain only.

Does the clarification above help you?
Quote
Second:  With all due respects, trying to "prove" the existence of God by examining the physical world is a fool's errand.

Again, I cannot prove it ... but I can make an Inference to the Best Explanation from my observance of 'Surprising Facts.' (See above)
Quote
I also note the deep hypocracy - you all demand that we teach "both sides of the issue," but refuse to do so with your own children!

Oh ... I teach them both sides alright ... guess which one they pick when they are given the whole truth about Evolution! (like ALL kids should be given)
Quote
Dave, how do you explain away the mountains of radiometric datings that prove the earth is some 4.5 billion years old?

This is really easy ... your assumptions are wrong (long answer later in the proper sequence)
Quote
But think about what you're up against [defending YEC]. You've got multiple lines of evidence from dozens of different scientific disciplines, and all that evidence converges on one value, within much less than an order of magnitude.

I was told this kind of nonsense by some IT guys when I set out in my telecom business to "do what no one in the industry had ever done before" ... they told me I could never do it, but I did it anyway.  This task is easier because Evolutionists are on a sinking ship.  My hope is to just rescue a few honest ones who want to be rescued.
Quote
So you not only want to do away with all of science, you also want to do away with the Constitution.

Wow ... must have stayed at the bar too long if that's what he heard.
Quote
Read a little history, Dave. Egypt's civilization lasted for thousands of years; the U.S. has been in existence for barely two hundred years.

By success, I mean "people would actually WANT to live there because it's such a great country."  Which country would YOU rather live in?  Ancient Egypt or USA?
Quote
And what about China?

Yes.  I forgot ... All Americans are now beginning to wear traditional Chinese dress and hairstyle and we're binding our women's feet and going back to subsistence rice farming because we want to be like the great Chinese nation.  Yes. Right.

To "Joe-the-Ordinary-Guy" -- Thanks for the excellent parable ... but you got the characters wrong.  The 'Auto Mechanic' represents all the good scientists from Ockham to Newton.  Then came a whole slew of 'Bakers', also known as Hume, Kant, Darwin, Marx, Freud and others.  Now the Creationists are stepping in again to clean up the whole mess.

To Norm Doering -- Your's and Aureola's comments were actually helpful to me -- I did not realize that my "Common Sense Logic" had a fancy name and I am also quite pleased that my logic is sound even though I didn't know the fancy name.  I have been saying all along that if someone points out things that need changing, I will change them.  See above.  Thanks again!

And finally to Corkscrew -- I always enjoy your comments ... I would be interested to hear your response to my discussion of Abductive Logic above.

Quote
(what's the deal with most people not wanting to write that [he11] out fully anyway?)

Use 'ones' for the L's ... if you don't the blog software cendors you.

Thanks!

Date: 2006/05/01 00:54:02, Link
Author: afdave
Quote
It is not Afdave and his ilk.
My goodness ... I've been called ILK again ... that's twice now!  Carol, I hope we can become friends even if we never end up agreeing.  I'm glad to find out that you are Jewish because I don't have many Jewish acquaintances here in Kansas City.  I love hearing what Jewish people have to say though because I hold the Jewish nation and people in very high esteem.  
Quote
During the sixth "era" (not day! the Bible tells us that God provided for the appearance of "humans" (Ha-adam, in Hebrew) not "Adams". When Adam appears, a sizeable population of human beings already existed. This also explains why Cain went about building a "city". There were enough folks around, just in his location, to populate a city!
Can you tell me what your basis would be for not reading the Hebrew word 'yom' as a literal day?  In all my study of the Hebrew scriptures, it appears to me that the word 'yom' is almost always one, 24 hour day.  My opinion is that some people think it is NOT a 24 hour day in Genesis only to accomodate what they believe to be incontrovertible evidence of the supposed long ages of evolutionary geology.

Faid-- You raise some very good points.  To answer them broadly, I have found that the difficulties clear up if I take away my 20th century presuppositions and frame of reference.  If we acknowledge the possibility that life was VERY different in the beginning, things become a lot clearer.  First, the Bible is very clear that the ante-diluvian patriarchs lived very long lives.  There are several independent lines of evidence supporting this, which I will get into in proper sequence.  Josephus tells us that the old Jewish tradition is that Adam had  33 sons and 23 daughters.  Josephus also tells us that one of Cain's descendants had 77 children by two wives.  (Antiq., Book 1, Ch. 2) Wow, those were tough women!  My hypothesis (short version) on this topic is that Adam and Eve and their near descendants were vigorous, model specimens of humanity--Ken and Barbie, if you will.  They probably had ZERO genetic defects and quite possibly were taller and stronger than modern humans. (notice that this is opposite of modern evolutionary speculation, but consistent with the evidence we see of accumulating deleterious mutations over time) If Cain was like his father, he had many children and they in turn had many more children.  My hypothesis asserts rapid population growth in the ante-diluvian world.  The Bible does not state that Enoch was Cain's firstborn. If he was not, there could have been MANY children and grandchildren BEFORE Cain and his clan moved to Nod.  Even if Enoch was his firstborn, we do no violence to the text by proposing that there could have been a 50-100 year time span between having Enoch and building the city.  Remember, 100 years was only a little over 10% of their entire lifespans.  As for why the writer use the word 'yada' (translated 'knew') instead of 'had sex with,' I could ask this question ... when you are at dinner parties, do you say to your friends, "Well, when my wife and I first met, we had dinner, went to a movie, then went to my house and had sex."  Probably, you don't talk about your private affairs, but if you do, you probably use some polite euphemism such as "we went to my house and 'made love.'  Of course if you are like 'hehe' you might have used the term 'banged.' I know this does not answer everything yet, but if you stick with me, I think you are going to be amazed at how clear everything becomes.

Rilke's GD-- Thanks!  And thanks also for your comments on my other thread.  I have taken yours and other helpful comments I received and clarified the structure of my "Creator God Hypothesis."  I want as many constructive comments on the structure and rules of my little debate as possible before moving ahead with additional points.

Midnight Voice and UnMark-- those are very easy examples to explain, but they are not my focus right now.  If you want a quick answer, Google search "Christian Research Institute" with the 'Bible Answer Man', Hank Hannegraf.

As for the 2 accounts of creation ... which came first?  Animals or Man.  No time now ... stay tuned!

hehe -- 'banging' ones sister apparently was fine with God in the beginning if you were married to her.  Again, there was no prohibition against this that I know of until the time of Moses by which time accumulated mutations would have posed a problem to close marriages with close kin.
Quote
I've met God!  And She's black!!

And her name is Condi ...!  Condi for president in '08!

Date: 2006/05/01 00:54:02, Link
Author: afdave
Quote
It is not Afdave and his ilk.
My goodness ... I've been called ILK again ... that's twice now!  Carol, I hope we can become friends even if we never end up agreeing.  I'm glad to find out that you are Jewish because I don't have many Jewish acquaintances here in Kansas City.  I love hearing what Jewish people have to say though because I hold the Jewish nation and people in very high esteem.  
Quote
During the sixth "era" (not day! the Bible tells us that God provided for the appearance of "humans" (Ha-adam, in Hebrew) not "Adams". When Adam appears, a sizeable population of human beings already existed. This also explains why Cain went about building a "city". There were enough folks around, just in his location, to populate a city!
Can you tell me what your basis would be for not reading the Hebrew word 'yom' as a literal day?  In all my study of the Hebrew scriptures, it appears to me that the word 'yom' is almost always one, 24 hour day.  My opinion is that some people think it is NOT a 24 hour day in Genesis only to accomodate what they believe to be incontrovertible evidence of the supposed long ages of evolutionary geology.

Faid-- You raise some very good points.  To answer them broadly, I have found that the difficulties clear up if I take away my 20th century presuppositions and frame of reference.  If we acknowledge the possibility that life was VERY different in the beginning, things become a lot clearer.  First, the Bible is very clear that the ante-diluvian patriarchs lived very long lives.  There are several independent lines of evidence supporting this, which I will get into in proper sequence.  Josephus tells us that the old Jewish tradition is that Adam had  33 sons and 23 daughters.  Josephus also tells us that one of Cain's descendants had 77 children by two wives.  (Antiq., Book 1, Ch. 2) Wow, those were tough women!  My hypothesis (short version) on this topic is that Adam and Eve and their near descendants were vigorous, model specimens of humanity--Ken and Barbie, if you will.  They probably had ZERO genetic defects and quite possibly were taller and stronger than modern humans. (notice that this is opposite of modern evolutionary speculation, but consistent with the evidence we see of accumulating deleterious mutations over time) If Cain was like his father, he had many children and they in turn had many more children.  My hypothesis asserts rapid population growth in the ante-diluvian world.  The Bible does not state that Enoch was Cain's firstborn. If he was not, there could have been MANY children and grandchildren BEFORE Cain and his clan moved to Nod.  Even if Enoch was his firstborn, we do no violence to the text by proposing that there could have been a 50-100 year time span between having Enoch and building the city.  Remember, 100 years was only a little over 10% of their entire lifespans.  As for why the writer use the word 'yada' (translated 'knew') instead of 'had sex with,' I could ask this question ... when you are at dinner parties, do you say to your friends, "Well, when my wife and I first met, we had dinner, went to a movie, then went to my house and had sex."  Probably, you don't talk about your private affairs, but if you do, you probably use some polite euphemism such as "we went to my house and 'made love.'  Of course if you are like 'hehe' you might have used the term 'banged.' I know this does not answer everything yet, but if you stick with me, I think you are going to be amazed at how clear everything becomes.

Rilke's GD-- Thanks!  And thanks also for your comments on my other thread.  I have taken yours and other helpful comments I received and clarified the structure of my "Creator God Hypothesis."  I want as many constructive comments on the structure and rules of my little debate as possible before moving ahead with additional points.

Midnight Voice and UnMark-- those are very easy examples to explain, but they are not my focus right now.  If you want a quick answer, Google search "Christian Research Institute" with the 'Bible Answer Man', Hank Hannegraf.

As for the 2 accounts of creation ... which came first?  Animals or Man.  No time now ... stay tuned!

hehe -- 'banging' ones sister apparently was fine with God in the beginning if you were married to her.  Again, there was no prohibition against this that I know of until the time of Moses by which time accumulated mutations would have posed a problem to close marriages with close kin.
Quote
I've met God!  And She's black!!

And her name is Condi ...!  Condi for president in '08!

Date: 2006/05/01 01:34:47, Link
Author: afdave
Yes.  I understand  there are a lot of "Liars and Scheisters for Jesus" in the world and I try very hard not to be one of them.  I am very sincere about what I believe and I think it is the most rational position, amazing as that may sound to modern scientific ears.  

But I am also very sincere that IF a person from the "Evolution Camp" was to offer a very convincing argument for the fine-tuning of the cosmos, the amazing biological machines, etc., etc., I would adopt that belief and become an Atheist.  My problem is that so far, despite the mass of literature advocating the postion, none of it has been very convincing to me.

Date: 2006/05/01 02:16:38, Link
Author: afdave
I said ...
Quote
ABDUCTIVE REASONING
DATA: The surprising fact A is observed. (The finely tuned cosmos, biological machines, etc.)
LOGIC: But if B were true, then A would be a matter of course. (B is God and His written message, the Bible)
CONCLUSION: Hence, there is reason to suspect that B is
true.


Correction:  this should read ....

ABDUCTIVE REASONING
DATA: The surprising fact A is observed. (The finely tuned cosmos, biological machines, written 'holy' books, etc.)
LOGIC: But if B were true, then A would be a matter of course. (B is God)
CONCLUSION: Hence, there is reason to suspect that B is
true.

Date: 2006/05/01 03:19:40, Link
Author: afdave
AF DAVE'S UPDATED CREATOR GOD HYPOTHESIS

When I first proposed my hypothesis a few days ago, I asked for comments and critique.  I have now received this and have updated my hypothesis to reflect this.  You can see this discussion under "AFDave's God Hypothesis."  Thanks to all of you for your feedback!

I will now restate my updated Hypothesis (added a few points) and set forth the updated rules and framework which I wish to use for my reasoning.

MY BACKGROUND
I was first an Electrical Engineer, then an Air Force pilot (T-38 and Huey, believe it or not), then a businessman. Having sold my second business, I am now what you might say "between businesses" and am spending a lot of time on non-profit endeavors. I do have an aircraft charter business (a single King Air to fuel my flying "habit") and I am into alternative motor vehicle fuels with the possibility of a future business venture, but I'm not currently doing anything big in business.  I was never a logician, by trade, but that does not mean I can't become one very quickly, especially when I see gross incompetence in the field.  I also do not pretend to be a professional geologist, cosmologist, physicist, biologist, or Hebrew or Greek scholar.  But I do know some good ones and I read voraciously. What I really am is an ordinary guy with a pretty good brain for learning most anything who is sick and tired of what appears to me to be absolute nonsense being fed to us from the Evolution Dogmatists.  It appears to me that while there are many good scientists doing a truckload of good work for the benefit of humanity, there seems to be a big disconnect with reality when "science" begins speculating about how life began and developed.  I was pleased to see the article mentioned below by Meyer because it is now obvious to me that I am not the only one floating the "God Hypothesis" again. I am apparently in very good company and the pace of new research in this area is accelerating.

RULES OF ENGAGEMENT (ROE)
I need to say right up front that my reasoning with respect to this "Creator God Hypothesis" DOES NOT follow the Deductive Framework.  I have stated prior to giving my hypothesis, that I cannot provide a watertight proof for God and I don't believe anyone can, so people are correct in saying that my hypothesis would fail using the deductive schema.  However, we CAN use Abductive Reasoning then draw an Inference to the Best Explanation (IBE), and as Meyer points out below, this gives us powerful support for believing that the "Creator God Hypothesis" may in fact be true.  So there is good news, O Seeker of Truth!  There is massive support for the existence of God and for the literal truth revealed in the Bible.  Stay with me through all of my points and I will show it to you in terms you can understand!  

Here's a little blurb on Abductive reasoning from Stephen C. Meyer.  I would HIGHLY, HIGHLY recommend reading his entire paper (only 23 pages) called "The Return of the God Hypothesis" which can be found here ...

http://www.arn.org/docs/meyer/sm_returnofgod.pdf

Abductive Reasoning
DATA: The surprising fact A is observed. (The finely tuned cosmos, biological machines, written 'holy' books, etc.)
LOGIC: But if B were true, then A would be a matter of course. (B is the God of the Christian Bible)
CONCLUSION: Hence, there is reason to suspect that B is true.  

Stephen C. Meyer notes that "The natural and historical sciences employ such logic [abductive] routinely.  For instance, Peirce argued that skepticism about Napoleon's existence was unjustified although his existence could be known only by abduction: Numberless documents refer to a conqueror called Napoleon Bonaparte. Though we have not seen the man, yet we cannot explain what we have seen, namely, all these documents and monuments, without supposing that he really existed" (Peirce, C. S. 1931. Collected Papers. Eds. Charles Hartshorne & Paul Weiss. Vol. 2. Cambridge, MA: Harvard University Press).

UPDATED HYPOTHESIS
A. There is a God -- My hypothesis proposes that there is a Super Intelligent, Incredibly Powerful Being -- I choose to call him God -- who has knowledge of scientific laws far more advanced than anything ever discovered by 21st Century humans.  These scientific laws are so powerful that this Being can literally "speak" material things into existence and destroy things with a simple command.  This Being lives "outside of time" and can view what we call "the future" and "the past" with equal ease.

B. This God created the Cosmos as a specially designed whole, with life and mankind as its fundamental goal and purpose.  This God created mankind with a choice of either doing his will or not doing his will, in a similar way as parents "create" babies knowing full well that their child will either do their will or not do their will.  Christian Theologians commonly call the choice of NOT doing God's will "sin."

C. All of human kind descended from two genetically rich parents, Adam and Eve, but did not diversify significantly due to minimal geographic isolation.  My hypothesis proposes that there was only one large "super-continent" prior to the Great Flood of Noah, thus minimizing geographic isolation and resultant natural selection and specialization/diversification.  The same applies to animals except that I make no proposal as to HOW MANY animals there were initially.  Obviously, there would have to be at least one pair of each 'kind' (a term to be defined later)

D. Early man was created perfectly, i.e. no deleterious genetic mutations.  It is proposed that early man was vigorous, healthy and possibly taller than modern humans.  Early families were very large--on the order of 30 to 50 kids per couple and lives were long, many over 900 years.  Sons routinely married their sisters in the ante-diluvian world with no worries of genetic defects.  The first laws prohibiting close marriages did not occur until the time of Moses by which time we assume that accumulated harmful genetic mutations would have been a significant consideration.

E. Mankind chose NOT to do God's will very early on (just as all young children choose not to do parents' will), thus prompting God to institute a system for persuading humans to admit their folly and begin doing His will, for "redeeming" humans who choose this path, and for reminding humans that the present physical world is only a "proving ground" or "training camp" for the next world which will be created at a definite point in the future.  These events are commonly called the Fall and the Curse by Christian Theologians.

F. God allowed the choices of mankind to take their natural course for the most part, intervening in the affairs of men sporadically and briefly.  Most of the "day-to-day management" of Planet Earth was delegated to mankind himself, similar to how modern parents delegate the day-to-day management of their children to a school or a day care center.

G. The natural result of collective disobedience to the revealed will of God was an extremely corrupt society--i.e. rampant dishonesty, injustice, murder, theft, etc.--which was terminated by God through the agency of a global, life-destroying flood--the Flood of Noah described in Genesis.  

H. The Global Flood of Noah was an immense cataclysm of enormous tectonic, volcanic and hydraulic upheaval.  It completely reshaped the ante-diluvian world and resulted in massive, worldwide sedimentation and fossilization, mountain range uplift, sea basin lowering, continent separation, and climate change.  The Flood was survived in a floating ark by 8 humans (four couples) and one or more pairs of terrestrial, air-breathing, genetically rich animals and birds. The diversity we see in the living world today is the result of subsequent geographic separation and isolation of species and natural selection.

I. Following the Global Flood, we hypothesize an Ice Age of undetermined duration brought on by the massive climate changes induced by the Flood.  It was during this time that the dinosaurs and many other species died out. Since the time of the Ice Age, the structure of the earth's crust and the climate which followed, has not changed appreciably, and uniformitarian principles may now be applied to geological studies.

J. We hypothesize a supernatural intervention by God at the Tower of Babel which instantly and miraculously created several new languages (we think on the order of 12 or so), whereas prior to this event, there was only one language.

K. The record of these events (except the Ice Age) was dictated to selected individuals such as Adam and Seth and their descendants and carefully recorded on stone tablets, then passed down to successive generations.  Moses eventually received these stone tablets (or copies of them) and composed the book we now call Genesis by compiling these records into one written document.  He then composed his own written record of the events of his own lifetime, resulting in the complete Pentateuch.

L. God personally dictated the events of the Creation week to the first man, Adam, but then assumed a less active role in the composition of the balance of Genesis and the balance of what is now commonly called the Christian Scriptures.  This role varied from active dictation in an audible voice to less obvious methods--we might call it "planting of thoughts" in the minds of the writers.  This collective process is commonly called the "Inspiration of Scripture" by Christian Theologians.

M. Many cultures in geographically diverse locations around the world have legends which follow the general outline above.  The reason for the variance we find in the legends is that many of them are simply oral traditions passed down through the generations without the benefit of scrupulous copying of written records that the Christian Scriptures have enjoyed.  Since the Documentary Hypothesis (Graf-Wellhausen Theory) has now been thoroughly discredited, we have good reason to revert to the previously well established hypothesis that Genesis is NOT oral tradition, but rather it is a carefully copied written record of eye-witness accounts.

N. The Christian Scriptures, i.e. the 66 books of what is commonly called the Holy Bible, are essentially the WRITTEN record of what this Super-Intelligent, Super-Powerful Creator God wanted mankind to know about Himself, His Creation, and His Plans for the Future.

O. Jesus of Nazareth is the single most influential human being to ever walk Planet Earth.  Also, there are over 300 specific prophecies concerning a supposed "Messiah" figure throughout the Jewish Scriptures -- what Christians call the Old Testament.  These prophecies "just happen" to all converge in the life of one man of history--Jesus of Nazareth. We hypothesize that this Jesus of Nazareth was (and is) the Creator God in human form, just as he claimed to be.

P. The Christian Scriptures consisting of the Jewish Scriptures plus what is commonly called the New Testament are the most basic and foundational collection of documents for all of mankind's activities on Planet Earth--from scientific endeavor to family activities to government structure.  They also are the only reliable source documents for knowing the future of Planet Earth and Mankind in relation to it.  As such, these Scriptures should be the basis and starting point for all human activities from individual behaviour to family operation to nation building and governance of human affairs to scientific endeavors and the arts.

So now you have the "AF Dave Creator God Updated Hypothesis" ... this is my second draft and almost completely my own words.  While it is true that I have done extensive study, the only sentence to my knowledge "lifted" from an outside source is the first sentence of para (b).  This hypothesis covers many of the main points that I believe should be included, but I would welcome any constructive comments suggesting additions, modifications, or clarifications.

As soon as I am satisfied from my feedback from you that my framework of reasoning is sound, I will proceed to provide evidence which I believe supports each point in my Hypothesis.

This should be fun ... I welcome your comments!

Date: 2006/05/01 03:44:58, Link
Author: afdave
Faid-- I am not sure which (2) you are talking about ... I have restated my hypothesis in a hopefully less confusing way.  I admit I was not as clear as I could have been.  See the discussion above.  The updated version can be found here ...

http://www.antievolution.org/cgi-bin....;t=1958

Chris-- I will do a post stating my main difficulties with ToE under the "AF Dave Wants you to prove Evolution" thread,

Thanks

Date: 2006/05/01 03:53:10, Link
Author: afdave
hehe-- I do appreciate your light view of life ... I might disagree with you about God being a relativist, but gotta love your wit! Cheers!

Faid--  It's only unsupported HERE in this post.  I can't take the time or space right now to support it all.  But as I said, if you stick with me, I think you will see that alot of it IS supported very well.

Date: 2006/05/01 03:53:10, Link
Author: afdave
hehe-- I do appreciate your light view of life ... I might disagree with you about God being a relativist, but gotta love your wit! Cheers!

Faid--  It's only unsupported HERE in this post.  I can't take the time or space right now to support it all.  But as I said, if you stick with me, I think you will see that alot of it IS supported very well.

Date: 2006/05/01 04:01:33, Link
Author: afdave
Quote
If you're going to present this theory as an alternative to current science theories using abductive reasoning you need to show why it explains the data better than current theories.

I agree completely ... I plan on going to great lengths to show exactly that.  My Ice Age info will show that it was not a million (did I get that about right from ToE?) year Ice Age, but that it was relatively short, occurred right after the Great Flood, and helps to explain dinosaur extinction.

Date: 2006/05/01 04:32:54, Link
Author: afdave
Quote
There was no need to open a new topic for this modification of what is already being discussed in the original topic.
I hear you.  I assumed people would quit posting to the old one and it would fade away ... If you need to merge them, though, no problem ... maybe use the TITLE for this one so people know it's updated and tack this discussion on the end of the other one?

Date: 2006/05/01 05:11:25, Link
Author: afdave
Quote
Or you can just change the meaning of "logic" to help you rationalize this junk.

Here's my logic ...
1) We hypothesize a Super-Intelligent Creator ... we can only imagine Him somewhat like a human mind because that is what we are familiar with, but much more intelligent ... this is my "B"
2) We observe a Surprising Fact that all over the world, people claim to have received messages--written and oral from some 'god' character ... this is my "A"
3) LOGIC:  If B were true, then A would follow naturally based on our own experience with Intelligent Agents (i.e. they communicate verbally and in writing)
4)  CONCLUSION:  There is reason to suspect that B is true (not proof, obviously, but reason)

Now how is this "junk" logic?

Date: 2006/05/01 05:23:03, Link
Author: afdave
Good question from the old thread from improvius ...
Quote
Or you can just change the meaning of "logic" to help you rationalize this junk.

Here's my logic ...
1) We hypothesize a Super-Intelligent Creator ... we can only imagine Him somewhat like a human mind because that is what we are familiar with, but much more intelligent ... this is my "B"
2) We observe a Surprising Fact that all over the world, people claim to have received messages--written and oral from some 'god' character.  It's a surprising fact because quite frankly it's WEIRD ... this is my "A"
3) LOGIC:  If B were true, then A would follow naturally based on our own experience with Intelligent Agents (i.e. they communicate verbally and in writing)
4)  CONCLUSION:  There is reason to suspect that B is true (not proof, obviously, but reason)

Now how is this "junk" logic?
Quote
In all that time, going through several religions, it never made it past first base into the realm of deductive science.
Again, I am saying that I am not using Deductive Reasoning ... I am using Abductive Reasoning and drawing an Inference to the Best Explanation.  This is used regularly by both scientists and historians, Meyer's Napoleon scenario being an excellent example.  Again, for other readers, see http://www.arn.org/docs/meyer/sm_returnofgod.pdf

Date: 2006/05/01 05:48:14, Link
Author: afdave
Renier--

I understand that you have the opposite suspicion, and I believe that you also could try to make Inferences to the Best Explanation for YOUR suspicion.  And this is where I think my evidence ... "cosmic fine tuning, the anthropic principle, etc." as I will elaborate on soon lead to a Super-Intelligent 'god-like' character as a better explanation than other alternatives.

You are RIGHT ON about having to judge between different supposed 'revelations.'  This is extremely important and will come after I present credible evidence that we should expect some Super-Intelligence to exist and that it is highly likely that He (or it) commmunicates like we do.


Would you all mind hopping over to my "Updated Hypothesis Thread" to add new posts?

Date: 2006/05/01 06:02:03, Link
Author: afdave
Quote
How far do you think you're going to get with the people on this website, many of whom are professional scientists?

I may not get very far with closed minded professional scientisits, which I hope you are not, but I hope to put some truth out there in an area where I currently see a lot of error.

This is from the Meyer article quoted previously ...
Quote
Scientists rarely prove their theories deductively from empirical evidence. Indeed, no field of inquiry short of mathematics could progress if itlimited itself to the logic of entailment. Rather, most fields of inquiry employ
alternate forms of inference known variously as the method of hypothesis,abduction, hypothetico-deductive method, or inference to the best explanation. (p.21)

and ...
Quote
The natural and historical sciences employ such logic routinely. In the natural sciences, if we have reason to expect that some state of affairs will ensue given some hypothesis, and we find that such a state of affairs has ensued, then we say that our hypothesis has been confirmed. This method of confirmation of hypothesis functions to provide evidential support for many scientific hypotheses. Given Copernicus heliocentric theory of the solar system, astronomers in the seventeenth century had reason to expect that the planet Venus should exhibit phases. Galileo's discovery that it does exhibit phases, therefore, supported (though it did not prove) the heliocentric view. The discovery did not prove the heliocentric theory, since other theories might and in fact could explain the same fact (Gingerich 1982: 133-43) (p. 22 of Meyer's article).

and ...

Date: 2006/05/01 06:10:32, Link
Author: afdave
Quote
These facts do not lend any credibility to your arguements.
I don't expect them to lend to or detract from credibility.  I want new people who have never met me to have some idea of where I'm coming from.

Faid--  The more I study this issue, the more I agree with Meyer that the Abductive approach with a Logical Inference to the Best Explanation is in fact used extensively by both scientists and historians to "establish" many theories (not prove, I understand) which are of great use to humanity.  This is not to say that my conclusions are then automatically true.  I expect to be required to do a great deal more work ... and I may fail.  I admit that.  If you used the same approach and your explanation was better, then it would be reasonable to adopt yours, to be sure.

Date: 2006/05/01 06:15:22, Link
Author: afdave
I said ...
Quote
I want new people who have never met me to have some idea of where I'm coming from.

Yeah, like Mars, Pluto or some Fundy Planet in another galaxy ... yeah, yeah ... I know the jokes are coming ... :-)

Date: 2006/05/01 06:29:34, Link
Author: afdave
Here's something else I have never understood ... maybe one of you can explain ...

Why does it always seem that every time the word 'God' is even mentioned, everybody runs for cover and says it's not science?  Personally, I'm content to not use the word God if it makes everyone feel better.  How about  Super-Computer-Alien-Thingy?  (SCAT for short) How about Cosmo-Brain?  Or you think of a name ... it doesn't matter to me.  What matters to me is IF ..... IF,IF,IF,IF,IF ..... there is such a thing, what do you call Him (or it) to even begin an honest search to find evidence for Him (or it) or show that there is none?

Date: 2006/05/01 07:06:23, Link
Author: afdave
Quote
If you want to impress us, start listening and addressing the criticisms.

Where have you been?  I have been doing just that. How about you?  Do you ever do that? What more do you want me to do?  (Agree that you are right ... I know, I know ... but you'll have to earn that if that's what you want.) What we have here, Aftershave, is a big problem in science today and many scientists are either too proud, or too blind, or too afraid to lose their jobs or their friends, or whatever to do anything about it themselves.  Denton and Behe are quite clear on this issue and I think this explains why they have taken the unusual step of presenting their information to the non-professionals like me.

You know, in families sometimes the dad shirks his responsibilities as a dad and so the mom takes over.  She's not as good at being a dad as he is (just like I'm not as well trained in logic, geology, etc., etc.).  But she has to jump in there and take over or the family would be in trouble.

This is exactly what I see in this one critical area of science today, i.e. the area of Origins and the Nature of Mankind and the issue of God.  Science should not be claiming that they have disproved the existence of God because they have not.  Science should not be implying to our children that they are glorified animals, because there is no proof.  Science should not be telling the theologians that God is dead or irrelevant, because they have no basis for claiming that and they arrogantly claim that they do.  And so on ... you get the idea.  So if science is going to behave irresponsibly, then who else but non-scientists are going to have to jump in and "blow the whistle" ??

This is exactly what you see going on right now on multiple fronts and it is exactly the reason we hear so much about "concerned scientists."

Now we laymen are reasonable people and we will forgive scientists if they admit their errors and fix them, but if all we ever get is stonewalling and "you're not even fit to make an argument" and "you're just a religious nut", you can be sure that the people will do everything in their power to rise up and fix it themselves.

And believe me, we laymen can do a lot.  I may not get professional scientists to listen to me, but as you and I both know, all we need is a political majority and we win.  Not to say that I'm just about politics.  I am about Truth and Fairness, but I am also about winning and using every political tool in my toolbox to make sure we have Truth and Fairness in the science establishment in this country.

A lot hinges on this, too.  What people think about origins and the nature of mankind is VITALLY important to law and society.  This is why you see me being so passionate about this issue.

Date: 2006/05/01 07:38:59, Link
Author: afdave
Quote
[...]and she conceived, and bare Enoch: and he builded a city, and called the name of the city, after the name of his son, Enoch.


Let me just show you one thing here ... the plain reading of this is very clear that there was SOME time lag b/t baring Enoch and building the city ... do you see this?  Babies don't build cities.  Grown up men do.  How much time elapsed?  I cannot tell, but we are unjustified in saying categorically that this is definitely an example of error.  Why can we not allow the writer some license to hit high points in a historical narrative?  This is very common practice.  Again, though, I am not saying anything yet about the Bible being proven to be true.  At this point in the argument, that is an open question.

As for my supposed pre-committment to the Bible, I don't know how else to tell you that I am doing as best as any human can of NOT being biased.  To tell you the truth, I didn't care a whit about the Bible growing up even though I was force fed it with a firehose.  I cared about the normal things boys care about ... fast cars, fast girls, etc.  But in college, I began to search for ultimate truth, and I tell you ... it could have gone either way.  I was not exactly a compliant child (actually kind of a rebel), so I did not have any great love for my parents belief system.  I do have an exercise that I want to propose on my other thread which I hope will at least allow us to agree on the ground rules for the debate.

hehe-- Your question has only become a question in modern times with the advent of vasectomies, but I would have to guess that God's opinion would be that your scenario would be OK with Him from one angle (absolute moral code), but not OK from another.  I would guess that He would say not to do it because you would no doubt get into failed vasectomies, etc. with the resulting deformities.

I've never been asked that question!  It's a funny one!

Date: 2006/05/01 07:38:59, Link
Author: afdave
Quote
[...]and she conceived, and bare Enoch: and he builded a city, and called the name of the city, after the name of his son, Enoch.


Let me just show you one thing here ... the plain reading of this is very clear that there was SOME time lag b/t baring Enoch and building the city ... do you see this?  Babies don't build cities.  Grown up men do.  How much time elapsed?  I cannot tell, but we are unjustified in saying categorically that this is definitely an example of error.  Why can we not allow the writer some license to hit high points in a historical narrative?  This is very common practice.  Again, though, I am not saying anything yet about the Bible being proven to be true.  At this point in the argument, that is an open question.

As for my supposed pre-committment to the Bible, I don't know how else to tell you that I am doing as best as any human can of NOT being biased.  To tell you the truth, I didn't care a whit about the Bible growing up even though I was force fed it with a firehose.  I cared about the normal things boys care about ... fast cars, fast girls, etc.  But in college, I began to search for ultimate truth, and I tell you ... it could have gone either way.  I was not exactly a compliant child (actually kind of a rebel), so I did not have any great love for my parents belief system.  I do have an exercise that I want to propose on my other thread which I hope will at least allow us to agree on the ground rules for the debate.

hehe-- Your question has only become a question in modern times with the advent of vasectomies, but I would have to guess that God's opinion would be that your scenario would be OK with Him from one angle (absolute moral code), but not OK from another.  I would guess that He would say not to do it because you would no doubt get into failed vasectomies, etc. with the resulting deformities.

I've never been asked that question!  It's a funny one!

Date: 2006/05/01 09:13:23, Link
Author: afdave
Quote
Science HAS NOT EVER claimed to have disproved the existence of God.  Whoever told you that if full of shit too. There are certainly a few atheistic scientists (i.e. Dawkins) who hold that personal opinion, but the science itself says NOTHING one way or the other on the existence of God.  You want to claim different?  Then find me a textbook or a scientific research paper ANYWHERE that says “here is scientific evidence there is no God”.
I just have to laugh ... "only a few  ... mmm ... like Dawkins, for example ... he's not very influential... not many others ..." OK.  Whatever.

I'll tell you what ... I won't sell you any bridges and you don't sell me any and we'll be friends, OK!

As for me, I'm going to get back on topic ...

Thankyou, Norm at least for that!  I'll consider your words.

Would anyone else like to comment on the real issue on this thread ... ?

We (at least I and Norm and a few others) are debating the validity of my structure for debating Origins, the Nature of Life and related topics, collectively referred to as my Creator God Hypothesis.

I have given you my preferred approach ... are there any more substantive objections?

Date: 2006/05/01 10:47:31, Link
Author: afdave
Quote
Abductive Reasoning
DATA: The surprising fact A is observed. (The Indian tsunami killed hundreds of thousands of people
LOGIC: But if B were true, then A would be a matter of course. (B is the hypothesis that AFDave caused the tsunami   )
CONCLUSION: Hence, there is reason to suspect that B is true.
Tell us AFDave, should we suspect you of killing all those innocent people?


Thankyou, Aftershave, for getting back on topic ... you know very well what the topic is and I'm glad you are man enough to finally get back to it. It's right up there at the top of this Internet Explorer frame.  I'm glad you noticed we are debating the UPDATED version, thankyou.

Now ... to fillet your statement in front of God and everybody ... my surprising answer to your question is ... DRUM ROLL ... YES ...

YES, YES!! Thankyou!  A Thousand time YES!  This is precisely what you should do!  And while you are at it, put your Origins and Macro-Evolution Hypothesis in exactly the same format and go look for that evidence on the same trek!

Guess what!  You won't find a SHRED of evidence for either one and you will display to all who come here that it is the Evolution Dogmatists who are doing Voodoo Science!  That's the difference between my Hypothesis and the two of yours.  

Yours have no evidence.  Mine does.  

And tomorrow morning you will be getting more or it than you care to hear.  But not for your benefit, unless you open your mind.  If you haven't noticed, I'm really writing for the benefit of people with open minds.  I know I won't convince hardened skeptics.

So bring it on and let's see how yours stands up.  (Either one you like--Tsunami or Evolution).  You tell me you guys are the professionals.  Let's see how professional your arguments are.  Or are you just going say I'm incompetent and I have no idea what I'm in for and Meyer is a liar, blah, blah, blah?

Date: 2006/05/01 11:12:16, Link
Author: afdave
Hey, no offense, but I'm going to let you guys knock yourselves out with the virgins and the angels and I'm going to hop back over to my main topic of interest on my other thread here ... you only have so many hours in a day ... go to the Christian Research Institute (Hank Hannegraf) if you really want to sort all this out ...

Date: 2006/05/01 11:12:16, Link
Author: afdave
Hey, no offense, but I'm going to let you guys knock yourselves out with the virgins and the angels and I'm going to hop back over to my main topic of interest on my other thread here ... you only have so many hours in a day ... go to the Christian Research Institute (Hank Hannegraf) if you really want to sort all this out ...

Date: 2006/05/01 16:29:37, Link
Author: afdave
Oops! It was Cain, not Enoch that built the city ... good eyes Faid!  You must be a doctor or something ...

Now why again does that matter?  Are you concerned about the fact that he built a city for only 3 people.  Did I not clear that up already?  I plan on giving a lot more detail as I walk through this whole thing on the other thread.

Quote
I just think you don't think at all, not when you're questioning your beliefs. You don't even try. And it's normal.

Now why do you want to insult me like that?  I was starting to like you!  Naaa ... I still do ... and I bet you make reading errors once in a while yourself.

Have a good night!

Date: 2006/05/01 16:29:37, Link
Author: afdave
Oops! It was Cain, not Enoch that built the city ... good eyes Faid!  You must be a doctor or something ...

Now why again does that matter?  Are you concerned about the fact that he built a city for only 3 people.  Did I not clear that up already?  I plan on giving a lot more detail as I walk through this whole thing on the other thread.

Quote
I just think you don't think at all, not when you're questioning your beliefs. You don't even try. And it's normal.

Now why do you want to insult me like that?  I was starting to like you!  Naaa ... I still do ... and I bet you make reading errors once in a while yourself.

Have a good night!

Date: 2006/05/02 01:03:29, Link
Author: afdave
Quote
Dave, wouldn't it make considerably more sense to simply state that the Bible focusses only on one particular lineage in the Creation Story in Genesis, and that all the rest come from other separately created tribes/lineages?

No, because that would force me to accept the inane, illogical position of Evolution with no Intelligent Agent which is far more problematic concerning the real evidence.  More later.
Quote
Of course the most reasonable interpretation of Genesis is that it's just one of many creation myths that intertwine an prehistoric attempt to account for how we got here with some kind of moral message.  Many Christians quite happily accept the morality tale without having to make a big deal about its historical veracity.  I suspect afDave does not.

You suspect right!  And there is a very good reason which we will get into.  So are you telling me that I'm a different YECer than you've encountered before?  I hope so, because then if nothing else, reading my stuff will be some new entertainment for you :-)
Quote
Does this make him a fool? No. He might have an IQ of 165 and act that way- and worse. He's no fool - he's just in love.
You might be interested to know that I was madly in love with a girl in 1983, proposed and was about to get married, when suddenly a whole string of hard evidence hit me in the face one night. I already knew this stuff ... I had just been sweeping it under the rug.  I struggled with the decision a long time and finally broke off the engagement. So I know how to rise above my feelings and make hard decisions.  Now people do say that "it takes one to know one" so to speak ... could it be that the situation you are describing is YOUR situation?  Maybe YOU are so "in love" with the idea of "millions of years" and "chance origins" and "no God" (not sure if that is one of your positions) and "the Bible is a nice myth" that you are blinded by the truth?  There is no question that this is possible with all of us. Faid-- At first glance, it appears to me that you see many APPARENT problems in the biblical record and it sounds like you say something like "unless all these apparent problems are cleared up, I would never believe in biblical inerrancy."  Well, here is an alternative position for you to consider which I think works better.  Make the PROPOSITION (or Hypothesis, if you will) that the Bible is inerrant.  Then begin a rigorous study of the apparent contradictions ... start by going to a Christian bookstore and getting a good book on the subject (I think Geisler writes on this topic) ... if you then find that you can prove the errors after considering much evidence, then discard or modify your hypothesis.

Pardon me if my answers are very short over here ... I will be spending most of my time over on my other thread and would welcome your comments there.  I will be discussing the First Point in my Hypothesis today.

Date: 2006/05/02 01:03:29, Link
Author: afdave
Quote
Dave, wouldn't it make considerably more sense to simply state that the Bible focusses only on one particular lineage in the Creation Story in Genesis, and that all the rest come from other separately created tribes/lineages?

No, because that would force me to accept the inane, illogical position of Evolution with no Intelligent Agent which is far more problematic concerning the real evidence.  More later.
Quote
Of course the most reasonable interpretation of Genesis is that it's just one of many creation myths that intertwine an prehistoric attempt to account for how we got here with some kind of moral message.  Many Christians quite happily accept the morality tale without having to make a big deal about its historical veracity.  I suspect afDave does not.

You suspect right!  And there is a very good reason which we will get into.  So are you telling me that I'm a different YECer than you've encountered before?  I hope so, because then if nothing else, reading my stuff will be some new entertainment for you :-)
Quote
Does this make him a fool? No. He might have an IQ of 165 and act that way- and worse. He's no fool - he's just in love.
You might be interested to know that I was madly in love with a girl in 1983, proposed and was about to get married, when suddenly a whole string of hard evidence hit me in the face one night. I already knew this stuff ... I had just been sweeping it under the rug.  I struggled with the decision a long time and finally broke off the engagement. So I know how to rise above my feelings and make hard decisions.  Now people do say that "it takes one to know one" so to speak ... could it be that the situation you are describing is YOUR situation?  Maybe YOU are so "in love" with the idea of "millions of years" and "chance origins" and "no God" (not sure if that is one of your positions) and "the Bible is a nice myth" that you are blinded by the truth?  There is no question that this is possible with all of us. Faid-- At first glance, it appears to me that you see many APPARENT problems in the biblical record and it sounds like you say something like "unless all these apparent problems are cleared up, I would never believe in biblical inerrancy."  Well, here is an alternative position for you to consider which I think works better.  Make the PROPOSITION (or Hypothesis, if you will) that the Bible is inerrant.  Then begin a rigorous study of the apparent contradictions ... start by going to a Christian bookstore and getting a good book on the subject (I think Geisler writes on this topic) ... if you then find that you can prove the errors after considering much evidence, then discard or modify your hypothesis.

Pardon me if my answers are very short over here ... I will be spending most of my time over on my other thread and would welcome your comments there.  I will be discussing the First Point in my Hypothesis today.

Date: 2006/05/02 05:47:27, Link
Author: afdave
Good morning everyone ...

I'll probably start off every day with a retraction or two because I am passionate about this stuff and I believe there is a lot in our country at stake, and sometimes I say unnecessary things to try and make my point ... I think we all do ...

I said ...
Quote
Science should not be claiming that they have disproved the existence of God because they have not.  Science should not be implying to our children that they are glorified animals, because there is no proof.  Science should not be telling the theologians that God is dead or irrelevant, because they have no basis for claiming that and they arrogantly claim that they do.


I am happy to retract these statements.  They are unnecessary and do not contribute to the points I am trying to make.  They represent an impression I have about some of our leading scientists, but they do open a can of worms that I don't want to focus on right now.  Also, I do not mean to insult anyone here who may be a professional scientist.  I have no doubt--honest--that you all do excellent work in your specialty.  But I feel that many good scientists have "stepped over" OUT OF their specialty (as I also am doing) to address the question of origins.  I don't know what your reasons are, but I'm sure you have good ones, and I have my own reasons as well.  I agree that name-calling, motive-questioning and other such tactics get us nowhere, and I for one will apologize when I commit these 'sins'.

So ... back to what I DO want to focus on ...

MY GOALS
My goal, first of all, is NOT to win an argument, or to make someone feel stupid.  My real goal is two-fold:  (1) to really get to the bottom of why Creationism is so objectionable to a lot of good scientists.  This is why I am HERE, not over at AIG or DI, (2) I have personally seen a lot of excellent support for being a Creationist, but I could be wrong.  If so, who better to tell me I'm wrong that professional scientists over here? (3) If I am right, the implications are enormous and all of humanity should know about this.  Believe it or not, I care about all of you on this blog as human beings.  I feel that I am a 'beggar who has found bread' and I want to share this information with others.  My motives are altruistic even though I may not act like it sometimes.  I am human and someone has rightly said 'To err is human.'  I will continue to 'err', but I will try not to and when I do, I will confess and try to fix it.  What else can I do? (4) I came here already armed with a significant amount of study, but I knew that I was missing one key ingredient ... actual dialog with a diverse group of Naturalistic Philosophers.  So what is really happening here is that you all are making some very good points to improve the presentation of my logic, help me select proper terminology so as not to make people mad, and understand the naturalistic perspective.  This is an incredibly valuable learning experience for me, which will help me immensely if I ever do get around to presenting information on a Grand Scale.  And of course there is the off chance that you guys' position may be correct, in which case I would be a fool NOT to adopt it.


So let's dive in ... it appears that I need to spend a little more time explaining my structure for testing ANY hypothesis ... I think that a lot of the evidence I will present, you will have probably heard before, but you may reject it as support for my particular hypothesis on logical or other grounds.  So I think I need to first argue the validity of using my approach ...

I have proposed Abductive Logic Confirmed by Inference to the Best Explanation, and have inserted an extra step (this was an assumption to me, but I see it is not for you, so we will insert it)

Abductive Reasoning
DATA: The Surprising Fact A (or Phenomenon A) is observed. (The finely tuned cosmos, biological machines, written 'holy' books, etc.)
EXPERIENCE: (Let us insert this to explain where 'B' comes from)  We propose 'B' based upon our own observation and experience.  We cannot do otherwise and still call it 'science'
LOGIC: But if B were true, then A would be a matter of course. (B is the God of the Christian Bible)
CONCLUSION: Hence, there is reason to suspect that B is true.

Let's illustrate this process from an example from my own experience.  I lived for a while as a child in a foreign country with a tribe of jungle natives (my Dad is a Bible translator).  These natives had never seen an airplane when my dad arrived.  We will call this Surprising Fact (or Phenomenon) A.  Some on this thread have argued that it should not be called a Surprising Fact, but I believe it should because the 'surprise' part means that you have never seen the thing before, i.e. you are surprised.  Some also say that EVERYTHING you see in the world could be called a Surprising Fact if you propose a 'God', but this is not true.  The definition of a surprising fact in this context is simply 'new', i.e. not previously studied.  Of course 'new' facts soon become old, but this does not take away anything.  Many new things in the physical world are still fascinating to study even though they are not 'new' to science.  So I would also be content to call my 'Surprising Fact" a 'Noteworthy Fact' or simply 'Phenomenon.'  Someone else may say, "Why do you think that fact is noteworthy? I don't think it is."  Well, you may not and that's OK.  This whole exercise is written for those who ARE interested in the phenomena of the physical world and who seek to explain how they got here.  I am one of them and I assume there are others.

So the natives observe this airplane and they observe people getting out of it and walking toward them and they say "Wow ... a sky canoe!"  (They really did this ... and that is what they call an airplane to this day ... the word is 'kanawa' in their language).  Notice that they immediately explained Phenomenon 'A' in terms they already understood well.  They understand canoes ... they get into their canoes, go various places, then get out again.  They saw this airplane arrive from someplace, they saw people get out, and so they assume that it is a very fancy 'canoe', and in a sense they are correct.

Now some of the more thoughtful natives (not many mind you ... most of them said 'Wow! Sky Canoe' and moved on) ... but some of them said to themselves, 'I wonder who made this sky canoe?' ... and they began asking questions.  They asked my dad and he told them something like 'Cessna Aircraft Corporation' in a country far from here called 'America.'  (Which to the natives was so foreign sounding that my dad might just as well have said 'The Tooth Fairy made it and she lives in Timbuktu.';) Now there are some interesting things we can observe here.  First, we could ask why my dad told them Cessna made the airplane. And the answer would be that he had previously used the Abductive Reasoning method and had made an Inference to the Best Explanation.  Let's walk through this.  

MY DAD IS THE OBSERVER
DATA:  Phenomenon A is the airplane.
EXPERIENCE:  My dad proposes 'B' because of his own experience
LOGIC:  If B were true, then A would be a matter of course.
CONCLUSION:  There is reason to suspect that 'B' is true.  In fact, 'B' is so well supported that my dad feels it warrants the strong statement 'Cessna made this airplane.'

Now my dad only has his own experience to draw upon to propose 'B' and to do anything else would be unscientific.  What is his experience?  He has seen many airplanes, he has read about Cessna, Piper and Beechcraft, and he even read a book on aerodynamics once.   All this leads him to propose 'B' that 'Cessna made the airplane.'  Could he propose other 'B's'?  Sure, he could propose that a farmer planted aiplane seeds and this airplane grew from one of the seeds.  He could propose that the Fairy Godmother waved a magic wand and the airplane magically appeared.  But these proposals would not be based in his experience and they would not constitute good science.  So he does the most logical thing and proposes that 'Cessna made the airplane.'  Now some will ask, "This is great, Dave, but can he PROVE that Cessna made the airplane?  Well, no.  Has he ever OBSERVED any aircraft factory building airplanes?  No again.  How does he know that someone didn't just FABRICATE THE EVIDENCE ... maybe a trickster printed 'Cessna' on the side of the airplane and on the instrument panel an on the pilot's operating handbook!   Right again ... coulda happened.  Maybe that book on aerodynamics had errors.  Maybe the whole book was a fraud.  And on and on we could go.  Well ... granted ... my dad could propose many alternatives for explaining the origin of the airplane, but the problem is that these alternatives would not be supported from his own experience, thus rendering them UNSCIENTIFIC.  The Best Explanation then, from his own experience is 'Cessna made the airplane.'  He cannot prove this in the sense that it is not a Deductive Proof using Logical Entailment.  In other words, he cannot 'prove' the logical premise that airplanes come from aircraft factories because there is the logical chance that this might not be true.

Another thing to point out in this example is that we have two 'classes' if you will, of people here.  This is important because some people on this thread said that my Proposals  -- 'B' -- are invalid because I was informed about them already, i.e. someone has already proposed that there is a God.  But this does not matter.  Let us see why.  My dad is in the supposedly 'informed class' of people who DO know about airplanes (or at least claim they do), and the natives are in a different 'class' of people who are NOT informed about airplanes.  We explored the proposal that my dad made from his experience - "Cessna made the airplane."  Now consider the Proposal -- 'B' -- that the natives might have proposed had they not been told anything by my dad.  

THE NATIVES ARE THE OBSERVERS
DATA:  Phenomenon A is the airplane.
EXPERIENCE:  The native proposes 'B' -- 'A super-expert canoe-maker made this sky canoe.  His canoe-making ability far exceeds our own because this canoe is not restricted to the river.  It obviously can fly over the treetops and can go anywhere the guy steering it wants it to go.  It is also much faster--look how fast it whizzed by as it was taking off.  And no one has to paddle!  It has a strange 'paddle' on the front that spins!' ... and so on ... They make this proposal -- 'B' -- because of their own experience -- which is an Inference to the Best Explanation that they can think of that compares to this new phenomenon.
LOGIC:  Now if B were true, then A would be a matter of course.
CONCLUSION:  There is reason to suspect that 'B' is true.  Are there other conclusions one could draw?  Yes, but they would not be better explanations based upon the evidence of their own experience and thus would not be scientific.  The Best Explanation for the natives is that stated above and so they make the Inference and are scientifically justified in making it.

Now here's the fun part ... notice that the two Proposals made by the two Classes of people are QUITE SIMILAR.  My dad's 'B' was 'Cessna did it'.  The natives 'B' was 'A super-expert canoe-maker did it.'  Both drew from their experience.  And both made logically sound proposals to explain the phenomenon.  My dad's is more refined because he has had the privelege of more data.  But the native could also gain access to this same data if he put forth some effort, i.e. learn English, read some books on airplanes, travel to America and observe more airplanes, etc.  My point is that the objection of 'You are just making proposals from you own experience so this invalidates your proposal' is not a valid objection.  In fact, we are REQUIRED to ONLY make proposals based upon our own experience because this is the THE ESSENCE OF SCIENTIFIC INQUIRY.  At least, that's what I think I am hearing from all of you ... correct me if I am wrong.

Now someone will say, 'Come on, Dave.  Where all your evidence for this supposed 'Creator God. We are waiting!'  And some have also said, 'We've seen all the supposed YEC evidence and we don't buy it.'  I have already hinted about some of my evidence for Point 1 - There is a God ... namely, the Cosmic 'Fine-Tuning', biological 'machines' we observe and so on.  I will elaborate on these and many other evidences of my other points going forward.  But I think many of you do in fact already have part of your answer to the question "Where is the evidence?"  You have read Denton, Behe, Dembski and YEC writers.

I think the REALLY NEW THING that I am presenting to you is not necessarily new evidence, but a NEW WAY OF DRAWING CONCLUSIONS FROM THE EVIDENCE, which I actually believe you put into practice every day in your scientific and other endeavors, but which you may not have thought to put into practice into the Origins question. And I admit, that my framework may need some tweaking ... maybe you can help me with that.  But I think I am at least on the right track.  So these are my really BIG questions for you:  Is it possible that this is the case with you?  Is my approach outlined above unreasonable?  If so, why specifically?  Do you admit that you use this process regularly to support many 'hypotheses' about a plethora of 'phenomena'?  I welcome your comments on this.

SOME MORE OBJECTIONS
Quote
Chris Hyland: ... The theory of evolution doesn't say anything about the ice age, saying thins like this makes people not take you seriously. The theory of evolution says nothing about the origin of the universe, the origin of matter, or the origin of life.
I think this is a terminology thing.  I will revise my terminology.  I will stop saying 'Evolutionists' and start saying 'Naturalistic Philosophers'.  Is that better?
Quote
Norm Doering: ... There is an old quote from David Brooks that applies to your method of reasoning: "To explain the unknown by the known is a logical procedure; to explain the known by the unknown is a form of theological lunacy."
Of course, your problem is that you don't recognise "God" as an unknown, do you?
 Actually yes.  You'll notice from the discussion above that I am doing EXACTLY what you say I should do, i.e. "To explain the unknown by the known is a logical procedure;"  Namely, I am trying to explain the origin of natural phenomena (unknown), with propositions from my own experience (known).
Quote
Dave, before I answer in any more of your arguments, I want to make this perfectly clear: Have we agreed that we are NOT discussing in scientific terms? Yes or no?
Answer is YES.  I do not practice 'religion' (whoa ... there's a shocker that I will have to explain separately no doubt) and I do not engage in wild speculation.  I have the mind of an engineer and a scientist.  I, like you, am a healthy skeptic.
Quote
Abductive Reasoning is supposed to lead to a hypothesis where deductive reasoning can apply.
I would submit to you that Deductive Reasoning can apply to NOTHING in all of science or history in an absolute sense.  I am only aware of its application in mathematics.  I believe the structure that I have proposed is used constantly in every day scientific practice. Can you demonstrate why I am wrong here?
Quote
BTW, when you say things like, "I see a lot of error in scientists' work, which I mean to correct for the honest folk on this discussion board," you do realize you obliterate any credibility you might have had, right?
Yes, I can see that.  Good call, referee!  I'll take the 'foul'!
Quote
The problem with your above statement is you've misread Meyer who is already lying to you.
It may be true that Meyer is lying about certain things.  I have not investigated all his claims.  But Meyer has pointed out a logical framework to determining 'truth' (proposed by Peirce in the 30's) that appears to be in use by many scientists and historians today.  I have thought through this framework myself and am adopting my own version of it, and I think it is solid.  I honestly value your feedback on this, though.
Quote
Dave, why would you get on this site without knowing about logic and how to make a hypothesis and so on?  Shouldn't you study up a little before presenting your hypothesis?
Good question.  I came here already armed with a significant amount of study, but I knew that I was missing one key ingredient ... actual dialog with a diverse group of Naturalistic Philosophers.  So what is really happening here (and this was one of my goals) is that you all are making some very good points to improve the presentation of my logic, help me select proper terminology so as not to make people mad, and understand the naturalistic perspective.  This is an incredibly valuable learning experience for me, which will help me immensely if I ever do get around to presenting information on a Grand Scale.  And of course there is the off chance that you guys' position may be correct, in which case I would be a fool NOT to adopt it.
Quote
To use your own terms, are you man enough to debate this honestly?
Yes.
Quote
Ockham's Aftershave: "I can spin that kind of argument any way I want too.  I can hypothesize "A Super Intelligent, Incredibly Powerful Being could create all necessary physical laws in the first femtosecond of existence, then just sit back and observe the results.  Therefore when I observe scientific data that says the universe is 14 Billion years old, and the Earth is 4.5 Billion years old, and that life has existed on Earth for over 3 billion years, and that life has evolved over that time by observed processes such as random mutations plus natural selection, I have just verified my hypothesis."
Yes, you could propose this, but the proposal would not be based upon your experience because we have never observed such a process, so it would not be the BEST explanation. Admittedly it's an explanation, just not the best one.  A BETTER explanation is something based in our own experience, such as a Super Intelligent Being DESIGNED this flagellum (or whatever), because this would be based upon our experience.  See discussion above.
Quote
Norm Doering:  It's about Danny Hillis who built the first massively parallel processing computer, the Connection Machine, and used it as a "proof" for a concept in Darwinian evolution.
I will copy this to my thread "AF Dave wants you to prove evolution to him" and I will try to find time to show you over there why this DOES NOT provide proof of concept for Darwinian Evolution.  But you need to know that this will be lower priority to me because I really want to get away from "Evolution Bashing".
Quote
Why oh why does anything about god matter in even the slightest bit to humans? Heaven and #### are meaningless words in the context of eternity. They are quite meaningful when applied to how we feel while living but not once we're dead. So why is gOd important?
He's only important IF HE (or it) is there.  If He is not, I agree ... who cares.  But I have strong suspicion that He is there and so I propose that see is, then make scientific observations to see if the proposal is supported.  If it is, then I make only a small step of 'Faith' by saying that I believe in God.  A step which I think takes LESS FAITH than the alternatives. Note that many people just basically pull this 'I believe in God' stuff out of thin air and I think they are rightly accused of practicing 'Blind Religious Faith.'  

Now I will go ahead and stop here and post this, then begin presenting my EVIDENCE FOR POINT 1.

See you in about an hour ...

Date: 2006/05/02 07:21:18, Link
Author: afdave
Quote
Also, I'd like to get some clarification here:
Dave, before I answer in any more of your arguments, I want to make this perfectly clear: Have we agreed that we are NOT discussing in scientific terms? Yes or no?
Answer is YES.  I do not practice 'religion' (whoa ... there's a shocker that I will have to explain separately no doubt) and I do not engage in wild speculation.  I have the mind of an engineer and a scientist.  I, like you, am a healthy skeptic.

What you've said here is that you agree that we are NOT discussing in scientific terms. Is that what you meant to say?


CORRECTION:  I blew right past that "NOT" didn't I.  Thanks.  

I meant to say "Answer is NO.  I do not practice 'religion' (whoa ... there's a shocker that I will have to explain separately no doubt) and I do not engage in wild speculation.  I have the mind of an engineer and a scientist.  I, like you, am a healthy skeptic."

Date: 2006/05/02 07:29:22, Link
Author: afdave
AF DAVE'S CREATOR-GOD HYPOTHESIS

EVIDENCE FROM MY EXPERIENCE SUPPORTING POINT 1 (I will use numbers instead of letters so as not to confuse with the 'A' and 'B' logic tools.)

Again as I said earlier, I think most of you are quite familiar with my supporting evidence for my points, but again, the important thing to me is THE METHOD OF DRAWING CONCLUSIONS FROM THE EVIDENCE.

To recap, Point 1 is as follows:
1. There is a God -- My hypothesis proposes that there is a Super Intelligent, Incredibly Powerful Being -- I choose to call him God -- who has knowledge of scientific laws far more advanced than anything ever discovered by 21st Century humans.  These scientific laws are so powerful that this Being can literally "speak" material things into existence and destroy things with a simple command.  This Being lives "outside of time" and can view what we call "the future" and "the past" with equal ease.

Let us also restate the framework (constantly being refined ... that's what scientists do, right?) and place this Point 1 into it.

ABDUCTIVE REASONING WITH LOGICAL INFERENCE TO BEST EXPLANATION
DATA: Phenomenon A is observed. (The finely tuned cosmos, biological machines, written 'holy' books, relativity, particle physics, etc.)
EXPERIENCE: We propose 'B' (Point 1 above) from our own observation and experience.  We cannot do otherwise and still call it 'science'
LOGIC: If B were true, then A would be a matter of course. (In this exercise, B is the God of the Christian Bible)
CONCLUSION: Since we do observe lots of 'A's there is reason to suspect that B is true.  We will propose that it is true, then modify, refine, etc. as we gather more data.

Now, what do I observe in the natural world?  This is my 'A' above.

A1=WE OBSERVE A FINELY TUNED COSMOS.  
Meyer observes ... "Physicists have discovered some seventy separate
physical or cosmological parameters that require precise calibration in order to
produce a life-sustaining universe (Barrow & Tipler 1986; Gribbin & Rees 1991;
Ross in Dembski 1998)." Say what you want about Michael Denton and his conclusion that 'the laws of Biology reveal Purpose' in the universe, but his book "Nature's Destiny" certainly presents credible evidence to me that at least the universe is in fact 'finely tuned' for life on earth as we observe it today.  He talks about water, light, the elements of the earth, carbon, gases, metals, DNA, 'the nano-manipulators' we call proteins, and cells, and he shows very convincingly that every parameter must be exactly as we find it within incredibly small tolerances, or life on earth would not be possible.  I like Denton's conclusion on page 389, ""All the evidence available in the biological sciences supports the core proposition of traditional natural theology--that the cosmos is a specially designed whole with life and mankind as its fundamental goal and purpose, a whole in which all facets of reality, from the size of galaxies to the thermal capacity of water, have their meaning and explanation in this central fact ... As I hope the evidence presented in this book has shown, science, which has been for centuries the great ally of atheism and skepticism, has become at last, in these final days of the second millenium, what Newton and many of its early advocates had so fervently wished--the "defender of the anthropocentric faith."

B1=A SUPER-INTELLIGENCE SET THE PARAMETERS.  We propose that some Super-Intelligence intentionally set the myriad parameters of the cosmos so that life would be possible.  This is consistent with our experience.  In our experience, intelligent engineers set parameters quite precisely in order to achieve some goal. For example, the viscosity of fuel has to correct for it to be used as a motor fuel in a gasoline engine. Note that we are not saying that 'life WAS the goal'.  We are simply saying that in our experience, intelligent agents set parameters precisely to achieve some goal.  Since we do find lots of precisely set parameters in the cosmos, maybe it's reasonable based on our experience, to propose that SOMEBODY set them in order to achieve some goal.

A2=BIOLOGICAL MACHINES.
Sorry guys, I know you don't like Denton and Behe, but if I could find someone who says it better that you like, I would quote them.  Maybe you can help me with that.  Behe's "Darwin's Black Box" is now well known.  I love Behe's words ... "systems of HORRENDOUS, irreducible complexity inhabit the cell"!!  I just love that word "HORRENDOUS."  Michael Denton in "Evolution: A Theory in Crisis" makes a very powerful and revealing statement ... "We now know not only of the existence of a break between the living and non-living world, but also that it represents the most dramatic and fundamental of all the discontinuities of nature.  Between a living cell and the most highly ordered non-biological system, such as a crystal or a snowflake, there is a chasm as vast and absolute as it is possible to conceive." (p. 249)  Denton says about the cell ... "What we would be witnessing would be an object resembling an immense automated factory, a factory larger than a city and carrying out almost as many unique functions as all the manufacturing activities of man on earth."  (p. 329) and  Bill Gates says of DNA--which is the controlling 'program of life'--that it is "is like a computer program, but far, far more advanced than any software we have ever created (The Road Ahead, 1996, p. 228)  Denton and Behe are absolute MUST READS!

B2=A SUPER-ENGINEER DESIGNED THE MACHINES.  We propose that a Super-Human Software Engineer of surpassing brilliance wrote the DNA code.  We propose that that a Super-Human Nano-technology engineer designed the wonderfully innovative and ubiquitous proteins fro which the DNA codes.  Was it the same 'guy'?  I propose that it was, yes.  Of course there is the possibility that there are several such 'guys' somewhere that worked onthis project together ... a sort of Engineering Department if you will.

OK ... there's 2 A's and B's for you ... again what we are saying is ...

DATA: Phenomenon A1 (FINELY TUNED COSMOS) is observed. EXPERIENCE: B1=A SUPER-INTELLIGENCE SET THE PARAMETERS. We propose 'B' (supporting Point 1 above) from our own observation and experience.  
LOGIC: If B1 were true, then A1 would be a matter of course.
CONCLUSION: Since we do observe A1, there is reason to suspect that B1 is true.  We will propose that it is true, then modify, refine, etc. as we gather more data.

DATA: Phenomenon A2 (BIOLOGICAL MACHINES) is observed. EXPERIENCE: B2=A SUPER-ENGINEER DESIGNED THE MACHINES. We propose 'B' (supporting Point 1 above) from our own observation and experience.  
LOGIC: If B2 were true, then A2 would be a matter of course.
CONCLUSION: Since we do observe A2, there is reason to suspect that B2 is true.  We will propose that it is true, then modify, refine, etc. as we gather more data.

I know I'm not done with Point 1 ... I still have to cover 'speaking things into existence' and 'living outside time' but my eyes hurt and I'm quitting for now ...

See you soon!

Date: 2006/05/03 05:28:09, Link
Author: afdave
Quote
From Corkscrew ...
- Hypothesis: humans evolved from the same lineage as modern apes
- Observation: the modern apes that are most physiologically similar to humans have 24 chromosomes per haploid
- Observation: humans have 23 chromosomes per haploid
- Conclusion: either humans have lost a chromosome or the other apes have all gained a chromosome
- By application of parsimony: humans have lost a chromosome
- Observation: chromosomes are generally "lost" by merging with another chromosome, as destruction of a chromosome's worth of genetic information is generally fatal
- Conclusion: at some point in our ancestry, two human chromosomes merged
- Prediction: one human chromosome will closely resemble two ape chromosomes merged together.
This prediction was subsequently confirmed. I can present other instances of confirmed predictions if you like.

Corkscrew continues to be the most logical sounding, non-emotional advocate of the general Theory of Evolution that I have heard over here at PT.  Right behind him is Faid, who is at least polite and does not engage in polemics, and Norm who sounds intelligent.  I keep throwing this bone out to ToE advocates that you will further your cause if you adopt the rational, non-emotional 'Corkscrew' approach.  Adopting the 'Aftershave' approach or the 'Mr_Christopher' approach will only harm your cause.  This hypothesis is very interesting to me and I want to hear more.  I will copy it into my "AF Dave wants you to prove Evolution" thread, then I would like to do some Google searching and get back to you on this as soon as I can.
Quote
Corkscrew said ... In general, the only time we take a statement on trust is when we can reasonably expect that it would have been falsified were it not true. Or when we have absolutely no other option. Abduction is rarely more than half the story, and in science it's generally not even that.

At first glance, I don't agree with this, but I will consider it further to see if my disagreement is warranted or not.  What do you think about Meyer's objection to falsifiability as a criterion for status as a "scientific theory"? [I'm asking Corkscrew ... or anyone else that wants to provide a calm, rational answer other than 'Meyer is a liar', etc.]
Quote
With the death of positivism in the 1950s, demarcationists took a different tack. Other semantic criteria emerged, such as Sir Karl Popper's falsifiability. According to Popper, scientific theories were more meaningful than nonscientific ideas because they referred only to empirically falsifiable entities.21 Yet this, too, proved to be a problematic criterion. First, falsification turns out to be difficult to achieve. Rarely are the core commitments of theories directly tested via prediction. Instead, predictions occur when core theoretical commitments are conjoined with auxiliary hypotheses, thus always leaving open the possibility that auxiliary hypotheses, not core commitments, are responsible for failed predictions.

Newtonian mechanics, for example, assumed as its core three laws of motion and the theory of universal gravitation. On the basis of these, Newton made a number of predictions about the positions of planets in the solar system. When observations failed to corroborate some of his predictions, he did not reject his core assumptions. Instead, he scrutinized some of his auxiliary hypotheses to explain the discrepancies between theory and observation. For example, he examined his working assumption that planets were perfectly spherical and influenced only by gravitational force. As Imre Lakatos has shown, Newton's refusal to repudiate his core in the face of anomalies enabled him to refine his theory and eventually led to its tremendous success.22 Newton's refusal to accept putatively falsifying results certainly did not call into question the scientific status of his gravitational theory or his three laws. Meyer on Scientific Status of Intelligent Design

AFDave said ...
Quote
I have already hinted about some of my evidence for Point 1 - There is a God ... namely, the Cosmic 'Fine-Tuning', biological 'machines' we observe and so on.
Chris Hyland said ...
Quote
We would also expect to see these things if there weren't a God.
On what basis?  Your personal experience?  Is there a scientist somewhere that has observed this that I have not read about? In my personal experience and in all my reading, I have never observed (or read about) a non-intelligent cause producing a functional machine (there are a few equivocal examples I have heard about).  Have you?  My experience has ALWAYS been that functional machines require intelligent agency.  Therefore, I think my hypothesis of a Super-Engineer (I do not insist upon calling him 'God') is a better explanation.

Eric Murphy said ...
Quote
Let me ask you something, Dave: would it surprise you to find yourself living in a universe that cannot sustain life? I know it would surprise me.
If you read what I have written, you will notice that I said I am content to discard the term 'Surprising Fact' and simply use 'Phenomenon.'
Quote
So let's just say that your fine-tuning argument, aside from being hardly original, is a less than compelling argument for the existence of God. At best, it's an argument for good luck. Assuming you think being blessed with existence is actually good luck.
I didn't say it was original ... 'my hypothesis' means to me a conglomerate of existing ones plus some of my own thoughts presented in my own way. Everyone does this.  Why is it less than compelling? Have you ever experienced or read about a system that was 'finely tuned' that was NOT finely tuned by an engineer (or team of them)?
Quote
You're conflating various origin concepts (origin of the universe, origin of life, origin of species) and applying exactly the same teleological reasoning to each. Teleological reasoning has the illusionary quality of appearing "knowable" but it's really a mask for a great big unknown. Wikipedia has an entry on teleology: http://en.wikipedia.org/wiki/Teleological_argument
Consider your airplane argument. It's classic teleology. You're stealing the basic concept of William Paley's watchmaker argument which was made prior to Darwin and which Darwin himself shot down after he believed it for awhile. Teleology and the watchmaker argument have even deeper flaws than those noted by Wikipedia.

Yes.  I am conflating them.  If I had a good reason from my experience and observable evidence NOT to conflate them, then I would not conflate them.  But I think it is quite well accepted now that the universe is finite and had a beginning, is it not?  (I think the 'parallel universe' theory is pretty much dead). So this provides support to my 'God' hypothesis.  No one has a clue about the origin of life, so why shouldn't we propose 'God' until we can find something better?  No one has yet shown me an example of a worm-like creature evolving into a squid or a dinosaur-like creature evolving into a bird, etc., etc. (did I get the supposed progression right?), so again, what is so unscientific about proposing a Master Engineer (or a committee of Master Engineers) that MIGHT HAVE created them?  And what is wrong with proposing that they all be conflated into one entity?  There are other lines of evidence that support this.  I think we can AT LEAST propose it, then investigate.  Wikipedia's main gripe of the Watchmaker argument (and I assume teleology as well) seemed to be that you run into the 'brick wall' of 'Who Designed God?'  I admit this readily, but just as the native would be wrong to say 'I cannot explain who designed the engineers at Cessna, so I will not believe that Cessna engineers designed Cessna airplanes', it is just as illogical to toss out the 'God possibility' simply because we cannot explain HIS origin.
Quote
Chris Hyland's Evolution Hypothesis
A1=WE OBSERVE A FINELY TUNED COSMOS.
Stars and that...
B1=A SUPER-INTELLIGENCE DIDN'T SET THE PARAMETERS
Because evolution is bound by many factors including physical constants ie the properties of water and carbon, and the availability of energy, it will create organisms that depend heavily on these. Therefore because we observe that if any of the physical constants change life would not exist we assume that evolution is true. Under the alternative hypothesis, we could just as easily see organisms survive if the universe was stacked against them.
I do not follow your logic.  Can you explain more clearly?  Also, to use my structure, you would need to propose what DID set the parameters.  Are you proposing that the parameters got set by chance?  If so, what basis do you have from your experience to propose this as valid?  How would you deal with the odds against this, etc.?  I think maybe what you are saying is that you don't believe the 'fine tuning' was necessary for life to evolve?   I obviously have already accepted that they are set precisely to sustain life because I think this is well supported.  Are you saying you do not accept this?
Quote
If someone says a heavier than air machine cannot fly and then someone builds one that can -- it is as absolutely certain a thing as man can know that a heavier than air machine can fly.
I see what you are saying, but even in this case, it is only absolute certainty to the person (or people) who built it and flew it. Think about it.  All other people who hear about it will get INDIRECT evidence--they will read about it, see the report on TV, etc. and of course this is quite reliable for the example you raise.  But TV and newspaper reports can get unreliable when reporting less cut and dried events.  The Miller/Urey experiment is an example.  The headlines were something like "Scientists Create Life in a Test Tube!!"  Oh really?  On closer examination, we found that was a big stretch (translated, lie).  Ditto for newspaper reports of many supposed human ancestor fossils.  For our discussion, I am assuming we were talking about things which CANNOT be verified directly, such as forces, fields, atoms, quarks, past events, mental states, subsurface geological features, molecular biological structures, airplane factories that the natives have never seen, George Washington, and 'God' to name a few.
Quote
You talk of "absolutes" to escape Danny Hillis' demonstration of evolutionary concepts, but then you talk of "truth" when dealing with Meyer's metaphysical conjectures. You don't see a problem with that?
My problem with Danny Hillis' has nothing to do with the concepts of 'absolutes'.  It has everything to do with the question of 'What exactly does the Hillis demo tell us? (Really, when we remove the spin)  Notice my reference to the word 'truth' is in quotes because I know there are different definitions of truth.
Quote
These tidbits from your favorite DI fellows aren’t evidence, Dave.
If they are not, then could you propose an example of what IS evidence?  Let me guess ... mountains and mountains of 'scholarship' from the science establishment to support Naturalistic Explanations Only?  This was the kind of odds Galileo was working against too.  Are you telling me that I should believe your evidence and reject mine because yours fits with the majority?
Quote
Second, what does “life-sustaining universe” mean?
Exactly what it says.  And I challenge you to propose some parameter changes and ask a biologist how likely it would be for life to continue.  The problem with naturalistic speculators like yourself is that you guys like to say "Well, we only know about life on earth ... sample size of one.  There could be other planets, other universes, who knows!"  OK, great.  I agree.  And there could be a Fairy Godmother for all I know.  But if we are going to admit wild speculation into the arena, let's admit ALL kinds of wild speculation into the arena.  My favorite is "Parallel Universes".  I don't know how people can tell me with a straight face that there might be an infinite number of parallel universes, then in the next breath tell me I'm a wild speculator for proposing an Infinite God character.

Regarding the Denton "howler" ...  THIS is the howler ...
Quote
All the evidence available in the biological (and geological) sciences in fact supports the proposition that life began ~3.8 billion years ago
*cough* because we arbitrarily made some massive initial conditions assumptions so it would come out that long
Quote
and that from that time forward the most numerous, diverse, robust, and tenacious life-forms have been prokaryotes.
the old 'what do you think makes humans so special, just look at the bacteria' saw ... sometime I'm going to do a thread on the implications of this thinking on law and culture ... talk about a howler ... this one will be way better than Rush Limbaugh and the Tree Huggers!
Quote
Multicellular, animal life has been around for maybe a billion years
based on our flawed assumptions in dating supposed 'index fossils'[/quote], most of that as relatively undifferentiated worm-like creatures. Mammals have been around for 80 to 100 million years, primates about 40 million, hominids 7 to 8 million, and genus Homo maybe two million[/quote]Ditto above ... funny ... every non-YEC history book I can find anywhere says things like "4000 (or so) BC: History Begins" (I never find over 10,000).   Hmmm... what did all those 'Homos' do for 1,996,000 years?  You're telling me they all of a sudden started writing and making artifacts only in the last .000000001% (or whatever) of their existence on the planet ... yeah, pretty plausible
Quote
The human conception of a creative “Super-Intelligence” is about the only thing the Bible dates correctly, being about 5 or 6 thousand years old. In other words, roughly .000001 of the history of life, or .0025 of the existence of our genus. Pretty long build-up for the punchline, wouldn’t you say?
the buildup is in your imagination, Mr. O'Brien, which is great.  I like imagining things too.  Have you seen Narnia?  It's a good one for the imagination, but it's not about science, unless we redefine science ... which I'm not opposed to as long as the rules are fair.
Quote
Tacitus said ... Dave, I'll bite.  You don't regard yourself as "religious"... maybe I'm being too suspicious, but I've heard this assertion from fundamentalist Christians to take it at face value.  They seem to regard their faith as something more than religion, but by any dictionary definition, Christianity, or faith in Jesus or whatever way you want to term it, is still a religion.  So, Dave, is that the case with you?
'God, Jesus, etc,' are religious terms by convention, and I understand that most people consider me religious, and I will call myself religious in certain contexts so as not to confuse people needlessly.  But my real view of myself is that I am scientific, not religious.  But my definition of science is ... drum roll ... more expansive than yours.  I consider ALL possibilites for explaining and describing the universe, not just so called 'naturalistic ones' which we presently understand. I, in contrast to you, make allowance that there just might be some things that we don't understand yet because our science is not advanced enough ... like angels and demons and creation  of matter from nothing and the ability to walk on water, part the Red Sea, etc.  Why do you guys choke so much on these ideas?  I thought you were scientists, forever pushing the boundaries back.  Isn't that what you want?  This is the most illogical thing to me.  That supposedly open-minded scientists would categorically rule out so many possibilities for explaining phenomena. Here ... go read Meyer some more and call me in three days ... http://www.discovery.org/scripts....Science
Quote
If you are being sincere in your search for the truth (BTW: only creationists and religious fundies capitalize talk about "Truth") then you need to read  the books and articles that directly refute their claims.  Are you prepared to do that?
Already did.  Been there. Done that.  Didn't buy it because it was unconvincing.
Quote
So far you haven’t provided any evidence at all to support YEC or God, just your own (and a few other Creationists’) personal incredulity. “WOW! It’s just SOOOOO complex, I’m too stupid or too lazy to investigate how it could have evolved!!”  You sound just like the natives looking at the “flying canoe”.
Uh, oh.  I'm getting 'Aftershaved" again.  Hey try some intelligent sounding arguments instead of insults ... they work better. See Corkscrew, Norm and Chris Hyland and others for some good examples of intelligent sounding stuff.
Quote
First, under oath, Behe testified that Astrology would qualify as a legitimate science under Behe’s definition.
Let's get the quote right at least if you're going to quote him.  Here's what I found ...
Quote
They acknowledged under oath that ID cannot qualify as science unless the definition of science is completely changed to admit the supernatural. Behe acknowledged that under his definition, astrology would equally qualify as science.
OK. So astrology wants to call itself a science?  Let 'em.  They have to prove their ideas just like the YECers and everyone else.  Don't you believe in the free market of ideas?  I think the majority would weed them out just like it does in other arenas.  Do you see an Astrology Chapel at the USAF Academy? (I was just there).  Do you see a Scientology chapel?  Or a Buddhist temple?  No.  You see a BIG Protestant chapel, a smaller Catholic chapel and a smaller still Jewish chapel.  Why?  Democracy.  Freedom.  Reflection of the majority within practical limits.  Should the USAF Academy shut down all religion on campus b/c it's a government entity?  Of course not.  Remember.. here in the USA ... Congress shall make no law respecting an establishment of religion [no state church lke the Church of England] or prohibiting the FREE EXERCISE thereof.  Same for science classes.  We shouldn't be telling kids 'God created the world' in science class and we shouldn't be telling the world that 'Evolution created the world' in science class.  We should be telling them 'Most scientists believe some form of Darwin's Theory of Evolution to explain the appearance of life.  Many non-scientists and a minority of scientists believe in some form of supernatural cause for the appearance of life.  Creationism and Intelligent Design Theory are two of these views.' And if Astrology or Scientism or Christian Science or whatever gets a big enough following, then throw them in there too and let the kids decide for themselves with the help of their parents.  And this is one point I would probably agree with all of you about.  I know there are YECers who share my view of Origins but who use bad tactics--'Let's teach the kids that God said it, I believe it and that settles it!!'  I join you in vigorously opposing these types.  They are not my allies.
Quote
The prosecuting attorney then dropped a two foot high stack of over 60 peer-reviewed scientific papers and articles with research detailing the evolution of the human blood clotting system and asked Behe if he was familiar with the work..  Behe replied that he didn’t need to read them as he already knew his claim was correct.
I didn't check this quote for accuracy, but I imagine he feels as I feel that scientists just keep on writing mountains and mountains of nonsense to support these notions they really, really want to be true ... like the immune system evolved, etc.  I've read a lot myself and it all starts to sound the same ... I'm sure you can relate.  Many people here have said the same about the stuff I write.  I will agree with you that it seems hair-brained to adopt the strategy to go try to defend a local school board's decision to put 'Evolution Warning Labels' on the books.  I mean ... who knows what kind of rednecks you might be defending?  Why fight this in the courts anyway?  I can think of better places to get the word out. So is that 2 things we agree on now?  Oh yeah ... we're both EE's.  OK 3 then.
Quote
The "fine-tuning" argument is really an argument "against" a God of miracles.
Not if you use MY definition of 'miracles'.  Have I given that yet?  A miracle is simply a natural law being employed which our science does not yet understand.  Jesus knew how to walk on water (if the NT record is true), but we don't yet, etc.

Date: 2006/05/03 23:03:04, Link
Author: afdave
Tacitus said ...
Quote
Claiming that harmful genetic mutations have increased to the point of reducing our lifespan to 10% of what it used to be 6,000 years ago is about as sensible as claiming the speed of light is a fraction of what it used to be


Hey Tacitus ... I know a good eye doctor I could recommend that could prescribe some eye glasses or contacts so you could accurately read what I write ... but if it was not an eyesight problem and you are going to deliberately misrepresent what I write, then kindly get off my thread so I don't have to waste my time correcting your mistakes ...

I said that by the time of Moses, genetic mutations would have accumulated enough to make close marriages unsafe, hence the anti-incest laws.  Get it?

The long lifespans prior to the Flood are a different matter.  I will give more details on this later on my other thread.

Date: 2006/05/03 23:03:04, Link
Author: afdave
Tacitus said ...
Quote
Claiming that harmful genetic mutations have increased to the point of reducing our lifespan to 10% of what it used to be 6,000 years ago is about as sensible as claiming the speed of light is a fraction of what it used to be


Hey Tacitus ... I know a good eye doctor I could recommend that could prescribe some eye glasses or contacts so you could accurately read what I write ... but if it was not an eyesight problem and you are going to deliberately misrepresent what I write, then kindly get off my thread so I don't have to waste my time correcting your mistakes ...

I said that by the time of Moses, genetic mutations would have accumulated enough to make close marriages unsafe, hence the anti-incest laws.  Get it?

The long lifespans prior to the Flood are a different matter.  I will give more details on this later on my other thread.

Date: 2006/05/03 23:16:36, Link
Author: afdave
I think HEHE was asking back there somewhere if God is a moral relativist, since brother/sister marriages were OK in the beginning, but not by the time of Moses ...

Good question ...

No, I don't believe He is.  But I think there is a common misconception about WHY God makes certain rules.  Some people think that God just arbitrarily made up a bunch of rules.  From my reading of the Bible, it is clear to me that God made rules FOR THE BENEFIT of people.  This is a perfect example.  In this case, God's rule was: Brothers, don't marry sisters.  Why?  Because of accumulated harmful mutations.  So God is not saying there is anything INHERENTLY wrong with brother/sister marriages ... he is only saying there is NOW something PRACTICALLY wrong with it.  Saying that God is a moral relativist because of this would be like saying that catalytic converter laws for motor vehicles are somehow "morally relativistic."  A long time ago, there were no such laws.  Now they are necessary due to the proliferation of automobiles.

HEHE's funny special case about a man with a vascectomy marrying his sister (I take my hat off to you, hehe, this is a good one!  I like the way your mind works!) would simply be a judgment call I suppose for lawmakers and/or individuals, the risks being failed vasectomies, etc.

Does this help?

Date: 2006/05/03 23:16:36, Link
Author: afdave
I think HEHE was asking back there somewhere if God is a moral relativist, since brother/sister marriages were OK in the beginning, but not by the time of Moses ...

Good question ...

No, I don't believe He is.  But I think there is a common misconception about WHY God makes certain rules.  Some people think that God just arbitrarily made up a bunch of rules.  From my reading of the Bible, it is clear to me that God made rules FOR THE BENEFIT of people.  This is a perfect example.  In this case, God's rule was: Brothers, don't marry sisters.  Why?  Because of accumulated harmful mutations.  So God is not saying there is anything INHERENTLY wrong with brother/sister marriages ... he is only saying there is NOW something PRACTICALLY wrong with it.  Saying that God is a moral relativist because of this would be like saying that catalytic converter laws for motor vehicles are somehow "morally relativistic."  A long time ago, there were no such laws.  Now they are necessary due to the proliferation of automobiles.

HEHE's funny special case about a man with a vascectomy marrying his sister (I take my hat off to you, hehe, this is a good one!  I like the way your mind works!) would simply be a judgment call I suppose for lawmakers and/or individuals, the risks being failed vasectomies, etc.

Does this help?

Date: 2006/05/03 23:19:14, Link
Author: afdave
I think HEHE was asking back there somewhere if God is a moral relativist, since brother/sister marriages were OK in the beginning, but not by the time of Moses ...

Good question ...

No, I don't believe He is.  But I think there is a common misconception about WHY God makes certain rules.  Some people think that God just arbitrarily made up a bunch of rules.  From my reading of the Bible, it is clear to me that God made rules FOR THE BENEFIT of people.  This is a perfect example.  In this case, God's rule was: Brothers, don't marry sisters.  Why?  Because of accumulated harmful mutations.  So God is not saying there is anything INHERENTLY wrong with brother/sister marriages ... he is only saying there is NOW something PRACTICALLY wrong with it.  Saying that God is a moral relativist because of this would be like saying that catalytic converter laws for motor vehicles are somehow "morally relativistic."  A long time ago, there were no such laws.  Now they are necessary due to the proliferation of automobiles.

HEHE's funny special case about a man with a vascectomy marrying his sister (I take my hat off to you, hehe, this is a good one!  I like the way your mind works!) would simply be a judgment call I suppose for lawmakers and/or individuals, the risks being failed vasectomies, etc.

Does this help?

Date: 2006/05/03 23:40:58, Link
Author: afdave
Norm--

Sorry to take so long to get back to you on the Danny Hillis Genetic Algorithm question.  GA's do not simulate the real conditions we find in the natural world and thus do not 'prove' evolution.  As Don Batten writes,
Quote
However, GAs do not mimic or simulate biological evolution because with a GA:

A ‘trait’ can only be quantitative so that any move towards the objective can be selected for. Many biological traits are qualitative—it either works or it does not, so there is no step-wise means of getting from no function to the function.

A single trait is selected for, whereas any living thing is multidimensional. A GA will not work with three or four different objectives, or I dare say even just two. A GA does not test for survival; it tests for only a single trait. Even with the simplest bacteria, which are not at all simple, hundreds of traits have to be present for it to be viable (survive); selection has to operate on all traits that affect survival.

Something always survives to carry on the process. There is no rule in evolution that says that some organism(s) in the evolving population will remain viable no matter what mutations occur. In fact, the GAs that I have looked at artificially preserve the best of the previous generation and protect it from mutations or recombination in case nothing better is produced in the next iteration. This has a ratchet effect that ensures that the GA will generate the desired outcome—any move in the right direction is protected. This is certainly the case with Dawkins’ (in)famous ‘Weasel’ simulation—see Weasel Words and Dawkins’ weasel revisited.

Perfect selection (selection coefficient, s = 1.0) is often applied so that in each generation only the best survives to ‘reproduce’ to produce the next generation. In the real world, selection coefficients of 0.01 or less are considered realistic, in which case it would take many generations for an information-adding mutation to permeate through a population. Putting it another way, the cost of substitution is ignored (see ReMine’s The Biotic Message for a thorough run-down of this, which is completely ignored in GAs—see Population genetics, Haldane’s Dilemma, etc.).

The flip side to this is that high rates of ‘reproduction’ are used. Bacteria can only double their numbers per generation. Many ‘higher’ organisms can only do a little better, but GAs commonly produce 100s or 1000s of ‘offspring’ per generation. For example, if a population of 1,000 bacteria had only one survivor (999 died), then it would take 10 generations to get back to 1,000.

Generation time is ignored. A generation can happen in a computer in microseconds whereas even the best bacteria take about 20 minutes. Multicellular organisms have far longer generation times.

The mutation rate is artificially high (by many orders of magnitude). This is sustainable because the ‘genome’ is small (see next point) and artificial rules are invoked to protect the best ‘organism’ from mutations, for example. Such mutation rates in real organisms would result in all the offspring being non-viable (error catastrophe). This is why living things have exquisitely designed editing machinery to minimize copying errors to the rate of one in about 10 billion (for humans).

The ‘genome’ is artificially small and only does one thing. The smallest real world genome is over 0.5 million base pairs (and it is an obligate parasite, which depends on its host for many of the substrates needed) with several hundred proteins coded. This is equivalent to over a million bits of information. Even if a GA generated 1800 bits of real information, as one of the commonly-touted ones claims, that is equivalent to maybe one small enzyme—and that was achieved with totally artificial mutation rates, generation times, selection coefficients, etc., etc. In fact, this is also how the body’s immune system develops specific antibodies, with these designed conditions totally different to any whole organism. This is pointed out in more detail by biophysicist Dr Lee Spetner in his refutation of a skeptic.

In real organisms, mutations occur throughout the genome, not just in a gene or section that specifies a given trait. This means that all the deleterious changes to other traits have to be eliminated along with selecting for the rare desirable changes in the trait being selected for. This is ignored in GAs. With genetic algorithms, the program itself is protected from mutations; only target sequences are mutated. Indeed, if it were not quarantined from mutations, the program would very quickly crash. However, the reproduction machinery of an organism is not protected from mutations.

There is no problem of irreducible complexity with GAs (see Behe’s Darwin’s Black Box). Many biological traits require many different components to be present, functioning together, for the trait to exist at all (e.g. protein synthesis, DNA replication, reproduction of a cell, blood clotting, every metabolic pathway, etc.).

Polygeny (where a trait is determined by the combined action of more than one gene) and pleiotropy (where one gene can affect several different traits) are ignored. Furthermore, recessive genes are ignored (recessive genes cannot be selected for unless present as a pair; i.e. homozygous), which multiplies the number of generations needed to get a new trait established in a population. The problem of recessive genes leads to one facet of Haldane’s Dilemma, where the well-known evolutionist J.B.S. Haldane pointed out that, based on the theorems of population genetics, there has not been enough time for the sexual organisms with low reproductive rates and long generation times to evolve. See review of ReMine’s analysis of Haldane’s Dilemma.

Multiple coding genes are ignored. From the human genome project, it appears that, on average, each gene codes for at least three different proteins (see Genome Mania — Deciphering the human genome. In microbes, genes have been discovered that code for one protein when ‘read’ in one direction and a different protein when read backwards, or when the ‘reading’ starts one letter on. Creating a GA to generate such information-dense coding would seem to be out of the question. Such demands an intelligence vastly superior to human beings for its creation.

The outcome in a GA is ‘pre-ordained’. Evolution is by definition purposeless, so no computer program that has a pre-determined goal can simulate it—period. This is blatantly true of Dawkins’ ‘weasel’ program, where the selection of each letter sequence is determined entirely on its match with the pre-programmed goal sequence. Perhaps if the programmer could come up with a program that allowed anything to happen and then measured the survivability of the ‘organisms’, it might be getting closer to what evolution is supposed to do! Of course that is impossible (as is evolution).

With a particular GA, we need to ask how much of the ‘information’ generated by the program is actually specified in the program, rather than being generated de novo. A number of modules or subroutines are normally specified in the program, and the ways these can interact is also specified. The GA program finds the best combinations of modules and the best ways of interacting them. The amount of new information generated is usually quite trivial, even with all the artificial constraints designed to make the GA work.
http://www.answersingenesis.org/home/area/faq/docs/genetic_algorithm.asp

Date: 2006/05/03 23:40:58, Link
Author: afdave
Norm--

Sorry to take so long to get back to you on the Danny Hillis Genetic Algorithm question.  GA's do not simulate the real conditions we find in the natural world and thus do not 'prove' evolution.  As Don Batten writes,
Quote
However, GAs do not mimic or simulate biological evolution because with a GA:

A ‘trait’ can only be quantitative so that any move towards the objective can be selected for. Many biological traits are qualitative—it either works or it does not, so there is no step-wise means of getting from no function to the function.

A single trait is selected for, whereas any living thing is multidimensional. A GA will not work with three or four different objectives, or I dare say even just two. A GA does not test for survival; it tests for only a single trait. Even with the simplest bacteria, which are not at all simple, hundreds of traits have to be present for it to be viable (survive); selection has to operate on all traits that affect survival.

Something always survives to carry on the process. There is no rule in evolution that says that some organism(s) in the evolving population will remain viable no matter what mutations occur. In fact, the GAs that I have looked at artificially preserve the best of the previous generation and protect it from mutations or recombination in case nothing better is produced in the next iteration. This has a ratchet effect that ensures that the GA will generate the desired outcome—any move in the right direction is protected. This is certainly the case with Dawkins’ (in)famous ‘Weasel’ simulation—see Weasel Words and Dawkins’ weasel revisited.

Perfect selection (selection coefficient, s = 1.0) is often applied so that in each generation only the best survives to ‘reproduce’ to produce the next generation. In the real world, selection coefficients of 0.01 or less are considered realistic, in which case it would take many generations for an information-adding mutation to permeate through a population. Putting it another way, the cost of substitution is ignored (see ReMine’s The Biotic Message for a thorough run-down of this, which is completely ignored in GAs—see Population genetics, Haldane’s Dilemma, etc.).

The flip side to this is that high rates of ‘reproduction’ are used. Bacteria can only double their numbers per generation. Many ‘higher’ organisms can only do a little better, but GAs commonly produce 100s or 1000s of ‘offspring’ per generation. For example, if a population of 1,000 bacteria had only one survivor (999 died), then it would take 10 generations to get back to 1,000.

Generation time is ignored. A generation can happen in a computer in microseconds whereas even the best bacteria take about 20 minutes. Multicellular organisms have far longer generation times.

The mutation rate is artificially high (by many orders of magnitude). This is sustainable because the ‘genome’ is small (see next point) and artificial rules are invoked to protect the best ‘organism’ from mutations, for example. Such mutation rates in real organisms would result in all the offspring being non-viable (error catastrophe). This is why living things have exquisitely designed editing machinery to minimize copying errors to the rate of one in about 10 billion (for humans).

The ‘genome’ is artificially small and only does one thing. The smallest real world genome is over 0.5 million base pairs (and it is an obligate parasite, which depends on its host for many of the substrates needed) with several hundred proteins coded. This is equivalent to over a million bits of information. Even if a GA generated 1800 bits of real information, as one of the commonly-touted ones claims, that is equivalent to maybe one small enzyme—and that was achieved with totally artificial mutation rates, generation times, selection coefficients, etc., etc. In fact, this is also how the body’s immune system develops specific antibodies, with these designed conditions totally different to any whole organism. This is pointed out in more detail by biophysicist Dr Lee Spetner in his refutation of a skeptic.

In real organisms, mutations occur throughout the genome, not just in a gene or section that specifies a given trait. This means that all the deleterious changes to other traits have to be eliminated along with selecting for the rare desirable changes in the trait being selected for. This is ignored in GAs. With genetic algorithms, the program itself is protected from mutations; only target sequences are mutated. Indeed, if it were not quarantined from mutations, the program would very quickly crash. However, the reproduction machinery of an organism is not protected from mutations.

There is no problem of irreducible complexity with GAs (see Behe’s Darwin’s Black Box). Many biological traits require many different components to be present, functioning together, for the trait to exist at all (e.g. protein synthesis, DNA replication, reproduction of a cell, blood clotting, every metabolic pathway, etc.).

Polygeny (where a trait is determined by the combined action of more than one gene) and pleiotropy (where one gene can affect several different traits) are ignored. Furthermore, recessive genes are ignored (recessive genes cannot be selected for unless present as a pair; i.e. homozygous), which multiplies the number of generations needed to get a new trait established in a population. The problem of recessive genes leads to one facet of Haldane’s Dilemma, where the well-known evolutionist J.B.S. Haldane pointed out that, based on the theorems of population genetics, there has not been enough time for the sexual organisms with low reproductive rates and long generation times to evolve. See review of ReMine’s analysis of Haldane’s Dilemma.

Multiple coding genes are ignored. From the human genome project, it appears that, on average, each gene codes for at least three different proteins (see Genome Mania — Deciphering the human genome. In microbes, genes have been discovered that code for one protein when ‘read’ in one direction and a different protein when read backwards, or when the ‘reading’ starts one letter on. Creating a GA to generate such information-dense coding would seem to be out of the question. Such demands an intelligence vastly superior to human beings for its creation.

The outcome in a GA is ‘pre-ordained’. Evolution is by definition purposeless, so no computer program that has a pre-determined goal can simulate it—period. This is blatantly true of Dawkins’ ‘weasel’ program, where the selection of each letter sequence is determined entirely on its match with the pre-programmed goal sequence. Perhaps if the programmer could come up with a program that allowed anything to happen and then measured the survivability of the ‘organisms’, it might be getting closer to what evolution is supposed to do! Of course that is impossible (as is evolution).

With a particular GA, we need to ask how much of the ‘information’ generated by the program is actually specified in the program, rather than being generated de novo. A number of modules or subroutines are normally specified in the program, and the ways these can interact is also specified. The GA program finds the best combinations of modules and the best ways of interacting them. The amount of new information generated is usually quite trivial, even with all the artificial constraints designed to make the GA work.
http://www.answersingenesis.org/home/area/faq/docs/genetic_algorithm.asp

Date: 2006/05/04 02:54:07, Link
Author: afdave
HUMAN-CHIMP CHROMOSOME NUMBER PREDICTION

This is a common 'proof' for Ape to Human Evolution, but as is so often the case, this appears to be wishful thinking on the part of Neo-Darwinists.  There are two major problems that I see with this Neo-Darwinist assertion, which they most recently displayed in the Dover case ...  

(1) No one to my knowledge has ever proposed a stepwise solution of HOW the 2A and 2B chimp chromosomes joined.  This appears to be a HUGE obstacle.
(2) The join was 'head-to-head'.  If my understanding is true (stated below) that chromosomes are read in only one direction, then this would be a SECOND HUGE OBSTACLE.

See Chimpanzee Genome Project
http://en.wikipedia.org/wiki/Chimpanzee_Genome_Project
for a nice picture comparing the genomes.

Below is a quote from Dr. Jerome LeJeune, Discoverer of Down's Syndrome.  Notice that this was 1975, so this is old news.  Chimp and human chromosomal differences were known around 8 years before this.  (I think I read that LeJeune and his staff discovered this also)

Professor Jerome LeJeune, a very distinguished French cytogeneticist and holder of the chair of Fundamental Genetics, University of Paris, claims that modern knowledge of chromosomes makes it impossible for a human to have evolved slowly and gradually from a pre-human. From other things he mentions, it appears that Prof. LeJeune is not a creationist—he appears to hover somewhere between theistic evolution and ‘progressive creation’. However, his comments denying Neodarwinism are very relevant to us [AIG], since this is the mechanism of evolution which is being taught in our schools and universities. His statements here mentioned were made at a conference of mostly Catholic doctors and theologians, entitled ‘The Quality of Life’ and dealing mainly with abortion, euthanasia and other pro-life issues. (Combined conference, Guild of St. Luke, SS Cosmos and Damian, Wairakei, N.Z. Ott 9-12, 1975, proceedings edited by D. Bonisch) For example:
Quote
‘And just from what we know from primates, that is, from the gorilla, from the chimpanzee, from the orangutan and from man, we can safely say that the very ingenious simplification of Neodarwinists is now just good to put in the museum of old news—that is, the museum in which you put past discoveries that no longer have any explanation-interest.’

A little further on:
Quote
‘Because from the actual structure of the chromosome we can demonstrate that the human species did not come from a progressive humanization of a prehuman. We can be as sure that the gorilla never came to be a gorilla by a progressive gorillization of a pregorilla. These things are not true. They are told as telltale in classic books, but they are not any longer true.’


Prof. LeJeune does not delve into technicalities or all his reasons for saying this, but one apparent reason seems to be as follows: A chimp has two more chromosomes than man, which two appear as if ‘homologous’ to a single one in man. The evolutionist would have to say that in the process of the chimpanzee and man’s common ancestor becoming ‘humanized’, the two chromosomes (which remained independent in the chimp) became joined in man. The strong biochemical resemblance between man and chimp would be used as further evidence to support the notion that the chromosomes are indeed homologous. The blow for Neodarwinism comes, however, with the discovery that the theoretical ‘join’ is head-to-head. Since the chromosomes are always ‘read’ in the same direction, this means that the same ‘sentence’ would be read backwards, and would make no biochemical sense!

Here is another quote from Dr. LeJeune ...
Quote

‘The Neodarwinist is now reaching the point of dignity in the history of science that the Ptolemaic system in astronomy, the epicycle system, reached long ago. We know that it does not work.’
(LeJeune, Jerome (Professor of Fundamental Genetics, University of Paris)
Symposium volume titled ‘Quality of Life’, Ed. D. Bonisch, 1975, p.64)


How would my friends here at PT answers these two objections?

Date: 2006/05/04 03:07:35, Link
Author: afdave
Quote
I think the point seems to be that genetic algorithms aren't perfect simulations of biological evolution. I don't think they were ever supposed to be. The idea was to use specific ideas from evolution to solve problems. You can say that is doesn't generate much information, and thats fine the point is it solves the problem that we can't in novel ways.

Thank you for clearing that up.  I think a better thing to say would be that 'Genetic Algorithms use specific ideas from the nature of Selection and Adaptation.'  Using the term 'evolution' confuses people, including apparently Neo-Darwinists.

This example was offered up to me as supposed 'evidence' that biological evolution (i.e. molecules-to-man) has in fact occurred.  

So I take it that whoever it was that offered that to me was in error, right?

And yes, Renier, I did understand most of it.

Date: 2006/05/04 03:07:35, Link
Author: afdave
Quote
I think the point seems to be that genetic algorithms aren't perfect simulations of biological evolution. I don't think they were ever supposed to be. The idea was to use specific ideas from evolution to solve problems. You can say that is doesn't generate much information, and thats fine the point is it solves the problem that we can't in novel ways.

Thank you for clearing that up.  I think a better thing to say would be that 'Genetic Algorithms use specific ideas from the nature of Selection and Adaptation.'  Using the term 'evolution' confuses people, including apparently Neo-Darwinists.

This example was offered up to me as supposed 'evidence' that biological evolution (i.e. molecules-to-man) has in fact occurred.  

So I take it that whoever it was that offered that to me was in error, right?

And yes, Renier, I did understand most of it.

Date: 2006/05/04 03:19:11, Link
Author: afdave
To be fair to Norm Doering, I found his quote ...
Quote
The computer used selection, akin to natural selection, tested the programs and terminated the less fit so that only the shortest (the best) sorting programs would be given a chance to reproduce. Over ten thousand generations of this cycle, Hillis' system bred a software program that was nearly as short as the best sorting programs written by human programmers.

That is a form of proof -- call it proof of concept. It's not proof that Darwinian evolution is what wrote our genomes, but it is proof that evolution could, in principle, do so. That's what I  mean  when I  talk about science and deductive proof.

Date: 2006/05/04 03:19:11, Link
Author: afdave
To be fair to Norm Doering, I found his quote ...
Quote
The computer used selection, akin to natural selection, tested the programs and terminated the less fit so that only the shortest (the best) sorting programs would be given a chance to reproduce. Over ten thousand generations of this cycle, Hillis' system bred a software program that was nearly as short as the best sorting programs written by human programmers.

That is a form of proof -- call it proof of concept. It's not proof that Darwinian evolution is what wrote our genomes, but it is proof that evolution could, in principle, do so. That's what I  mean  when I  talk about science and deductive proof.

Date: 2006/05/04 03:30:21, Link
Author: afdave
I have given evidence every day as promised.  I spend at least 2 hours every day now both answering critics and producing evidence for my own assertions.

Where have you been?

And kindly don't clog my serious attempts to understand ND assertions--such as this one--with your polemics.

Date: 2006/05/04 03:53:53, Link
Author: afdave
You you have not read my evidence that I have posted for my first "God Hypothesis" point?  About 'Cosmic Fine Tuning' and 'Biological Machines'? Have you not read my explanation for Cain's wife that was asked of me?

Or are you telling me you don't consider this to be evidence?   I really can't help you if you don't ACCEPT my evidence.  I can only give it.  And I will not take time to answer EVERY question that I feel has no bearing on the purpose of my thread.

Back to this thread, do you have any explanation for these seemingly insurmountable questions?

Date: 2006/05/04 05:05:23, Link
Author: afdave
Quote
Since an ancient divine rule was necessarily changed for no other reason than to avoid newly emerging concequenses, wouldn't elimination of the possibilty of those consequenses mean it would apply again? If God allowed incest when offspring were not a problem, then would a person completely incapable of having offspring, who commits incest, sin in the eyes of the lord?
That is very good logic and I do follow it.  From my understanding of Scripture, the word "sin" simply means "opposition to the will of God."  The primary guideline which we have to determine the will of God is the Bible as far as I know.  We have the one written guideline against incest at the time of Moses, but there are other guidelines for marriage in Scripture which may or may not apply, i.e. one question I can think of is "What is the Biblical PURPOSE of marriage?"  Remember that IF God approves of brother/sister no-offspring marriages NOW, this would mean  He would be approving of a marriage which WILL NEVER have any kids.  Notice that this situation, too, would be different than my supposed Cain's Wife scenario.  My tentative answer without further study would be that this unique situation still would not meet God's approval because one of his designs for marriage is to have children, but it does not appear  to me to be some kind of "heinous sin," but I could be wrong ... maybe He's fine with it.  

I'm curious what you are driving at ... are you considering doing this?  Are you concerned that you would somehow "fall out of Grace" under the Catholic conception of this term if you did?  Do you know someone who is?  Like hehe? :-) Or are just trying to investigate if you think God is consistent?

Date: 2006/05/04 05:05:23, Link
Author: afdave
Quote
Since an ancient divine rule was necessarily changed for no other reason than to avoid newly emerging concequenses, wouldn't elimination of the possibilty of those consequenses mean it would apply again? If God allowed incest when offspring were not a problem, then would a person completely incapable of having offspring, who commits incest, sin in the eyes of the lord?
That is very good logic and I do follow it.  From my understanding of Scripture, the word "sin" simply means "opposition to the will of God."  The primary guideline which we have to determine the will of God is the Bible as far as I know.  We have the one written guideline against incest at the time of Moses, but there are other guidelines for marriage in Scripture which may or may not apply, i.e. one question I can think of is "What is the Biblical PURPOSE of marriage?"  Remember that IF God approves of brother/sister no-offspring marriages NOW, this would mean  He would be approving of a marriage which WILL NEVER have any kids.  Notice that this situation, too, would be different than my supposed Cain's Wife scenario.  My tentative answer without further study would be that this unique situation still would not meet God's approval because one of his designs for marriage is to have children, but it does not appear  to me to be some kind of "heinous sin," but I could be wrong ... maybe He's fine with it.  

I'm curious what you are driving at ... are you considering doing this?  Are you concerned that you would somehow "fall out of Grace" under the Catholic conception of this term if you did?  Do you know someone who is?  Like hehe? :-) Or are just trying to investigate if you think God is consistent?

Date: 2006/05/04 06:58:26, Link
Author: afdave
Hello Everyone!

I begin this morning with a quote from Corkscrew because I can still see that we are not in agreement on HOW to present my case and WHAT constitutes 'science' ...

Quote
AFDave: again, I think we have a slight confusion of terminology. What you're describing as an hypothesis would, if I understand correctly, be more accurately considered a conjecture.  My understanding is that statements about the universe subdivide into the following categories:

Conjectures - statements that fit all the known data (these are produced by the largely-intuitive process of abduction)

Hypotheses - conjectures that are falsifiable

Data - conjectures that have been verified (there's no term for conjectures that are merely verifiable)

Predictions - conjectures that are both verifiable and falsifiable, and that haven't yet been verified or falsified

Science is concerned primarily with deciding which of the infinite number of possible hypotheses for any given situation is best. It does this by applying three principles: predictivity, parsimony and credibility. Predictivity means that an hypothesis must give us some idea of what we'll find next (otherwise it's scientifically useless), parsimony means that an hypothesis must be efficient in its use of "magic numbers" (so, for example, five dots in a row would be best described by a linear equation not a quintic equation), and credibility means that an hypothesis must have survived attempted falsification. Of these, credibility is the most important, followed by predictivity and then parsimony (this is partly because predictivity is a necessary condition for credibility).

Your conjecture does not, as it stands, make any predictions, so can't be considered an hypothesis. To rectify this, you'll need to:
1) increase its specificity until you can use it to make a prediction of the form described above
2) confirm that the current best-of-breed scientific hypotheses would not also make that prediction (ideally, they shouldn't even leave open the possibility of that prediction being true, but you can't have everything)
3) go out and test the prediction

I repeat: for your conjectures to be scientifically valid, it is not sufficient to present existing evidence in support of each of them. To match the level of current origins science, you must also be able to derive and confirm predictions from them. Otherwise, it really is just a "just so story". Predictivity is what makes the difference.


This objection is commonly called a "Demarcation Argument" ... possibly you all are very familiar with this in which certain "Demarcation Criteria" such as verifiability, falsifiability, predictivity, etc. are used to say "This is not science" or "that is not science."

While I would agree that Corkscrew's arguments are true for some endeavors within some branches of science, I do not think they are true for all of them.  Historical geology is one field that I would assume everyone here considers to be a scientific endeavor, yet I am not aware that the rules above apply.  My understanding of the data which we have in historical geology is that it is fixed.  We go out and observe the rock formations and begin making theories about WHY they are the way they are.  Of course, we can also test some samples in the lab to determine isotope content subject to certain initial conditions.  But I am not aware of anyone being able to make predictions of "how the next mountain range will be built" or "where the next oil fields will be laid" or "when, where or how a new gold mine will be formed." (If some of you know this last one, please tell me)  Rather, what we are concerned with is HOW the geologic formations got there  and WHAT EVENTS might have caused them, and this is a different business than predicting orbits of satellites, yet we rightly call it science.

Corkscrew uses the term 'origins science' and I agree that the study of the ORIGIN of all things IS INDEED SCIENCE.  However, some distinctions must be made.  A Neo-Darwinist's attempt to explain the origin of species (or we might say phyla here) by mutation and natural selection is in my opinion a scientific endeavor, but not because of the rules above.  Some of the rules certainly apply  when predicting relatively minor changes such the size of finch beaks, moth colorations, fruit fly anomalies, and my kid's disposition, etc.  But when ND's begin talking about how a worm developed into a squid, or how a land-mammal developed into a whale, they have crossed a big line.  Now they cannot make "predictions" in the same sense, i.e. "Put that worm in a bucket in your backyard, add X, Y, Z and wait one year and you will have a proto-squid."  They can do this with minor variations in finches and fruitflies, however.  They can say "Take some finches from South America with long beaks, put them on the Galapagos Islands and wait 10 years.  Then come back after 10 years and you will see only finches with short, strong beaks." (or whatever ... you get my point).  Do you see the difference?  One field of study, which I call "Designed Adaptation" (I think ND's call it confusingly to me -- Evolution) allows one to apply the demarcation tests of Credibility, Predictivity, Parsimony, mentioned by Corkscrew, and even Experimental Validation.  But with the former enterprise, which I have trouble labeling--shall we call it Macro-evolution? (worms to squids, eyes from eyespots, flippers from feet, etc)--we are not able to do any such thing to my knowledge.

I submit to you that in light of these considerations, my attempt to propose a Hypothesis for an Intelligent Designer as the Cause of all life on earth IS AT LEAST IN THE SAME CATEGORY OF DEMARCATION as current Neo-Darwinist attempts to explain life on earth (I call this Macro-Evolution, but I am open to a different term).

1)  BOTH have access to data which is FIXED.  We cannot observe flippers to feet happening today, and we cannot observe my postulated creation of dolphins.
2)  BOTH assume that AN EVENT in the past or a SERIES OF EVENTS in the past caused the phenomena being studied.
3)  BOTH are seeking to come up with a true description of the event or events that took place in the past.
4)  NEITHER can test the process that formed the phenomena today by experimental methods.
5)  BOTH require the use of analogy to things which ARE known to us
6)  BOTH require the scientist to DRAW INFERENCES TO THE BEST EXPLANATION

OK?  There you have my argument for why I think my structure is valid.  Before moving ahead with more evidence supporting Point 1 of my hypothesis, I would like to have your feedback.  For those who don't think I am being responsive with your questions, keep in mind that I am trying hard, but I also need to stay focused on the topic of this thread.

I did study the Human-Chimp chromosome fusion prediction and I found what appears to be some serious flaws in reasoning.  This is posted as a separate topic. I will be interested in your replies.

Quote
Evolution in animals takes a long time so you can't see it directly, (though you can get direct results with bacteria and fruit flies).

I am glad to see an acknowledgment that you cannot see evolution in animals.  I had never heard of that.  I am aware of the fruit fly and bacteria thing.  What kind of changes do we see?  I am only aware of relatively minor changes, which I would call 'Designed Adaptation.'  Are you saying that someone has observed, for instance, a fruit fly evolving into a house-fly like insect?

Quote
This is incorrect. The Theory of Evolution says nothing about the appearance of life. Origins of Life ("abiogenisis") theories are entirely separate from the Theory of Evolution. Nor does the Theory of Evolution have anything to say about the origin of the earth or the origin of the universe. Entirely separate theories deal with those issues. It's common among creationists to assume that the Theory of Evolution is an all-embracing origins theory.
OK.  Maybe someone should come up with one.  Isn't there something called a GUT? (Grand Unifying Theory).  That's sort of what mine attempts to be.

Quote
Dave, I asked you very early on in this thread to explain why you think the earth is only thousands of years old, not billions of years old.
I have to get past Demarcation Arguments and Point 1, then we will look at it.

Quote
Evolutionary programming and genetic algorithms are that kind of evidence. It may be indirect to you now -- but you've got to be stubornly denying the obvious for you to deny such things exist.
They are excellent evidence for what I call "Designed Adaptation" (moths, fruiflies, etc.) and are certainly quite useful, but they are not convincing to me regarding Flippers from Feet, etc.

Quote
One of the things about science that YEC's just can't get their heads around is that there just isn't any "my evidence" and "your evidence."
Agreed.  I did not mean to imply there is separate evidence.  I only meant evidence that I have seen.

Date: 2006/05/04 09:49:55, Link
Author: afdave
So this statement from AIG would definitely be incorrect?

Quote
The blow for Neodarwinism comes, however, with the discovery that the theoretical ‘join’ is head-to-head. Since the chromosomes are always ‘read’ in the same direction, this means that the same ‘sentence’ would be read backwards, and would make no biochemical sense!


What about the other statements from Dr. LeJeune?  These are strong statements from the discoverer of Downs Syndrome ... no?  Were not the 2 structures of chimp and human chromosomes well known even back in 1975?  Would this not put him in a postion to make an authoritative statement?

Date: 2006/05/04 10:27:41, Link
Author: afdave
Google's faster my friend ... and it got me as far as this

http://en.wikipedia.org/wiki/Chimpanzee_Genome_Project

but I could not find anything about chromosome reading being directional ... so I thank "whoever-it-was" for that!

Date: 2006/05/04 11:33:01, Link
Author: afdave
Quote
You've been admonished several times that you'll wear out everyone's patience if you don't get down to supporting these three assertions.

Relax.  Relax.  We'll get there ... besides, aren't you having fun beating up on a YECer?  Just think ... you might even make a convert!

Date: 2006/05/04 15:26:49, Link
Author: afdave
Quote
Beating up a YECer? Fun? Not much sport really.
Mmmm ... proud words!  Hope you can keep it up for the long haul :-)

Date: 2006/05/04 15:32:38, Link
Author: afdave
Quote
Hey, a thread with an interesting discussion in it! What happened?


What happened?

... you guys finally got one over on AIG after many years of trying ...

Your welcome!

Date: 2006/05/04 17:13:25, Link
Author: afdave
Quote
Thanks for reminding us that no matter what we do, the light of reason will never penetrate your religion darkened brain. ...


Man you guys are uptight ... it was a joke!

Norm ... you succeeded in getting some good info into my 'religion darkened' brain.  The chimp thing is the best one I've heard so far.  I'm really interested in studying it more.  You guys did good today!  There ... is that better?

Go celebrate!  Send the drink bills to me!

Date: 2006/05/04 17:30:04, Link
Author: afdave
I trust them with many, many things as well.  I am not a hermit who rejects science.  I love all the research that our enormous scientific community is doing and most of what they do is not affected by my debate here.  

There is really one really big thing I resent.  And that is the idea that humans are nothing more than highly evolved animals.  This to me first of all has never been proven but many scientists speak as if it has, and secondly, history has shown what this type of belief can do in a society if it is believed by the leadership. I not only believe it is unproven, I believe it is patently false, and I believe that I can show that my assertion that mankind is no animal (in spite of our little chimp discussion today), but that he is in a different category--made in the image of the Creator God with the ability to commune with this God, is very well supported by the evidence.  

The rest of the stuff I don't care nearly so much about.

See you tomorrow!

Date: 2006/05/05 00:47:43, Link
Author: afdave
Quote
afdave, you've asserted that your view of the world and its origins is true because a) most people believe it and b) you and others are marshaling political support for it.
What I think I said was that to me it warrants investigation when half the country believes AIG and some smaller % believe in evolution.  In response to this, the consensus here was that this "half the country" aren't scientists, which I grant is a good answer.  However, the question still remains to me ...  "Are ND's really such poor marketers of their ideas that only 20% of the public is buying their story?"   I mean, they've got all the museums showing evolution, all the textbooks, all the encyclos, most of the media, etc, etc.  I draw one of two conclusions from this ... (1) either the ND's are just REALLY bad at marketing their origins ideas or, (2) their origins ideas don't make any sense and the public rejects them
Quote
Yet you agree with Behe that a two-foot stack of research, produced and challenged and confirmed over many decades, is meaningless.
It's meaningless for explaining the ORIGIN of immune system.  I'm sure its quite meaningful at explaining HOW THE IMMUNE SYSTEM WORKS.
Quote
Are scientific research and its results determined by democratic vote, or not? If not, you have no support at all. If so, who's franchised? How often would the votes take place? Who sets the ballot? Are the votes national, or statewide, or county-by-county? How would the voting affect, e.g., pharmaceutical research? If scientific research isn't voted on but scientific pedagogy is -- how would that work?
You might want to try quoting me next time so I can see how you think I am saying this.  I don't think any of this stuff.

Date: 2006/05/05 00:53:34, Link
Author: afdave
Quote
How did God do it?
I haven't a clue.  The writers of Genesis didn't either.  ND's THINK they know how it happened, but they really only have some guesses.

Date: 2006/05/05 01:19:50, Link
Author: afdave
Quote
Why do you resent the idea that you're an animal, Dave? (Would you prefer to be a plant?)  The evidence that human beings are animals (as opposed to, say, amniosperms, fungi, viruses, or archaebacteria) is so utterly overwhelming as to leave the suspicion that doubters aren't fully in possession of their senses. Not only can we tell that humans are animals, but we can tell how closely or how distantly they are related to other primates, other mammals, other amniotes, other vertebrates, other animals, other eukaryotes, etc. I'm sorry this makes you feel resentful, but I suppose that can't be helped.
Yes, I understand all this ... no ... don't care to be a plant.  I understand that our BODIES are very much like other animals ... VERY, VERY much like chimps as we are seeing on the other thread (I've got a lot more for that thread by the way), but I will be showing you that there are many fundamental differences between a chimp and a human--differences so great that when you see them, you realize it is not sensible to call a human an animal any more.  He should be called a human.  These are not physical differences.  It's matters of the mind and spirit and morality that we will be exploring.  You may not think these issues are not 'science' but they are whether you recognize it or not.
Quote
Oh, and if you're worried about the political ramifications of a belief that humans are animals—look around you and observe the political ramifications of a belief that they are not.
It is true that many awful things have been done in the name of God, Jesus Christ, Mohammed, Atheism, etc., but I believe (don't know if I will get to show this here--we're trying to focus on the God/human thing) that all the wonderful blessings of Western Civilization all ultimately boil down to one man of history--Jesus of Nazareth.

Quote
So, Dave, your only gripe is really with common descent, from ape to man? That's it? That's all? Then why all this other useless noise and antics? Lets focus on the chimp/human thing then and ignore the rest of the BS.
You'll notice my first hypothesis points focus on God and mankind.  If you want to tune me out after the first two points are done, OK by me.

Date: 2006/05/05 01:23:26, Link
Author: afdave
Quote
Dave, are you going to read up on the Vitamin C thing or not? If so, check some other sources too, not just AiG BS.
Sure.  What is it exactly that I am looking for?

Date: 2006/05/05 03:59:19, Link
Author: afdave
OK, back to my evidence ...

Here's Point 1 again.

1. There is a God -- My hypothesis proposes that there is a Super Intelligent, Incredibly Powerful Being -- I choose to call him God -- who has knowledge of scientific laws far more advanced than anything ever discovered by 21st Century humans.  These scientific laws are so powerful that this Being can literally "speak" material things into existence and destroy things with a simple command.  This Being lives "outside of time" and can view what we call "the future" and "the past" with equal ease.

I have already given evidence for the existence of an Intelligent Entity of some sort.  The two lines of evidence given so far are (1) Cosmic Fine Tuning and (2) Biological Machines.  To me this says loud and clear ... "Someone purposely set the 'dials' in the 'universe control room'" and "Someone is a fantastically brilliant Engineer."  Obviously, that's ALL these two lines of evidence suggest.  They say nothing about the Bible or genetics or morality or any of the other myriad issues that I am interested in.  But to me they do speak very loudly to the two statements above.  Some here say that this is not evidence and I would have to ask specifically WHY is this not evidence?  

Some ask "What do you mean by Cosmic Fine Tuning?" Well to quote one of your favorite resources over at TalkOrigins ...
Quote
In recent years, creationist theologians, and even a few physicists, have heavily promoted what they claim is a remarkable fine-tuning of the basic laws and constants of physics, without which life as we know it would never have developed (Barrow, 1986; Rolston III). If the universe had appeared with slight variations in the strengths of the fundamental forces or the masses of elementary particles, that universe would be pure hydrogen at one extreme, or pure helium at the other. Neither would have allowed for the eventual production of heavy elements, such as carbon, necessary for life. Similarly, if gravity had not been many orders of magnitude weaker than electromagnetism, stars would not have lived long enough to produce the elements of life. Long before they could fabricate heavy chemical elements, stars would have collapsed. Only the fact that the gravitational force was forty orders of magnitude weaker prevented this from happening. In a calculation similar to Hoyle's, mathematician Roger Penrose has estimated that the probability of a universe with our particular set of physical properties is one part in 1010123 (Penrose 1989: 343). However, neither Penrose nor anyone else can say how many of the other possible universes formed with different properties could still have lead to some form of life. If it is half, then the probability for life is fifty percent. [url="http://www.talkorigins.org/faqs/cosmo.html"]

Notice here that this TalkOrigins writer does not refute any claims of these physicists regarding THIS universe.  All he is able to do is point out that there MAY BE other universes.  And this nicely illustrates my point about the inconsistency of scientists such as some of you ... namely that you engage in 'wild speculation' about multiple universes with no evidence that there may be other universes.  Then you accuse theists of engaging in 'wild speculation' about our proposed 'God' character.  We are BOTH talking about things that we cannot observe and that are even difficult to imagine, yet the theistic scientists are pushed away with the lame argument that they are somehow less scientific that the Multiple Universe Speculators (MUS's).  Now of course we theists would not push away the MUS's as we ouselves are pushed away.  It is quite permissible for them to propose anything they want ... the real question is "How reasonable is their hypothesis?" to which Richard Swinburne, John Leslie, William Lane Craig and Robin Collins have given a formidable answer.  In my opinion, they have shown the superiority of the Theistic Design Hypothesis.  More about that here [url="http://www.arn.org/docs/meyer/sm_returnofgod.pdf"].  If anyone would like to argue this, I am happy to dive into it in more detail. (looked hard on TO for a refutation ... couldn't find one)

Some also ask "How do biological machines point to a 'God'?" ...  Well again, I have not yet given enough evidence to say that it is 'God' as described in the Bible, but it certainly does seem to indicate that there at least was a Designer of some sort.  Richard Dawkins spends an entire chapter on bat echolation in The Blind Watchmaker and then says
Quote
I hope the reader is as awestruck as I am, and as William Paley would have been, by these bat stories.  My aim has been in one respect identical to Paley's aim.  I do not want the reader to underestimate the prodigious works of nature and the problems we face explaining them. (p. 37)
then he says
Quote
We have seen that living things are too improbable and too beautifully 'designed' to have come into existence by chance. (p. 43)
Thank you Richard Dawkins.  Case closed.  It's been great debating all of you.  Now can we move on to the IMPLICATIONS of the existence of a Designer?  Just kidding ... I know you are not yet convinced, but I hope this is at least a good start for you.  I'm pretty sure you don't want me to repeat the Denton and Behe stuff which is why I quoted one of your own.  Here's one more nice tidbit on Molecular Machines from a non-YEC source ... Bruce Alberts, President of the National Academy of Sciences, introduced this issue with an article entitled, The Cell as a Collection of Protein Machines (pointed out by Meyer ... see link above).  In his article, Alberts admits that
Quote
We have always underestimated cells . . . . The entire cell can be viewed as afactory that contains an elaborate network of interlocking assembly lines, each of which is composed of a set of large protein machines . . . Why do we call the large protein assemblies that underlie cell function protein machines? Precisely because, like machines invented by humans to deal efficiently with the macroscopic world these protein assemblies contain highly coordinated moving parts (Alberts, Bruce. 1998. The Cell as a Collection of Protein Machines: Preparing the NextGeneration of Molecular Biologists. Cell 92 (8 February): 291-94).
Alberts notes that molecular machines strongly resemble machines designed by human engineers, although as an orthodox neo-Darwinist he denies any role for actual, as opposed to apparent, design in the origin of these systems.

Say what you want about Behe and his wisdom in court (and I probably agree), but in my opinion, Behe has done an excellent job of pointing out the complete absence of any gradualistic explanations for the origin of the systems and motors he discusses.

Before we field questions, let's touch on the last two issues in Point 1.  I said
Quote
this Being can literally "speak" material things into existence and destroy things with a simple command.  This Being lives "outside of time" and can view what we call "the future" and "the past" with equal ease.  
What in the world could I possibly have as evidence for this?  Well, this is obviously a bold statement, but consider Meyer's study of "The Big Bang and General Relativity."  I searched TalkOrigins for a refutation of Meyer's "God Hypothesis" article as well as the "Index to Creationist Claims" for a refutation of the particular section I am about to quote and found none.    I Googled "meyer god hypothesis refutation" which yielded a seemingly unrelated Panda's Thumb article. So maybe you all can point me to some of those if they exist somewhere.  Here's the Meyer quote in full.  I give it IN FULL because I want all here to READ IT IN FULL.  I have, probably 3 times now and it makes a lot of sense to me ...
Quote
THE BIG BANG AND GENERAL RELATIVITY
During the twentieth century, a quiet but remarkable shift has occurred in
science. Evidence from cosmology, physics, and biology now tells a very
different story than did the science of the late nineteenth century. Evidence from
cosmology now supports a finite, not an infinite universe, while evidence from
physics and biology has reopened the question of design.
In 1915-16, Albert Einstein shocked the scientific world with his theory of
general relativity (Chaisson & McMillan 1993: 604-5). Though Einstein s theory
challenged Newton s theory of gravity in many important respects, it also implied
(as did Newton s) that the universe could not be static, but instead was
simultaneously expanding and decelerating. According to relativity theory,
massive bodies alter the curvature of space so as to draw nearby objects to them.
Einstein s conception of gravity implied that all material bodies would congeal
unless the effects of gravitation were continually counteracted by the expansion of
space itself (Eddington 1930). Einstein s theory thus implied an expanding, not a
static, universe.
Einstein disliked this idea, in part for philosophical reasons. An actively
expanding universe implied a beginning to the expansion, and thus, to the
universe. As the Russian physicist Alexander Friedmann (1922: 377-86) showed,
general relativity implied that, in the words of Stephen Hawking, at some time in
the past (between ten and twenty thousand million years ago) the distance
between neighboring galaxies must have been zero (1988: 46). Relativity theory
suggested a universe of finite duration racing outward from an initial beginning in
the distant past. For Einstein, however, a definite beginning to the universe
seemed so counterintuitive that he introduced an arbitrary factor in his theory to
eliminate the implication. In 1917, he postulated a repulsive force, expressed by
his cosmological constant, of precisely the magnitude necessary to counteract
the expansion that his theory implied.1 Like Newton, Einstein inadvertenly
concealed an important cosmological reality implicit in his theory.
Yet the heavens would soon talk back. In the 1920s-30s, Edwin Hubble, a
young lawyer-turned-astronomer, made a series of observations that shocked even
Einstein. While working at the Mt. Wilson Observatory in Southern California,
Hubble discovered for the first time that our Milky Way galaxy is but one of
many galaxies spread throughout the universe. More important, he discovered that
the galaxies beyond the Milky Way are rapidly receding from ours. Hubble
noticed that the light from these distant galaxies was shifted toward the red-end of
the electromagnetic spectrum. This red-shift suggested recessional movement,
for the same reason the so-called Doppler Effect that a train whistle drops in
pitch as a train moves away from a stationary observer. Hubble also discovered
that the rate at which these other galaxies retreat from ours is directly related to
their distance from us just as if the universe were undergoing a spherical
expansion in all directions from a singular explosive beginning the big bang
(1929: 168-73).
During the remainder of the twentieth century, physicists and cosmologists
formulated several alternatives to the Big Bang theory that preserved an infinite
universe. Some of these cosmological models were formulated for explicitly
philosophical reasons. For example, in the late 1940s, Fred Hoyle, Thomas Gold,
and Hermann Bondi proposed the steady state model to explain galactic
recession without invoking the objectionable notion of a beginning. According to
their theory, as the universe expands new matter is generated spontaneously in the
space between expanding galaxies. On this view, our galaxy is composed of
matter that spontaneously popped into existence between other galaxies, which in
turn came out of the empty space between other galaxies, and so on (Bondi &
Gold 1948; Hoyle 1948). Thus, the steady state theory denied the need to
postulate a singular beginning, and reaffirmed an infinite universe without
beginning or end.
By the mid-1960s, however, Hoyle s theory had run aground as the result of
a discovery made by two employees of Bell Telephone Laboratories in New
Jersey. According to the steady state model, the density of the universe must
always remain constant, hence the creation of new matter as the universe expands.
Yet in 1965, the Bell Lab researchers, Arno Penzias and Robert Wilson, found
what physicists believed to be the radiation left over from the universe s initial
hot, high-density state (1965: 419-21). The discovery of this cosmic background
radiation, at roughly 2.7 degrees Kelvin equivalent, proved decisive. Physicist
George Gamow had predicted its existence as a consequence of the Big Bang
(1946: 572-73). Yet advocates of the steady state acknowledged that, given their
model, such radiation should not exist. The steady state theory also implied that
galaxies should have radically different ages, but advances in observational
astronomy have revealed that galactic ages cluster narrowly in the middle-age
range. By the 1970s, even Bondi, Gold, and Hoyle had abandoned their theory
(Kragh 1993: 403).
Following the demise of the steady state model, the oscillating universe
model arose as an alternative to a finite universe. Advocates of this model
envisioned a universe that would expand, gradually decelerate, shrink back under
the force of its own gravitation, and then, by some unknown mechanism, reinitiate
its expansion, on and on, ad infinitum. But, as physicist Alan Guth
showed, our knowledge of entropy suggests that the energy available to do the
work would decrease with each successive cycle (Guth & Sher 1983: 505-7).
Thus, presumably the universe would have reached a nullifying equilibrium long
ago if it had indeed existed for an infinite amount of time. Further, recent
measurements suggest that the universe has only a fraction about one-fifth of
the mass required to create a gravitational contraction in the first place (Peebles
1993: 475-83; Coles & Ellis 1994: 609-13; Sawyer 1992: A5; Ross 1993: 58).
Prior to the formulation of the oscillating universe theory, three
astrophysicists, Hawking, George Ellis, and Roger Penrose, published a series of
papers that explicated the implications of Einstein s theory of general relativity
for space and time as well as matter and energy (Hawking & Penrose 1970).
Previously, physicists like Friedmann showed that the density of the universe
would approach an infinite value as one extrapolated the state of the universe
back in time. In a series of papers written between 1966-70, Hawking and his
colleagues showed that as one extrapolated back in time the curvature of space
also approached infinity. But an infinitely curved space corresponds to a radius
(within a sphere, for example) of zero and thus to no spatial volume. Further,
since in general relativity space and time are inextricably linked, the absence of
space implies the absence of time. Moreover, neither matter nor energy can exist
in the absence of space. Thus, Hawking s result suggested that general relativity
implies that the universe sprang into existence a finite time ago from literally
nothing, at least nothing physical. In brief, general relativity implies an absolute
beginning of time, before which neither time and space, nor matter and energy,
would have existed.

The space-time theorem of general relativity was, of course, conditional. It
stated that, if general relativity obtains for the universe, then space and time
themselves must have originated in the same initial explosion that created matter
and energy. In a series of experiments, beginning just two years after Einstein
published his results and continuing on to the present, the probable error of
general relativity (estimated quantitatively) has shrunk from 10 to 1 to .05
percent, to a confirmation out to the fifth decimal place. Increasingly accurate
tests conducted by NASA, such as the hydrogen maser detector carried by a
NASA rocket in 1980 and 1994, have continued to shrink the probable error
associated with the theory (Ross 1993: 66-67; Vessor 1980: 2081-84). Thus,
general relativity now stands as one of the best confirmed theories of modern
science. Yet its philosophical implications, and those of the Big Bang theory, are
staggering. Taken jointly, general relativity and the Big Bang theory provide a
scientific description of what Christian theologians have long described in
doctrinal terms as creatio ex nihilo Creation out of nothing (again, nothing
physical). These theories place a heavy demand on any proposed causal
explanation of the universe, since the cause of the beginning of the universe must
transcend time, space, matter, and energy.
[url="http://www.arn.org/docs/meyer/sm_returnofgod.pdf"]


Now admittedly, this study does not yet fully support my hypothesis points of "God  speaking things into existence" and "God living outside of time, seeing the past and future with equal ease."  But you have to admit it is intriguing and warrants further study.  Meyer's last paragraph (bold) is stunning to me and argues strongly for AT LEAST THE POSSIBILITY of a 'God' who can 'speak' things into existence and who JUST MIGHT in fact 'live outside of time' as the Bible asserts.  

OK.  That's enough for now.  I have now given you much of what I consider to be excellent evidence for a "Designer of the Universe" and a "Designer of Living Systems" and at least preliminary evidence for believing the long standing assertion of theists that "God Transcends Space and Time."  As we move ahead, I will show why I believe there is much evidence that this "Universe Designer" and "Living Systems Designer" are in fact One Person and that there is good reason to believe that this One Person does in fact 'dwell outside of space and time.'

I welcome your intelligent comments.  I qualify comments with the modifier 'intelligent' because I have now pretty much heard everything un-intelligent that there is to hear including but not limited to Glen Davidson's detailed and authoritative "Psychoanalysis of AF Dave" (thankyou, Glen ... I have to pay $300/hr for those here in Kansas City), Aftershave's continual attempts to supposedly "Look out for a poor-deluded fellow EE and help him avoid 'getting his ass handed to him'".  Some people's criticisms have in fact been well founded and I have acknowledged them.  The latest, of course is AIG's reference to the Chimp-Human Chromosome issue and my acceptance of it.  Again, a good criticism and I plan on confronting AIG about it (I have a contact who claims they know Ken Ham personally ... we will see what happens).  Of course, if you WANT to keep making un-intelligent criticisms, that's OK,  but you could always start another thread for that, and I question what such inane comments profit you.  But again, who am I to stop you?

Note that I have left of the A1, B1 stuff.  I assume by now that everyone at least UNDERSTANDS my argumentation framework--whether they agree with it or not, so it is not necessary to keep repeating it.

Date: 2006/05/05 05:03:17, Link
Author: afdave
Quote
FYI, quote mining is probably the single best way to demonstrate your own dishonesty.
[quote]
We have seen that living things are too improbable and too beautifully 'designed' to have come into existence by chance. How, then, did they come into existence? The answer, Darwin's answer, is by gradual, step- by-step transformations from simple beginnings, from primordial entities sufficiently simple to have come into existence by chance. Each successive change in the gradual evolutionary process was simple enough, relative to its predecessor, to have arisen by chance. But the whole sequence of cumulative steps constitutes anything but a chance process, when you consider the complexity of the final end-product relative to the original starting point. The cumulative process is directed by nonrandom survival. The purpose of this chapter is to demonstrate the power of this cumulative selection as a fundamentally nonrandom process.


Someday you'll regret having lied to your children about all of this. [/quote]

I own the book ... I have heard you that you don't accept 'lifts' from AIG, so you didn't get any this time.  I typed the quotes from Dawkins myself.

It's not dishonest to quote the pieces I did because the part I was wanting to point was that Richard Dawkins himself at least ADMITS that it all looks designed, which my quotes illustrate nicely.  Of course it is common knowledge that Dawkins rejects ACTUAL design ... I think that's pretty obvious from the title of his book, don't you?

As for my kids, they have free access to this book and they understand both Dawkins and MY position well. Come on, guys, there's no deception going on here.

Now if we are going to get preachy about quote mining, let's talk about some other quote mining criminals ... let's look at Faid's ... he lifted this from me
Quote
(afdave @ May 05 2006,08:59)
[Quote ]
We have seen that living things are too improbable and too beautifully 'designed' to have come into existence by chance. (p. 43)

Thank you Richard Dawkins.  Case closed.  It's been great debating all of you. [/quote]

but forgot to include the last part ...
Quote
Thank you Richard Dawkins.  Case closed.  It's been great debating all of you.  Now can we move on to the IMPLICATIONS of the existence of a Designer?  Just kidding ...


I was joking because I KNEW that Dawkins (and you) don't accept this as ACTUAL design ... i.e. "It LOOKS like a duck, WALKS like a duck, QUACKS like a duck, but let me spend the next EIGHT CHAPTERS trying to convince you that it's NOT a duck **cough** (isn't that what this debate is about in the first place?)

OK.  So now that we have another ROE question settled, are there any substantive arguments against my case?

Date: 2006/05/05 05:20:43, Link
Author: afdave
Quote
And to AFDave: keep in mind that AiG has not simply been shown to be wrong in this instance. We didn't "get one over on AiG once in many years".


Tom, thanks.  But I was kidding.  I do realize what you are saying and I will take AIG with a grain of salt and I know they have been wrong before, and I plan on confronting them with this when I have been completely educated on the topic myself.  

And I hope no one thinks that I am trying here to demonstrate my superior biological knowledge by slinging AIG quotes around, because obviously I have very little.  I was simply showing all of you an assertion made by them and I wanted to hear your side.

And I am really enjoying the dialog here ... I am learning a lot about a process that is MOST fascinating to me from people who evidently know a lot about it.

I am wondering about what Alan Fox meant by this ...
Quote
Oooh, I think I see a problem. the codons that alternate would have to be of the same number of nucleotides or master/complement will not work.


Maybe it will become clear as the dialog continues.  I will also look at your links ... thanks!

Date: 2006/05/05 05:27:10, Link
Author: afdave
Another layman question ... what's the meaning of 5' and 3' ... what do the numbers designate and what do the single quote marks indicate?

Date: 2006/05/05 05:39:20, Link
Author: afdave
Quote
When you knew, in fact, that this misquote does not support "design" in any way, and in fact simply argues against random assembly of life in its present complexity, ie: the "tornado in a junkyard" example(which is something none of us believes, anyway).

I mean seriously, Dave.  


Again, let me say VERY CLEARLY.  I quoted Richard Dawkins to illustrate to me a FASCINATING phenomenon with this man ...

Here is a man who everyone know DOES NOT accept design, yet he in effect says, "It LOOKS like a duck, WALKS like a duck, QUACKS like a duck, but let me spend the next EIGHT CHAPTERS trying to convince you that it's NOT a duck **cough** (isn't that what this debate is about in the first place?)

Thank you for giving me the opportunity to once again highlight this embarassing paradox of one of science's most brilliant minds.

I'll do my darndest not to quotemine and I trust you will do the same.  Now, to quote someone on this thread, "Can we quit arguing about rules and get on with it?"  

Do you have any substantive refutation of my logic?

Date: 2006/05/05 06:24:26, Link
Author: afdave
Quote
As I said before, you need to provide evidence that biological systems are more likely to be the work of a designer than biological evolution without using and argument from ignorace or analogy. No-one will accept your point if you just assume this to be the case.
True.  But this is my point exactly.  Science attempts to explain things in terms of current understanding.  Then as new understanding comes, science modifies its descriptions.  This is what I do.  I see bio machines.  I know how non-bio machines come into existence, so I have nothing better from my experience to explain the bio-machines than "Bio-Machine Design."  I would be happy to adopt "Evo Did It" if I had ever seen an instance of this happening, but so far I have not.  When I ask for examples of, for instance, a fruit-fly "evolving" into a house fly type insect, I am told that this type of change would take many millions of years, so "we cannot possibly observe the process."  This would leave me in the uncomfortable position of trying to explain a process that I can only wildly speculate about, but have never even seen, even by analogy.  So to me, my ANALOGY, while it may be weak, appears to be far stronger than your COMPLETE LACK OF AN ANALOGY.  In other words ... at least I have SOMETHING ... I have my analogy.  You have NOTHING that I can see.  Oh, yes ... I know ... moths changing color and finch beaks, etc.  But this is well understood already WITHIN the Creationist model and has NOTHING AT ALL to say about "Feet to Flippers" type Evolution.  Oh and I know .. the fossil record.  But again, we have a handful of equivocal examples of "transitional forms."

I'm happy to try to see things your way, but so far, no one has walked me through it well enough to be convincing.

Does this make sense?

Date: 2006/05/05 06:32:28, Link
Author: afdave
Quote
We just don't care about all of the blather that you gather up to defend your prejudices, trying to pass them off as science.
Would you care to show me specifically WHY it's blather, since you obviously are smarter than me?  Or will you keep filling my thread with psycho-analysis?

Date: 2006/05/05 06:37:34, Link
Author: afdave
AF Dave said ...
Quote
Would you care to show me specifically WHY it's blather, since you obviously are smarter than me?  Or will you keep filling my thread with psycho-analysis?


One more thing, Glen.  Talk really slow and refute my points one by one in simple layman's terms so that my "religion darkened brain" can understand.

Thanks!

Date: 2006/05/05 06:50:47, Link
Author: afdave
Quote
why don't you pick up a basic biology textbook sometime and learn these things for yourself?  


Thanks for the tip but Google's faster.

Date: 2006/05/05 07:42:37, Link
Author: afdave
Quote
Since then, biologists have proposed gradual, stepwise pathways for all six of those systems.
Is there an online source you could point me to so that I can see this?

Date: 2006/05/05 08:28:03, Link
Author: afdave
Thanks.  When is uni-directional reading important?  And when is it not?  I think I saw someone say that it is important for some things.  I'm trying to understand where exactly the AIG author went wrong. (other than the jokes about they woke up that morning, they went Creo, etc.)  :-)

Date: 2006/05/05 18:18:18, Link
Author: afdave
Quote
"I've never understood why airplanes don't need to flap their wings. Could you teach me how to fly a jet next week?"
I'm not asking anyone to teach me to BE a molecular biologist.  I'm just trying to find the truth about certain biological realities by relying on supposed experts on both sides of the controversy.  I think people on both sides are necessarily a little biased toward their own viewpoint, but I trust that each strives for the truth as best they know how.  I enjoy hearing from you guys, and up until this little incident, I have found AIG to be reliable.  One would think a medical doctor at AIG would be a reliable source, and in all fairness to him, he may be reliable in many areas.  And I'm not ready to call him a liar until I hear his side of the story.  We have seen that Dr. LeJeune was mistaken about Down's syndrome as well--it happens.

Thanks 'incorygible' for the detailed explanation.  I would be interested to hear Alan Fox and Jeannot's comments on incorygible's explanation and also would like to know what your specialties are.

Thanks!

Date: 2006/05/06 04:55:28, Link
Author: afdave
Quote
If you learned that a car company puts all their money in advertising and publicity, to show how cool their cars are, and NOTHING in research to make them better and safer -in fact, they don't have an R&D department at all- would you buy a car from them?
No, I would not buy the car.  And I do realize that ICR has a limited research department and I think AIG and DI probably have none at all ... doesn't matter because the fact is that THE DATA IS THE DATA, regardless of the source.  Creationists really don't care a hoot about the beliefs of the guy digging up the fossil or mapping the genome or what have you.  What we are interested in is the INTERPRETATION of the data.  And we do realize that you need qualified experts in many fields to be able to INTELLIGENTLY analyze the data.  At this point in my study of the whole origins debate, it is too early for me to be able to say with strong assurance that ICR and AIG and DI have well qualified experts in many fields.  I have assumed they did in past years without drilling into them in great detail.  Now that I have begun this very detailed investigation, I have found one major goof (or lie, not sure which yet) by Carl Wieland (the chimp chromosome thing).  If I find a lot of these types of wrong information, obviously I will begin to question the reliability of the whole organization, question their motives, etc.  This has not yet occurred, but I'm sure you will help me on this quest.  That is one reason I am here and not debating over at DI (as someone has suggested).

AF Dave said ...
Quote
It's meaningless for explaining the ORIGIN of immune system.  I'm sure its quite meaningful at explaining HOW THE IMMUNE SYSTEM WORKS.

Faid responded ...
Quote
Um Dave, I dunno what AIG says, but the research presented in the trial was about the evolution of the immune system.

So let us look at the relevant testimony because this is very important that there be no misunderstanding ...
Quote
Q. We'll get back to that. Now, these articles rebut your assertion that scientific literature has no answers on the origin of the vertebrate immune system?
A. No, they certainly do not. My answer, or my argument is that the literature has no detailed rigorous explanations for how complex biochemical systems could arise by a random mutation and natural selection and these articles do not address that.
Q. So these are not good enough?
A. They're wonderful articles. They're very interesting. They simply just don't address the question that I pose.
Q. And these are not the only articles on the evolution of vertebrate immune system?
A. There are many articles.
Q. Okay. So there's at least fifty more articles discussing the evolution of the immune system?
A. And midpoint I am, I certainly haven't had time to look through these fifty articles, but I still am unaware of any that address my point that the immune system could arise or that present in a detailed rigorous fashion a scenario for the evolution by random mutation and natural selection of the immune system.
Q. Is that your position today that these articles aren't good enough, you need to see a step-by-step description?
A. These articles are excellent articles I assume. However, they do not address the question that I am posing. So it's not that they aren't good enough. It's simply that they are addressed to a different subject.
Q. And I'm correct when I asked you, you would need to see a step-by-step description of how the immune system, vertebrate immune system developed?
A. Not only would I need a step-by-step, mutation by mutation analysis, I would also want to see relevant information such as what is the population size of the organism in which these mutations are occurring, what is the selective value for the mutation, are there any detrimental effects of the mutation, and many other such questions.
Q. And you haven't undertaken to try and figure out those?
A. I am not confident that the immune system arose through Darwinian processes, and so I do not think that such a study would be fruitful.
Q. Origin and Evolution of the Vertebrate Immune System, by Pasquier. Evolution and Vertebrate Immunity, by Kelso. The Primordial Vrm System and the Evolution of Vertebrate Immunity, by Stewart. The Phylogenesis of Immune Functions, by Warr. The Evolutionary Mechanisms of Defense Reactions, by Vetvicka. Immunity and Evolution, Marchalonias. Immunology of Animals, by Vetvicka. You need some room here. Can you confirm these are books about the evolution of the immune system?
A. Most of them have evolution or related words in the title, so I can confirm that, but what I strongly doubt is that any of these address the question in a rigorous detailed fashion of how the immune system or irreducibly complex components of it could have arisen by random mutation and natural selection.
Q. And the fifty-eight articles, some yes, some no?
A. Well, the nice thing about science is that often times when you read the latest articles, or a sampling of the latest articles, they certainly include earlier results. So you get up to speed pretty quickly. You don't have to go back and read every article on a particular topic for the last fifty years or so.
Q. And you conclude from them that certain structures are irreducibly complex that could not have evolved through natural selection, and therefore are intelligently designed?
A. I conclude from them that we see very detailed molecular machinery in the cell, that it strongly looks like a purposeful arrangement of parts, that in fact a purposeful arrangement of parts is a hallmark of intelligent design. I surveyed the literature and I see no Darwinian explanations for such things. And when one applies one's own reasoning to see how such things would be addressed within a Darwinian framework it's very difficult to see how they would, and so one concludes that one explanation, Darwinian processes, doesn't seem to have a good answer, but that another explanation, intelligent design, does seem to fit better.

After reading through this, I think my statement above is valid, but could be stronger and more clear, so let me add to it.

The stack of 50+ books are meaningless for explaining the ORIGIN of immune system.  I'm sure they quite meaningful at explaining how the immune system works and I'm sure they are quite full of SINCERE ATTEMPTS to explain the origin of the immune system.

There ... is that better?  If you read the testimony above, this is what Behe is saying and I strongly agree with him.  Again, let's reiterate what Behe (and I) (and all Creationists) are looking for ...

A. Not only would I need a step-by-step, mutation by mutation analysis, I would also want to see relevant information such as what is the population size of the organism in which these mutations are occurring, what is the selective value for the mutation, are there any detrimental effects of the mutation, and many other such questions.

Notice also that Behe (and I) think that spending one's time to search for this is, to put it politely as Behe did, UNFRUITFUL.  I can think of many other, less polite adjectives to describe the wisdom of attempting such a search, but I'm trying to practice what I preach and be nice, so I will refrain, but you get the idea.

Quote
PS. the question mark in "ID?Creos" was supposed to be a slash, but I like it better that way. "ID? Nah, Creos".
Cute.  And I happen to agree with you on this point.  And I do have my own version:  Evos? Nah, Flat-earthers. :-) Just kidding here.  I know everyone here is very intelligent even though I disagree with some of your interpretations.

Renier--  Thanks for the analysis of the Vitamin C issue.  You are correct that this requires careful analysis.  I will be taking some time to do just that starting with what you have written.
Quote
The reason, Dave is that most people are stupid.  Yes, that's right.  Stupid.
I would agree that the advent of government involvement in education in Western society has, in fact been a colossal failure.    I might take this opportunity to point out, though, that even with private schools, self study, excellent colleges and the like, it appears that much learning does not always yield smarts, unfortunately.  Or maybe the better term would be wisdom instead of smarts. There have been many people down through history who had much learning, but did incredibly unwise things or made incredibly unwise statements--  Galileo's opponents being a case in point. I believe--but have not proven yet to my satisfaction (it's still a hypothesis)--that this exact situation exists today with Neo-Darwinists.  They have much learning and know many facts and possess much knowledge, but in my opinion are making incredibly unwise statements when they assert that "flippers came from feet" and "we see life because of abiogenesis millions of years ago", etc.  This by itself is very unwise, but then to go further and not only assert things which don't make sense to a lot of people, but also vilify others who try to propose alternatives that they honestly feel DO make sense, is INCREDIBLY UNWISE to me. In my opinion, there are hordes of Neo-Darwinists sitting on a very thin branch, with the "saw" of scientific evidence slowly cutting through it, the ID/Creo people are offering an escape ladder, and the ND's are spitting on them.  


RICHARD DAWKINS MISIDENTIFIES "DUCKS"

I will repeat my quote of Richard Dawkins because (a) I am NOT "quote mining" (maybe I should just quote the whole chapter?) and (b) it is worth repeating because it drives home my point so well.  Dawkins spends an entire chapter on bat echolation in The Blind Watchmaker and then says
Quote
 
I hope the reader is as awestruck as I am, and as William Paley would have been, by these bat stories.  My aim has been in one respect identical to Paley's aim.  I do not want the reader to underestimate the prodigious works of nature and the problems we face explaining them. (p. 37)

then he says
Quote

We have seen that living things are too improbable and too beautifully 'designed' to have come into existence by chance. (p. 43)

This is HUGE and I do not want my readers to miss this. Here is one of "world's most brilliant minds) (according to some vote) spending AN ENTIRE CHAPTER  ON A SINGLE WONDER OF NATURE -- Bat Echolocation and admitting that he is "awestruck" and does not underestimate the "prodigious work of nature" and "the problems we face explaining them."  After standing in awe of this stuff, he then spends the next 9 chapters telling us why this is not ACTUAL design, but APPARENT DESIGN ... i.e. "It LOOKS like a duck, WALKS like a duck, QUACKS like a duck, but let me spend the next NINE CHAPTERS trying to convince you that it's NOT a duck **cough**   **retch**   **die**

This is HUGE, folks, and we are just getting started.  I will make this prediciton ... there will come a day soon when the name of Darwin and all his disciples, like Richard Dawkins will be relegated to the ashheap of scientists whose theories were wrong and whose name people remember, not for the good they did, but for the prodigious blunder they made.

Glen Davidson ...
Quote
We're herd animals, and we are intelligent herd animals for the most part.
Afdave **cough** (I meant to say the Neo-Darwinist) illustrates this fact over and over again.


Quote
Look at Afdave's argument.  Clearly it is fallacious by any standard, but it is also carefully drawn (though it was hardly invented by Afdave) to avoid the fact that the only explanation for current and fossil forms of life that has managed to cross borders, religions, ethnic groups, politics, and intellectual inheritances, is evolutionary theory.  Russian atheists, American Catholics and mainline Protestants, scientists, intellectuals, Japanese Shintoists (initially, anyhow, though I don't know if Shinto holds up well alongside modern science), Muslim thinkers, Hindus, Jainists, and traditional religionists like native Americans, have all been able to comprehend and accept the evidence for evolution.
Herd thought?[YES]
You guessed it, Glen.  My thought exactly. (Attention Quote Mine Police:  Glen really said "No" -- I'm putting words in his mouth)
Quote
Evolutionary theory is extraordinarily successful by the standards of any startup of a new religion.
Yes.  And so was Islam.  And your point is?  Possibly that this means AF Dave should accept it as true?  I see.
Quote
The only universally-acceptable origins-of-life idea is evolutionary theory
never mind the small detail that no one has the slightest idea how it arose.  Francis Crick was so perplexed that he proposed "Panspermia".  

Chris Hyland ...
Quote
Biological systems only trivially appear to be designed.
Trivial?  How does this mesh with the fact that Richard Dawkins wrote an ENTIRE BOOK trying to tell people that this stuff IS NOT designed.  Answer: A LOT of people think this stuff at least APPEARS designed.  To me, this is in no way trivial.

Glen Davidson ...
Quote
Well, you're too stupid and ignorant even to respond to my authoritative analysis, moron ... If you ever can make an intelligent remark, please do so, cretin ... There is virtually no chance that you will ever be anything except a stupid and ignorant little ape, Dave.  The biggest reason of all is that you only sneer at expertise of all kinds, while clinging to your tiny collection of knowledge as if it were Eternal Truth, as do all bigots.
Wow Glen, if words could kill! Have you found this debating technique to be effective for you?
Quote
However, real scientists do not care a fig about Dawkins' incorrect notions about life "appearing designed", for on the face of it, life does not appear designed.  I will grant that it may appear "miraculous" or "spiritual", depending on definitions and contexts, but it does not appear designed.
Are you telling me that Richard Dawkins is not a real scientist?
Quote
The most truly embarrassing thing is that religious apologists like Afdave think that life looks designed like machines.
Why don't you call Bruce Alberts, President of the National Academy of Sciences and tell him he is an embarrasment to you.  Here is his quote again ...
Quote
We have always underestimated cells . . . . The entire cell can be viewed as a factory that contains an elaborate network of interlocking assembly lines, each of which is composed of a set of large protein machines . . . Why do we call the large protein assemblies that underlie cell function protein [ba]machines?[/b] Precisely because, like machines invented by humans to deal efficiently with the macroscopic world these protein assemblies contain highly coordinated moving parts (Alberts, Bruce. 1998. The Cell as a Collection of Protein Machines: Preparing the NextGeneration of Molecular Biologists. Cell 92 (8 February): 291-94).

Quote
Do you want medical testing to be done on our relatives, the apes, or would you prefer that it be done on birds?  And can you think through the implications of why medical testing is done on monkeys and apes just prior to humans, or are you going to just drivel on in your ignorance and prejudice?
If you read what I wrote, you will see that I acknowledge that human BODIES are very similar to the apes.  I even acknowledge that Chromosome 2 in humans does in fact appear to be fused from 2 chromosomes in chimps.  But to me it is a different matter  then to say definitively that they did in fact fuse.  Also, let me reiterate what I have said before that my hypothesis regarding humans and apes is that humans have something additional, something invisible, that is very different from the apes, and that this difference is quite crucial. I will be presenting evidence for this soon.

Norm Doering ...
Quote
Meyer doesn't warrant special attention in a search term because his arguments are stolen from old and moldy arguments that were refuted before he made them. Try searching for "Big Bang Argument for the Existence of God," "Teleology," "Prime Mover."
Or maybe the reason is because no one HAS BEEN ABLE to refute him?  I searched the archive below and found nothing that refutes Meyer's "Cosmic Fine Tuning" argument.  In fact, the article from Talk Origins that I posted does not in any way attempt to refute it.  Don't you think this would be the FIRST thing they do if it could be refuted?

Talk Origins Index to Creationist Claims
CE400: Cosmology
(see also CI300: Anthropic principle)
CE401. There are too few supernova remnants for an old universe.
CE410. Physical constants are only assumed constant.
CE411. The speed of light has changed.
CE411.1. Physicists found that the speed of light was once faster.
CE412. Gravitational time dilation made distant clocks run faster.
(see also CF210: Radiometric dating assumes constant rates.)
CE420. The big bang theory is wrong.
CE421. The cosmos has an axis, contrary to big bang models.
CE425. Red shift comes from light aging, not expansion of the universe.
CE440. Where did space, time, energy, and laws of physics come from?
CE441. Explosions such as the big bang do not produce order or information.

You are going to have to better than send me off on a Google hunt if you want me to believe that "Cosmic Fine Tuning" has been refuted.  Try refuting me point by point with linked support.
Quote
Spacetime, the fabric of the universe isn't really nothing. Look up the term "Casimir effect."
I agree.  The term is used by Creationists out of convenience and the need to use SOME word.  Maybe we should say "apparent nothing."
Quote
Nothing is explained by proposing an unknown entity with unknown powers. You're explaining the known in terms  of the unknown.
Yes, actually it is ... quite well.  Remember my example of the native who has never seen an airplane  before?  He proposes an unknown (the Cessna factory) to explain the new phenomenon (the airplane) in terms THAT HE ALREADY KNOWS (canoes), hence his fairly accurate statement considering his limited observation and experience, "A brilliant sky-canoe maker must have built this!"  Would you like more examples?
Quote
Religions, at least those of Judeo-Christian family, must start with a core metaphysical assumption about mind (of an entity with will, planning, intention, foresight and understanding) being the primordial stuff and cause of the universe.
My discussion has nothing to do with religion and I do not consider myself to be religious.  I am trying to explain the phenomena in the universe by the most sensible explanations.  Religion to me is man made stuffy ritual ... robes, candles, homina-hominas and the like.  Would it surprise you to know that I don't think God is religious?  Or Jesus either?  Well ... that's my opinion.
Quote
Creation myths are teleological and naturalism undermines teleology by finding non-mind, (rules of material interaction without any mind stuff like choice, will or intention coming into play), as an explanation.
There are in fact many creation myths.  But my opinion is that there is only one true, earliest, eyewitness account from which all the myths were then derived with various levels of deletions, modifications and embellishments.  

Secondly, naturalism only undermines teleology if it explains the evidence BETTER.  It is my goal of this exercise to show you that Teleology is in fact the better, more sensible explanation.

Faid said ...
Quote
The anthropic principle is examined thoroughly in the very talkorigins page you quoted
Really?  Where?  Could you cut and paste the section?  I looked and did not find it.  Also, why would not the author have refuted the section I quoted if he thought he could have?
Quote
As for your "biological machines" argument, this has been demonstrated repeatedly to be based on loaded terms: Labelling living things "machines" to argue that they are designed, presupposes that they are designed.
I propose that the labeling is complained about only by those who have no other way to complain that their view might be questioned, i.e. they don't have anything sensible to counter with, so they have to say crazy things like "your terms are loaded."  As for my calling them machines, talk to Bruce Alberts, President of the National Academy of Sciences.  He is more of an authority than I.  Also, let me correct you ... I do not PRE-suppose design.  I PROPOSE design, then test the validity to see if it is the best among competing hypotheses.  There is a BIG difference.
Quote
With the same logic, we should argue that those round volcanic rocks were the marbles of giants, because they look like big stone marbles. Now, the reasons those rocks are round are pretty much the same (as far as the fundamental laws of physics are concerned) with the reasons marbles are made round- but that is no proof that they are, in fact, marbles -as I'm sure you agree.
I do agree.  But have ever studied the differences between marble/round rocks and biological machines?  I don't think you need to study this b/c this is obvious.  This is not a valid refutation of my argument.

Eric Murphy ...
Quote
Actually, Dave, the differences between humans and chimps, compared to e.g. the differences between humans and bacteria, are practically invisible. Humans are basically taller, balder, weaker, and smarter chimps. I fail to understand why this presents a problem for you.If you want to say there are spiritual differences between a human and chimp that amount to some sort of unbridgeable gulf, that's fine, but you're not talking about science anymore (to the extent you ever were).
The proper definition of science should include trying to explain the phenomena in the universe, where ever that may lead.  If it leads us to invisible entities, why is that a problem?  Are not quarks invisible and rather abstract and hard to define?  Ditto for multiple universes, the Casimir Effect and a host of other things?

Norm quoted someone who said ...
Quote
Since then, biologists have proposed gradual, stepwise pathways for all six of those systems. (Behe's supposedly irreducibly complex systems)
Yes. After Behe's book they tried.  But even if there were a few before, they were unconvincing attempts.  See discussion above RE: Dover testimony.  Here's an example of a failed (in my opinion) attempt.  You see if YOU think the attempt was successful.
Quote
One plausible path for the evolution of flagella goes through the following basic stages (keep in mind that this is a summary, and that each major co-option event would be followed by long periods of gradual optimization of function):

a. A passive, nonspecific pore evolves into a more specific passive pore by addition of gating protein(s). [How?  In detail please.  By magic?  By what selective pressure?  What mutation or transposition of what gene(s)?] Passive transport converts to active transport by addition of an ATPase [Ditto above questions]that couples ATP hydrolysis to improved export capability. This complex forms a primitive type-III export system.

b. The type-III export system is converted to a type-III secretion system (T3SS) by addition of outer membrane pore proteins (secretin and secretin chaperone) from the type-II secretion system. These eventually form the P- and L-rings, respectively, of modern flagella. The modern type-III secretory system forms a structure strikingly similar to the rod and ring structure of the flagellum (Hueck 1998; Blocker et al. 2003).

[How?  In detail please.  By magic?  By what selective pressure?  What mutation or transposition of what gene(s)?]

c. The T3SS secretes several proteins, one of which is an adhesin (a protein that sticks the cell to other cells or to a substrate). Polymerization of this adhesin forms a primitive pilus, an extension that gives the cell improved adhesive capability. After the evolution of the T3SS pilus, the pilus diversifies for various more specialized tasks by duplication and subfunctionalization of the pilus proteins (pilins).

[How?  In detail please.  By magic?  By what selective pressure?  What mutation or transposition of what gene(s)?]

d. An ion pump complex with another function in the cell fortuitously becomes associated with the base of the secretion system structure, converting the pilus into a primitive protoflagellum. The initial function of the protoflagellum is improved dispersal. Homologs of the motor proteins MotA and MotB are known to function in diverse prokaryotes independent of the flagellum.

[How?  In detail please.  By magic?  By what selective pressure?  What mutation or transposition of what gene(s)?]

e. The binding of a signal transduction protein to the base of the secretion system regulates the speed of rotation depending on the metabolic health of the cell. This imposes a drift toward favorable regions and away from nutrient-poor regions, such as those found in overcrowded habitats. This is the beginning of chemotactic motility.

[How?  In detail please.  By magic?  By what selective pressure?  What mutation or transposition of what gene(s)?]

f. Numerous improvements follow the origin of the crudely functioning flagellum. Notably, many of the different axial proteins (rod, hook, linkers, filament, caps) originate by duplication and subfunctionalization of pilins or the primitive flagellar axial structure. These proteins end up forming the axial protein family.


Do I make my point clear?  This is the point Behe was trying to make in the trial.   Let me repeat his statement from above ...
Quote
A. Not only would I need a step-by-step, mutation by mutation analysis, I would also want to see relevant information such as what is the population size of the organism in which these mutations are occurring, what is the selective value for the mutation, are there any detrimental effects of the mutation, and many other such questions...Q. And you haven't undertaken to try and figure out those?
A. I am not confident that the immune system arose through Darwinian processes, and so I do not think that such a study would be fruitful.


improvius quote mined me ...
Quote
There is really one really big thing I resent.  And that is the idea that humans are nothing more than highly evolved animals.
and left out the last part that said I also believe this to be a factual error.  It is true that I get somewhat emotional, but the emotion is generated BECAUSE I believe there is some great error in ND thinking.  I've notice some of this emotion going the other direction on this thread as well, have you not?  It is understandable on both sides of the debate ... we are human, not rocks, thus we have emotions.

Glen said ...
Quote
What Afdave fails to recognize in the area of origins is the importance of establishing proximate causes, of showing how one event causes another one.
What I am doing, Glen, is showing everyone why MY proposed proximate cause makes more sense than YOUR proposed proximate cause for explaining the phenomena in the universe.
Quote
But what we need for any ID hypothesis is a designer who has been shown to design items similar to organisms.
Well, I cannot show Him to you any more than you can show me a fruitfly evolving into a "housefly type insect" or a "foot becoming a flipper."
Quote
This is because animals are very different from machines, even at a cursory glance.
Yes, but the key difference is that they are SO SO SO SO much more sophisticated.  Ask Bill Gates ...
Quote
DNA is like a computer program, but far, far more advanced than any software we ve ever created (The Road Ahead,1996: 228).

Quote
What is more, we aren't even satisfied with "intelligence" as a "reason" for human-made machines and art, rather we typically appeal to psychology, evolution, and social causation to explain why and how art is made (as in all historical sciences, we can't fully explain Sumerian art, but we can explain important aspects of it).
You're kidding, right?  I will let you take this one back if you want to and I won't even bring it up again.
Quote
This brings up an important fact:  triumphant IDists would likely impede investigation into what intelligence is and why it is the way that we find it to be--even if only by suggesting that intelligence is some kind of "universal constant" or "law".  
Your implication that IDists are not progressive in science?  What about Galileo, Newton, Hooke, Brahe, Copernicus and Huygens?  They all believed in Design.  Were they anti-progressive?
Quote
IDists analogize wildly to God, but then they fail utterly to be able to identify factors, like evolution, that would constrain God's designs.
 What?  Constrain God's design?  Creationists accept Designed Adaptation that you call evolution.  Maybe I'm not following you.
Quote
but if we could not find causes of evolution in the genome/environment, we would have to abandon evolution as an explanation.
Yes. I predict this will happen soon.  
Quote
Dave doesn't like macroevolution, claiming that it has not "been seen".  Since, however, macroevolution is predicted to be produced by largely known mechanisms, therefore to produce the sorts of fossils, nested hierarchies, and genomes that we see, it is fair to say that we have observed it, since we are surrounded by it and are a part of it.
No.  You have NOT observed it. You have observed what you THINK is evidence for it, but I will show you in time why this fails.
Quote
No, we do not accept Causes that are not seen to be acting, we accept the mutations and selections of those mutations as the sort of mechanism that evolution demands and requires, both as a science of proximal causes, and as a theory peculiar to biology.
Yes.  You DO accept Causes that are not seen to be acting.  Again, no one has seen feet evolve into flippers, etc.
Quote
We have our proximate causes, then.  The IDists/creationists have no cause at all, but only an analogy that on the face of it appears flawed, and which more tellingly cannot be backed up through evidence for active proximal causes.
No.  You don't have your proximate causes, then.  You don't even have an analogy.  We at least have an analogy from our experience.  To me, this is far more scientific.
Quote
If this news turns out to be true, even the shaky foundation Meyer built his argument on is shot down:

'Cyclic universe' can explain cosmological constant
[URL=http://www.newscientistspace.com/article....ue]http

Thanks.  I'll check it out.

And with that, I'll leave you with this parting nugget from Talk Origins ...

Quote
Furthermore, we are beginning to understand the possible physical mechanisms for the appearance of matter from nothing [hmmm... seems like Creationists have said something about this before], and for organization without design.

[url="http://www.talkorigins.org/faqs/cosmo.html"]

May God bless all of you (including Glen)!  And have a great weekend!

Date: 2006/05/06 16:27:08, Link
Author: afdave
Quote
I'd also like to add, Dave (not to make you feel persecuted or anything) that you started this thread with the claim that you would provide evidence for (at minimum) three contentions:

1. The Bible is literally inerrant;
2. The earth is not billions of years old, but only thousands of years old; and
3. Evolution cannot explain the origin of species.


Eric--  Have you even read this thread at all?  Here's the first thing I said I would discuss ...

A. There is a God -- My hypothesis proposes that there is a Super Intelligent, Incredibly Powerful Being -- I choose to call him God -- who has knowledge of scientific laws far more advanced than anything ever discovered by 21st Century humans.  These scientific laws are so powerful that this Being can literally "speak" material things into existence and destroy things with a simple command.  This Being lives "outside of time" and can view what we call "the future" and "the past" with equal ease.

I don't think I even touch on the things you mention anywhere in my Hypothesis, correct me please if I am wrong.

I do believe those things, but they are not covered in what I said I was going to address.  Maybe I will cover them after this project.

Do you have any refutation of my evidence for Point 1?

Date: 2006/05/07 01:52:03, Link
Author: afdave
Thanks to Alan Fox, Jeannot, Tom Ames and Incorygible for enlightening me on this truly fascinating subject.  I do sincerely appreciate the effort you have put forth.

Apparently, we have +1 for the "Evos " and -1 for the "Yecs."  So for all of you that like to keep score, you have my hearty congratulations!  I'm looking forward to having that hard conversation with Dr. Carl Wieland from AIG about why he is a medical doctor and yet made such an elementary mistake.  I will post that result here for you all to see, as I believe in rewarding everyone fairly for honest victories, whether they agree with my worldview or not.

I do appreciate all the suggestions to "go out and get a biology book," but the fact is, I do not wish to become a biologist, or a genetic research scientist, or anything similar.  We have plenty of those, and thanks to the internet, much information is a few mouse clicks away.  Some have said that this gets you incomplete information and you should still go read a book.  

Well certainly, in some cases, you should go read a book ... all of Behe's and Denton's work, Dan Brown's novels (albeit with a shaker of salt), and David Barton  and Henry Morris titles have certainly been favorites of mine. (here come the rotten tomatoes)

But reading books don't work for everything and I will throw this advice out there for those wise enough to grab it and learn ...

All of my success in life can be traced to what you might call "Highly Focused, Targeted Learning.  Let's call it HFTL for short."

While many of my friends got MBA's and now have very stressful jobs working for someone else, I took the alternative approach and applied "HFTL" to the world of business, and as a result, retired last year at age 42.  I applied this same strategy to Marriage, Family and Parenting, which I knew nothing about when I got married, and I can tell you that today, after almost 17 years of marriage, it is hard to describe the happiness that my wife and my children bring into my life.  I have 5 natural children and they are so much fun that we are adopting a sixth. (we're stopping there though ... I do have limits).  

Now I am applying the HFTL strategy to the Creation/Evolution debate (I know ... some of you think there IS NO debate), but I think there is and I intend to sort the fact from the fiction on both sides in short order.  I understand it will take some time, but I am not about to subject myself to the laborious and inefficient process of getting an advanced degree in Genetics or such.  I think this kind of thing would serve you well if you are trying to teach or get published or get government research grants or other goals, but these are not my goals.

So I say all this to say "thanks, but no thanks" to those of you here who want to give me direction in life.  I truly believe it is the Creator God of the Christian Bible (maybe you will prove me wrong .. we'll see) who has guided my footsteps so far and I trust that He will continue to do so.   I do know what I am doing and I have clear goals.  I think if you stay with me, it will become clear to you what my goals are (actually, they are no secret ... stated clearly on my other thread).  It is also no embarrassment to me to lack knowledge in a particular area.  For those of you trying to embarrass me or demean me, you are wasting your time.  I have very thick skin earned in Air Force barrooms and the harsh realities of the business world.  I am very single-minded, passionate, and hard driving toward my goals and no amount of silly comments will deter me from what I am trying to accomplish.

What you WILL accomplish with silly comments is discrediting yourself.  I think everyone here wants to be viewed as fair-minded, balanced, rational scientists working hard for the good of humanity.  May I submit to you that if the Neo-Darwinist view of Origins is to prevail in Western Civilization and beyond, hurling stupid insults will not help it prevail.  You can hurl them if you like.  No one will stop you.  And selfishly, I could say "Go ahead and hurl insults" because it actually HELPS my cause.  But I want to give you a fair chance at promoting your view, and as a minority viewpoint holder on this forum, I can tell you that this approach does NOT help your cause.  And any of you that HAVE discredited yourself already by hurling insults, you can easily repair the damage, simply by stopping.  I don't plan on embarrassing you back or singling you out and I am happy to hear what you have to say, especially if it is substantive and sounds intelligent.

In any case, my investigations into the ape/human questions have only just begun.  Stay tuned for more on Monday!

And in the mean time, I invite you all to hop on over to my "AF Dave's Creator-God Hypothesis" thread and join the fun!  It's an interesting (for me anyway) mix of Science, Philosophy, Theology and soon Biblical Studies and who really knows where it will end up!

I'm headed for church, so I'll see you all on Monday!  May the God who you may not believe in bless you anyway!

Date: 2006/05/07 02:34:10, Link
Author: afdave
Oh ... an afterthought ... another reason to not hurl insults at me ... WE'RE CLOSELY RELATED ... don't we share something like 98.5% of our genetic info, you and I?

(OK, OK, I know ... I realize that could be spun both ways)

Date: 2006/05/07 08:47:55, Link
Author: afdave
Quote
Although the process of gnetic coding and codons and transcription and 5'-3' orientation can be unknown or forgotten to an MD (heck, I hardly remembered any of it), arguing against centric fusions and Robertsonian translocations as an impossibility can not be attributed to ignorance. It's standard textbook genetics, and highschool material

Might have been high school material for you ... I must have been sleeping in that class!  The ignorant one on centric fusions was ME, not Dr. Wieland.  Only the paragraphs starting with "Professor Jerome LeJeune, a very distinguished French cytogeneticist ..." were from him.  I should have made that clear by enclosing it.

Now I see why you think he was lying !!  I thought that was strange that you should think that.

Date: 2006/05/07 16:14:25, Link
Author: afdave
Quote
So, he says that "head to head" fusion is a biochemical impossibility. Right.

No.  He does not say that.  His mistake is this ...
Quote
Since the chromosomes are always ‘read’ in the same direction, this means that the same ‘sentence’ would be read backwards, and would make no biochemical sense!

Date: 2006/05/07 23:42:29, Link
Author: afdave
Quote
I think afdave is starting to get it.

Actually, I understood this back on page 1 when 'jstockwell' explained it.  The only piece still hanging to me was Faid thinking that Dr. Wieland is a liar.  This was due to the fact that Faid thought it was Dr. Wieland who was questioning 'stepwise fusion of chromosomes'.  This was ME that had this question, not Dr. Wieland.  Dr. Wieland's problem was that he thought there could be a 'backwards' way to join the chromosomes.  

Relevant to this, Faid (an MD himself) notes ...

Quote
Although the process of gnetic coding and codons and transcription and 5'-3' orientation can be unknown or forgotten to an MD (heck, I hardly remembered any of it)


My conclusion is that AIG made an understandable mistake in this case, but that there is no evidence of lying.

Date: 2006/05/08 01:17:40, Link
Author: afdave
Quote
Dave, Wieland says there couldn't be a "backwards" way to join the chromosomes.


???? I cannot find where he says this.

Here is what he says ...

Quote
Since the chromosomes are always ‘read’ in the same direction, this means that the same ‘sentence’ would be read backwards, and would make no biochemical sense!


He is talking about READING the Chromosome backwards, not JOINING it backwards.

Date: 2006/05/08 03:55:25, Link
Author: afdave
DIFFICULT QUESTIONS REMAIN FOR APE/HUMAN ORIGINS

I appreciate the good information that was exchanged on my "Chimp Chromosome Thread."  I have learned some important information regarding the similarity of the genomes of apes and humans.  I agree that the similarities are quite striking indeed and cannot be dismissed as some Creationists attempt to do.

However, I believe there are a number of major issues which would have to be solved before a scientist could logically adopt the firm position that humans and apes DO IN FACT share a common ancestor.  Of course, I am becoming quite proficient at searching the "Index to Creationist Claims" and the Article DB at Talk Origins now BEFORE posting my questions here, so as not to waste your time.  I will summarize the points of agreement that I share with Neo-Darwinists, then pose my questions.  I have surveyed the various Creationist refutations of common descent for apes and humans and have found most of them to be inadequate.  These inadequacies are spelled out rather nicely by Todd Charles Wood (2006) of the Center for Origins Research at Bryan College in Dayton, Tennessee, who appears from this paper to be a fair-minded creationist.
Wood Article (2006)

Points of Agreement between myself (Wood also) and Common Descent Advocates
(1)  Nucleotide mismatches appear to be very small ~1.5%
(2)  Alignment gaps are also very small ~3-4%
(3)  Human Chromosome 2 does in fact appear to be a result of the fusion of 2 chimp chromosomes
(4)  The pseudogene for Vitamin C production does in fact appear to support common descent theory
(5)  Body similarities are indeed very striking and pose interesting questions
(6)  Many creationist arguments are inadequate.

Summary of Inadequacies of Creationist Responses (Wood)
(1) Similarity pointing to Common Design is inadequate.
Quote
A very popular argument is that similarity does not necessarily indicate common ancestry but could also imply common design (e.g. Batten 1996; Thompson and Harrub 2005; DeWitt 2005). While this is true, the mere fact of similarity is only a small part of the evolutionary argument. Far more important than the mere occurrence of similarity is the kind of similarity observed.(p.7)

(2) Possibility of higher % differences proves nothing.
Quote
More recently, creationists have begun to argue that the similarity between chimpanzees and humans is less – sometimes much less – than claimed by evolutionary biologists (DeWitt 2003, 2005; Criswell 2005; Thompson and Harrub 2005). These arguments are inspired in part by a study by Britten (2002) that concluded that the overall similarity of human and chimpanzee genomes is ~95%. Britten arrived at this greater dissimilarity by including in his calculations not only nucleotide mismatches but also alignment gaps. Creationists also tend to emphasize other important differences between the human and chimpanzee genomes, including the differing chromosome numbers (DeWitt 2003, 2005) and the differences in gene expression in the humans and chimpanzees (Rana 2001).Differences are certainly important, and there are many differences between the human and chimpanzee genomes, as detailed above. However, emphasizing these differences does not resolve the problem of similarity. Even if the chimpanzee genome were more than 5% or 10% different from the human genome, the differences are still vastly outnumbered by the similarities (at least 9 to 1). The major pattern that requires explanation is the surprising degree of genomic similarity, as King and Wilson (1975) noted thirty years ago. (p.9)

(3) There may be NO "Haldane's Dillema" at all.
Quote
Based on a 10% dissimilarity between the human and chimpanzee genomes, Criswell argued that humans and chimpanzees could not have evolved from a common ancestor. Criswell reasoned that if evolution were true, a 10% difference would mean that 300 million mutations had been fixed in the human and chimpanzee genomes, or roughly 150 million mutations in each species. Assuming that the human/chimpanzee last common ancestor lived 5 million years ago (Ma), he calculated that an average of 600 “beneficial mutations” must have been fixed in each generation. He concluded that Haldane’s dilemma prohibits such a large number of mutations fixed by selection.Even conceding his assertion of <90% identity between human and chimpanzee genomes, his argument suffers from some errors. (p.10)


Wood then goes on to propose an intriguing alternative ...
Quote
Despite these shortcomings[of the ReMine Message Theory], it is possible that ReMine’s message theory could be modified to explain biological similarity. Although ReMine (1993, p. 368) claimed that his message theory would be invalidated if the unique, nested hierarchy of organisms was falsified, other interpretations of the biotic message could be consistent with non-nested or non-hierarchical patterns. For example, a network pattern of similarity can also serve as a message because a network pattern has the attributes of language. In written language, a very limited number of letters can be rearranged to form a great number of words, which in turn can be rearranged (following rules of grammar and syntax) to express a virtually unlimited number of ideas. If organisms and their genomes are conveying a message (or messages) from the Creator, we should expect a high degree of repetition, both within and between genomes, because of the nature of language. It is therefore intriguing that the human and chimpanzee genomes contain a high fraction of repetitive DNA and that some of the more significant differences between the genomes are in their repetitive DNA (segmental duplication and transposable element) content. If correct, this line of reasoning would imply that a proper understanding of the similarity of humans and primates would depend on detecting rules of “syntax” and “grammar” in the biotic message and applying them.
Furthermore, a network pattern of similarity resulting from transposition could serve a non-naturalistic function since a network pattern is not expected from tree-like inheritance. ReMine (1993, pp. 342-343) argued that evolution “does not predict a nested hierarchy,” but that is only true if evolution is understood in the broadest possible way to include many different (and potentially contradictory) theories. Specific theories of evolution (like Darwin’s) do predict nested hierarchies. Other theories (e.g. Woese 1998) could be constructed to accommodate widespread transposition, but these arguments are not arguments for common descent. As a result, a network pattern of similarity resist simple explanation by naturalistic theories (although complicated theories of transposition might explain it), thus reinforcing its origin by design.(p.12)


and he asks an important question which serves as an excellent prelude to my own questions ...
Quote
What is a Genome? This might seem like a trivial and self-evident question, but its simplicity hides a deep challenge (Wood 2001). The Bible teaches that God created adult organisms and presumably even complete ecosystems by covering the land with plants. Thus, the Bible favors a holistic perspective of organisms. Modern molecular biology has favored the opposite perspective: that life is the complicated interaction of molecules and that DNA is the “code of life.” If the molecular viewpoint is correct, then the differences between organisms that really matter are indeed the differences in the DNA. If a holistic perspective is correct, then perhaps differences in the DNA are not paramount to understanding organismal differences.Complicating this reasoning is the fact that differences in DNA do indeed cause differences at the organismal level. There is a definite relationship between phenotype and genotype, even though the relationship is not as simple as Mendel might have imagined it. We could understand the genome as a repository of some of the information necessary for the physical composition of the organism (Wood 2001). In that case, far more important than the genome may be its cellular context, which interprets and applies the information stored in the genome. Since some of the cellular context is coded by the genome, we have something of a chicken/egg problem, which can only be resolved by a creation event.The similarity of the human and chimpanzee genomes offers evidence that the genome could primarily be a repository. If the fixed nucleotide mismatches between the chimpanzee and human genomes are 1.06%, then the original nucleotide identity could be as high as 99%. At that high level of similarity, perhaps it is not impossible to believe that God created humans and chimpanzees with identical genomes. The known differences between human and chimpanzee biochemistry (see Varki 2000; Varki and Atheide 2005) may well rule this out, but it is an intriguing possibility. Even at 99% identity, however, the biological and behavioral differences between chimpanzees and humans indicate that the source of these differences is not likely to be found entirely in the genome sequences. Theologically, the high similarity of humans and chimpanzees reinforces our spiritual – not physical (Ecc. 3:18-21) – distinctiveness from the animals. It is the image of God that makes us human not some intrinsically valuable genetic element.(p.12)


This paper by Wood is quite interesting to me and serves well as a prelude to my own questions which I shall now present to you ...

(1) How do we explain the complete lack of 'Hominid Civilizations' (for lack of a better term) today?  It seems to me that if Common Descent Theory is correct, that  we would expect to see numerous 'civilizations' of 'less evolved' humans.  I suppose a hopeful candidate for this type of civilization has been the remote tribes of jungle natives found throughout the world.  However, I have firsthand experience with one such tribe, the Wai-Wai indians of Southern Guyana/Northern Brazil (My father is a Bible Translator for this tribe), and we have observed no evidence of anything 'primitive' about their human characteristics.  To be sure, their civilization and technology was quite primitive (they were basically hunter/gatherers), but their language is every bit as complex as English or Spanish or many other languages (I speak the language some and have a copy of their grammar, which my dad produced).  Their behaviour is in no way 'primitive' for the purpose of determining if they are 'less evolved.'  They laugh, cry, make jokes, tell stories, get mad at one another, read, write, learn foreign languages, play guitars and keyboards, have political battles, and in short do everything that any human society also does.  The main difference is in technology, which of course is not advanced.  As far as I know, there are Apes and there are Humans.  And there are no existing 'in-betweens.'  How do you explain this?

(2) The fossil record of human evolution is unconvincing to me.  Here is the supposed evidence from Talk Origins ...
Quote
Intermediate fossils include
Australopithecus afarensis, from 3.9 to 3.0 million years ago (Mya). Its skull is similar to a chimpanzee's, but with more humanlike teeth. Most (possibly all) creationists would call this an ape, but it was bipedal.
Australopithecus africanus (3 to 2 Mya); its brain size, 420-500 cc, was slightly larger than A. afarensis, and its teeth yet more humanlike.
Homo habilis (2.4 to 1.5 Mya), which is similar to australopithecines, but which used tools and had a larger brain (650-cc average) and less projecting face.
Homo erectus (1.8 to 0.3 Mya); brain size averaged about 900 cc in early H. erectus and 1,100 cc in later ones. (Modern human brains average 1,350 cc.)
A Pleistocene Homo sapiens which was "morphologically and chronologically intermediate between archaic African fossils and later anatomically modern Late Pleistocene humans" (White et al. 2003, 742).
A hominid combining features of, and possibly ancestral to, Neanderthals and modern humans (Bermudez de Castro et al. 1997).
And there are fossils intermediate between these (Foley 1996-2004).
 Do we not have plenty of LIVING HUMANS which could correlate very nicely with some of these fossil finds, but which we now know are completely human?  i.e. Pygmies and 'Aborigines' ?  

(3) Some have claimed that for all practical purposes, we are apes and biologically speaking, I see what they are saying.  But does this not minimize the ENORMOUS non-biological differences?  Humans have highly complex symbolic languages.  Apes probably communicate some, but do they communicate in DIFFERENT LANGUAGES in different parts of the world?  Are there any apes that have learned how to write?  Do apes organize themselves into 'governments' and seek to conquer  other ape groups?  Is there any indication of abstract thinking among the apes?  Is there any evidence of any 'technology' developed by apes?  Even primitive technology?  And this is only the tip of the iceberg with such questions.

(4) Has anyone thought about the implications of an assertion by a government entity that "Apes are 98.5% human and therefore should be afforded certain 'human rights.'"  This would be a silly idea to me of course, but it appears to be a logical conclusion of some evolutionist thinking.

(5) Was not Adolf Hitler affected by current evolutionary thinking when he came up with his "Aryan Master Race" theory?  I believe he was, and why shouldn't he have been?  Isn't it logical to assume that some races might be 'less evolved' than others if human evolution is true?  How about slavery?  Did not many whites view themselves as 'more evolved' than blacks, thus justifying their ownership and ill treatment of slaves?  And if human evolution is true, why would Hitler and slave owners be wrong in their actions?  After all, we 'enslave' chimps in zoos and we do medical experiments resulting in the death of lab rats.  Why should we not do the same with 'less evolved' humans?

My conclusion then is that in spite of striking genome similarities, humans and the apes are VERY DIFFERENT in many important ways.  All the evidence that I have seen so far is explained in a much better way by the Biblical assertion that mankind was made "in the image of God."  It appears to me also that Neo-Darwininsts are not even close to being able to answer ANY of the above questions in a satisfactory manner.  But maybe you will prove me wrong.

OK.  That should do it for starters.  I welcome your comments.

Date: 2006/05/08 04:49:00, Link
Author: afdave
Arden Chatfield said ...
Quote
The 'Hitler = Darwin' equation has been tried out by every creationist for the last 60 years. It's bullshit. Start here: http://www.talkorigins.org/indexcc/CA/CA006_1.html

I did and it is extremely weak.

Then go look here for a much stronger case.

The Holocaust and Darwinism


Quote
Hitler was especially determined to prevent Aryans from breeding with non-Aryans, a concern that eventually resulted in the ‘final solution’. Once the inferior races were exterminated, Hitler believed that future generations would be eternally grateful for the improvement that his programs brought to humanity:

‘The Germans were the higher race, destined for a glorious evolutionary future. For this reason it was essential that the Jews should be segregated, otherwise mixed marriages would take place. Were this to happen, all nature’s efforts “to establish an evolutionary higher stage of being may thus be rendered futile” (Mein Kampf).’ 20

Individuals are not only far less important than the race, but the Nazis concluded that certain races were not human, but were animals:

‘The Jews, labelled subhumans, became nonbeings. It was both legal and right to exterminate them in the collectivist and evolutionist viewpoint. They were not considered … persons in the sight of the German government.’ 34

As a result, the Darwinist movement was ‘one of the most powerful forces in the nineteenth–twentieth centuries German intellectual history [and] may be fully understood as a prelude to the doctrine of national socialism [Nazism]’.35 Why did evolution catch hold in Germany faster, and take a firmer hold there than any other place in the world?


But OK.  You don't want to accept this?  What about the other questions?

Ltracey said ...
Quote
Whoa, I seriously cannot believe we just saw another instance of "why are there still pygmies and dwarves?".


That's not what I am saying.  I am saying if a pygmy or some LIVING HUMAN that is not the same size or shape as the mean average of all humans, could not the fossil it made be virtually indistinguishable from the supposed human ancestor fossils found at Talk Origins.

I'm saying that if certain LIVING HUMANS and LIVING APES died, we might easily have the same fossil situation that we currently do have.  Is this not correct?

Tom Ames said ...
Quote
"What is the Bernoulli effect? Well, the Bible teaches..."  Sounds kinda dumb, doesn't it?

Sure, THAT does.  But you are distorting what the paragraph says.  Read the context.  What Wood is saying is "What is a Genome?  It is something worth studying, no question.  But is the Genome going to explain the real differences?  No.  There are differences which have to be accounted for by means OTHER THAN Genome studies."

Remember, that I and apparently Wood view the Bible as a SOURCE FOR PLAUSIBLE HYPOTHESES.  I also believe in Biblical inerrancy.  But this is a separate issue which must be proven on its own merits.  Biblical inerrancy has nothing to do with the issue you just raised.

Norm said ...
Quote
The most evolved life forms on our planet are probably bacteria and virii. They go through more generations and mutations in shorter time periods.

There is no such thing as "less evolved" or "more evolved" in the context you want to use them. There is only more fit or less fit to the niche you find yourself living in.

This is an amazing statement to me.  Do most of you guys really believe this?

Date: 2006/05/08 04:56:41, Link
Author: afdave
Quote
Dave, what exactly are you trying to argue about here?

That Carl Wieland is mistaken, but not necessarily a liar.  There is a big difference.
Quote
I wonder if Dave will admit that the Chromosome fusion is STRONG evidence for evolution..... anyone want to take a bet?

Yes.  I'll take you up on a bet.  How about $1000?  Will you take the position that I WILL NOT say chromosome fusion is strong evidence for evolution and pay me $1000 if I do?  

Before you commit to that, you might want to hop over to my new "Ape Questions" thread.

As far as I'm concerned, this thread has accomplished its purpose.  Thanks for your participation!

Date: 2006/05/08 05:04:47, Link
Author: afdave
I said ...
Quote
That's not what I am saying.  I am saying if a pygmy or some LIVING HUMAN that is not the same size or shape as the mean average of all humans, could not the fossil it made be virtually indistinguishable from the supposed human ancestor fossils found at Talk Origins.

I'm saying that if certain LIVING HUMANS and LIVING APES died, we might easily have the same fossil situation that we currently do have.  Is this not correct?


Oops.  Let's try that again ...

That's not what I am saying.  I am saying if a pygmy or some LIVING HUMAN that is not the same size or shape as the mean average of all humans DIED, could not the fossil it made be virtually indistinguishable from the supposed human ancestor fossils found at Talk Origins??

I'm saying that if certain LIVING HUMANS and LIVING APES died, we might easily have the same fossil situation that we currently do have.  Is this not correct?

Date: 2006/05/08 05:36:09, Link
Author: afdave
Norm said ...
Quote
Human Brain Is Still Evolving

Howard Hughes Medical Institute researchers who have analyzed sequence variations in two genes that regulate brain size in human populations have found evidence that the human brain is still evolving.

They speculate that if the human species continues to survive, the human brain may continue to evolve, driven by the pressures of natural selection. Their data suggest that major variants in these genes arose at roughly the same times as the origin of culture in human populations as well as the advent of agriculture and written language.


and he also said this ...
Quote
You seem to think that human intelligence is some sort of goal in evolution. It's not. There is no goal except for an organism's instinct to survive and reproduce itself. Brains won't be of use to all. ... and ... The most evolved life forms on our planet are probably bacteria and virii. They go through more generations and mutations in shorter time periods.
There is no such thing as "less evolved" or "more evolved" in the context you want to use them. There is only more fit or less fit to the niche you find yourself living in.


These seem to be contradictory statements to me.  On the one hand you seem to be saying that the brain is evolving (I assume this means humans are getting smarter), then on the other hand you say that bacteria are the most 'evolved' ???

Let me just explain that MY conception is this:

MORE EVOLVED=More Intelligent and More Abilities.  For example, apes can walk, climb, eat, drink, sleep, communicate in a limited way, etc.  Humans can of course do all these things and much more including blow all the rest of life on Planet Earth to smithereens.  This is what I'M talking about.  

If you want me to use a new term so I don't confuse your minds, please suggest one.

Date: 2006/05/08 05:59:52, Link
Author: afdave
Quote
How about you go get a high-school biology textbook and shut up for a while.

PLEASE go get some education (not from Answers in Genesis) and come back in 6-12 months.


Out of answers and energy, perhaps?  I'm starting to make sense and you are frustrated?  Maybe evolutionary explanations are not so great as they once seemed to you?  But you still want to hang onto them because you have your life invested in them?

Hmmmm ....

Date: 2006/05/08 06:53:58, Link
Author: afdave
Quote
More Koko news.

I acknowledged up front that apes have communication ability and even some of the other abilities mentioned here.  This does not overcome the ENORMOUS differences between Apes and Humans.  The BEST explanation remains, as it did before Darwin, that an Intelligent Designer made Humans to be Humans and Apes to be Apes.
Quote
Oh, look. The evidence shows that the differences between the various races are negligible, and that their abilities are essentially identical. Huh. I guess that makes it an instance of "Things are not always what you expect."

My point exactly.  Things ARE NOT as one would expect if evolution were true.
Quote
It is your next line ...that the reality-based people here will take issue with. 'All the evidence that I have seen so far is explained in a much better way by the Biblical assertion that mankind was made "in the image of God."'

Why?  What is wrong with proposing this as a hypothesis and testing it?  This is what am doing on my other thread (well into Point 1 already).  If the evidence fails to support it, then fine.  I will abandon the proposition.

You should not be calling people here 'reality based.' Because many of them refuse to consider the possibility of what may in fact be quite legitimate REALITIES -- God, angels, demons, afterlife, etc.  I will be showing excellent evidence for just these types of realities on my other thread.  I cannot prove them, but there is much evidence.  A better term for the people here might be 'naturalistic based.'  In other words, they only acknowledge things they can test with their meters and such.  They think that there is no 'God-meter' so to speak, so they reject the possibility out of hand. I will show that this is a mistake.
Quote
What I wanted to ask you was what are we suppose to make of the non-gaps(I don't know what else to call a non-gap, maybe evidence woudl be a good name, but if anyone has an idea please do tell) in the fossil evidence?  You know, the places that make all those gaps the creationists complain about possible.  All that evidence has to mean something.  Especially since the evidence between the gaps shows such flow(again a bad word but the only one I could think of) between features and anytime a new piece of evidence is found it fits into the flow just as we would expect it to.  Focusing only on the gaps gives the lopsided picture that the gaps are all that is important, but as I said above without the evidence there would be no gaps; or, rephrased, all of prehistory would would be one giant gap.  And if creationism was true(especially YEC) that is all we would expect.  One giant gap.  Why can't creationists get that?

I will cover this on my other thread.  Keep checking back.  Thanks for the question.
Quote
(Arden)Ah yes, where would creationists be without comparisons of Hitler and Darwin? And where would they be with AIG? (Didn't use AIG this time ... are you happy?) Okay, Dave try answering this.
Adolf Hitler was a Christian. Catholic, in fact. The great majority of Nazis were Christians of some kind. Hitler frequently rationalized his attitudes towards 'racial purity' by appeals to Jesus and God. From this, one could conclude that a natural consequence of Christianity is murdering Jews. You presumably disagree. So do I. But why is this any less reasonable than your logic? It's FAR EASIER to find statements by the Nazis invoking Jesus for what they did than invoking Darwin.
(Joe the Ordinary Guy) Sure he [Hitler] was. But, as above, I think most people would describe him as “wrong”; he MISINTERPRETED evolutionary theory and arrived at bad conclusions. Wasn’t he also a Christian? Would you say he followed Christian precepts correctly?

I might concede this point.  It is true that various twisted versions of Christianity has wreaked enormous havoc on the human race, the medieval Catholic Church being a case in point, in my opinion.  But history also has a very recent example of a nation which based its laws upon the general Protestant interpretation of Christianity (the USA)--there is a very strong case that this is true--it should be self-evident, but may not be now thanks to post-1950 (or so) revisionists of American history.  America (and the British Empire before it)  owes its success more than anything else to the Bible and to the teachings of Jesus of Nazareth.  And by "success", I mean equality, prosperity, culture, conveniences, art, music, good treatment of women and children, etc.  Note that people from all over the world want to come to America.  I cannot help but think that the story of Great Britain and America would have been quite different (maybe like the USSR?) had they been founded upon Darwinism instead of upon the Bible and the teachings of Jesus.  Do you disagree with this?

To me, basing society upon the Bible and the teachings of Jesus has been demonstrated to be a good idea, whether they happen to be true or not.  And basing a society upon Darwinism would be a bad idea, whether it is true or not.  But I believe I have a "double whammy" if you will.  Not only do I believe Darwinism is unsupported by adequate evidence AND has bad societal influences, but I also believe that Biblical Christianity and YEC is supported by overwhelming evidence AND is good for society.  

This explains my zeal in fighting AGAINST Darwinism and FOR Biblical Christianity and Creationism.

Quote
Evolutionary theory does not provide any support for the arguments you try to make.  These are issues for society, not science, to resolve.
True, and I am not an official member of the science community, but policy makers rely on what they think is good science many times to make good decisions.  I am a concerned citizen with a scientific mind who feels that a pseudo-science called Neo-Darwinism is being called science on a large scale.  This gives politicians scientific sounding reasons to implement potentially disastrous policies in our society.

Quote
Christians had been discriminating against and killing jews for well over a thousand years before Hitler was born.
Twisted Christianity had been.  You are correct.  It got so bad that a man named Martin Luther turned things upside down.  The result?  The translation of the Bible into the English language and the attendant success of the British Empire, followed by the founding of the United States squarely upon the Bible also, again with great results.  Note also the DECLINE of the British Empire coincident with the REJECTION of the validity and authority of the Bible.

Quote
Tell us what to do, now, Dave. Obviously we have to start from scratch. I mean, I assume I have to get one of those Jesus fish eating a Darwin fish for my car, and vote Republican this fall, but aside from that, I'm at a loss.
No one will make you do any of those things.  That's the beauty of America.  We let people be Atheist or Islamic or Buddhist or Nothing with no penalties.  And the reason for this is the Christian worldview which is unique in the world in that it allows maximum freedom.

What we DO want is to NOT have our Creationist views ridiculed in the public square, and we want school children to hear both sides of the evidence (whether in ID format or Creo format, I don't care).  I hear this is starting to happen in the UK and I think this is great!

Date: 2006/05/08 07:35:16, Link
Author: afdave
Quote
Since you seem to have abandoned the previous thread, I'll repost my simple, unanswered question here:

Do you or do you not find the very idea that humans are evolved apes offensive?


If it does indeed turn out to be false when I have finished my investigation into the claim, then YES, I would be offended at the idea of teaching it as if it were true.

I will resume posts on my other thread tomorrow morning.  I was not avoiding yours or anyone's questions over there.

Date: 2006/05/08 08:36:47, Link
Author: afdave
Quote
To #### with it all -- let's play Hitler ping-pong!


We are getting off on rabbit trails.  I said I would concede the Hitler point.

Let me put us back on the main track.

The BOTTOM, BOTTOM, BOTTOM line for me is this, guys.

None of this discussion here changes the simple FACT that ...

(a) WE REALLY DON'T KNOW FOR SURE IF HUMANS EVOLVED FROM APE-LIKE ANCESTORS, AND I'M NOT SURE WE EVER WILL.

and ...

(b) WE REALLY DON'T KNOW FOR SURE IF "GODDIDIT" AND WE CERTAINLY CAN'T "PROVE" THAT.


OK?  

Now ... my BIG problem is this ...

Why are we standing up in science classes and teaching kids that Ape to Human Evolution is a FACT?  This is dishonest and potentially damaging to society for any number of debatable reasons.  What we SHOULD be doing is telling them BOTH THEORIES--DESIGN and NO DESIGN and clearly let them know they are UNPROVEN THEORIES and it is up to YOU and YOUR PARENTS to decide.  My tax dollars are funding this education system just like yours are and I have a different opinion on something that is an unprovable fact in either direction.  Why is my opinion shut out and vilified?  Is this country supposed to be a representative democracy or is it not?  Last time I checked IT WAS.

And that ... my friends ... is the BOTTOM LINE on this thread.

Date: 2006/05/08 08:50:03, Link
Author: afdave
Well ... I didn't quite read the AIG guy quite that way ...

but whatever ... I don't really care about that anymore.

The important thing is that I was corrected in some erroneous thinking regarding this topic and I am glad for that.

You might want to check out my new thread "Ape Questions" ... where I concede many things that evolutionists are saying about Ape/Human issues.

I have maintained from the first that I am a fairminded guy and will give up my position readily when it is proven wrong.

I do wonder if anyone else here will ever concede anything, though.  Haven't seen it yet, but then ... I've only just begun, really.  Who knows!

Date: 2006/05/08 09:06:05, Link
Author: afdave
Let me just put to rest all the talk about "More Evolved=More Abilities, etc." ...

When comparing Apes and Humans (which is the topic of this thread), I am simply saying this ... Humans Have More Abilities than Apes

Let's just forget about the bacteria and the rest until another day ...

OK?  Everybody happy now?

Also, this type of thing from Aftershave ...
Quote
Let's use AFDave "logic", shall we?

Those evil Nazis used their knowledge of chemistry to produce high explosives and poisonous gas, so therefore the Atomic Theory of Chemistry must be scientifically wrong!

Worse than that, those evil Nazis used their knowledge of physics and gravity to aim and drop their bombs, so therefore Newtonian physics and the Theory of Gravity must be scientifically wrong!

How can we teach such blasphemy as chemistry and physics to our children???

Let's say someone drops AFDave into the middle of the Pacific with no raft, into a pack of sharks, to see which is "more evolved".  Any bets?


is a sure indicator that this person has nothing left to say that is substantive ...

this does not help the image of evolution promoters ...

the YECs on the other hand thank you for ranting so ...

Could you maybe do some more?  Maybe go tell 4 friends to show up and insult me too ... then you would be 5 times as effective :-)

Date: 2006/05/08 11:37:42, Link
Author: afdave
Well ... one thing is sure ... most of you are answering me precisely as I expected you to answer ...

We'll see you guys tomorrow for some more fun ... :-)

Date: 2006/05/08 11:39:56, Link
Author: afdave
Well ... one thing is sure ... most of you are answering me precisely as I expected you to answer ...

We'll see you guys tomorrow for some more fun ... :-)

Date: 2006/05/08 11:44:16, Link
Author: afdave
Quote
He already HAS the Truth.


Very good, Flint.  Now if we could just get you to have it, wouldn't life be grand ... :-)

Date: 2006/05/08 14:01:01, Link
Author: afdave
Maybe you guys could start a new thread called ...

"Live Mudwresting: Steve vs. Ghosty"

Just a thought ...

Date: 2006/05/09 05:21:02, Link
Author: afdave
Good morning everyone!

I hope everyone has had an excellent night's sleep so your mind is clear and your wits are sharp!  The remaining half of my brain that's not "religion darkened" feels pretty good, so I'm ready to go at it again hammer and tongs!  

It was a fun day for me yesterday ... I learned some really interesting things, and my wife and I got some great laughs from some of the creative answers you gave.

I do see that some of my "Chief Insult Hurlers" have abandoned that tactic apparently because they found it ineffective for their cause.  We'll see how long it takes ALL the Insult Hurlers to figure this out. (You know ... some are more "highly evolved" than others, so it takes a while with some ... just kidding, JUST KIDDING! :-)  )


NOTEWORTHY HIGHLIGHTS FROM YESTERDAY'S SKIRMISHES

Tom Ames runs for cover when the "B WORD"  is mentioned ...
Quote
What is a Genome? This might seem like a trivial and self-evident question, but its simplicity hides a deep challenge (Wood 2001). The Bible (RED ALERT!! RED ALERT!! ALL PERSONNEL TAKE COVER IMMEDIATELY!! THE DEPLORABLE WORD HAS BEEN SPOKEN!;) teaches that God created adult organisms and presumably even complete ecosystems by covering the land with plants. Thus, the Bible (RED ALERT!! RED ALERT!!;) favors a holistic perspective of organisms. Modern molecular biology has favored the opposite perspective: that life is the complicated interaction of molecules and that DNA is the “code of life.” If the molecular viewpoint is correct, then the differences between organisms that really matter are indeed the differences in the DNA. If a holistic perspective is correct, then perhaps differences in the DNA are not paramount to understanding organismal differences.Complicating this reasoning is the fact that differences in DNA do indeed cause differences at the organismal level. There is a definite relationship between phenotype and genotype, even though the relationship is not as simple as Mendel might have imagined it. We could understand the genome as a repository of some of the information necessary for the physical composition of the organism (Wood 2001). In that case, far more important than the genome may be its cellular context, which interprets and applies the information stored in the genome. Since some of the cellular context is coded by the genome, we have something of a chicken/egg problem, which can only be resolved by a creation event.The similarity of the human and chimpanzee genomes offers evidence that the genome could primarily be a repository. If the fixed nucleotide mismatches between the chimpanzee and human genomes are 1.06%, then the original nucleotide identity could be as high as 99%. At that high level of similarity, perhaps it is not impossible to believe that God created humans and chimpanzees with identical genomes. The known differences between human and chimpanzee biochemistry (see Varki 2000; Varki and Atheide 2005) may well rule this out, but it is an intriguing possibility. Even at 99% identity, however, the biological and behavioral differences between chimpanzees and humans indicate that the source of these differences is not likely to be found entirely in the genome sequences. Theologically, the high similarity of humans and chimpanzees reinforces our spiritual – not physical (Ecc. 3:18-21) (RED ALERT!! RED ALERT!!;) – distinctiveness from the animals. It is the image of God (RED ALERT!! RED ALERT!! THE OTHER DEPLORABLE WORD HAS BEEN SPOKEN!;) that makes us human not some intrinsically valuable genetic element.(p.12)


NOTE:  Let me emphasize again that for YECs showing evidence of YEC Theory, the Bible is a SOURCE FOR HYPOTHESES.  Belief in Biblical inerrancy IS NOT required in this discussion.  This is a SEPARATE ISSUE and stands or falls on its own merits.

Quote
The most evolved life forms on our planet are probably bacteria and virii.
 I just LOVE this one!  My kids got a great laugh too.  I quickly learned yesterday that I am not up to date on the latest version of THE GREAT MYTH, so I thank all of you for fixing that.  You'll have to pardon me for making this mistake.  When I was in grade school, I remember all the encyclopedias showing Evolution going something like AMOEBAS - WORMS - SQUIDS - FISH - AMPHIBIANS - MAMMALS - APES - HUMANS (did I get that right?), with humans at the top of the tree.  Anyway, I remember seeing a nice little Ape to Human progression and I remember quotes from Huxley and the like saying things about whites being "more evolved" than humans.  I guess it stands to reason that ND Theory would have to change as racism became less fashionable worldwide throughout the 20th Century.  And I do apologize for not keeping up on the latest version of THE GREAT MYTH.  The Bible (My "myth" as you call it) says the same thing THIS century as it did in Darwin's day, so it's easier to keep up with than YOUR MYTH.

Quote
Human Brain Is Still Evolving: Howard Hughes Medical Institute researchers who have analyzed sequence variations in two genes that regulate brain size in human populations have found evidence that the human brain is still evolving.

And why shouldn't it be if evolution is true?  It seems that the ToE would actually PREDICT continual brain sophistication (oops ... there's one of those evil "directional" words) ... er, shall we say, er ... I'm at a loss ... anyway ... ToE should predict continual brain sophistication so that at some point there may actually be some kind of Super Homo Sapiens species who might be able to leap tall buildings in a single bound, play 100 simultaneous chess games, memorize large books in minutes, etc, etc.

Quote
Why should Common Descent produce “Hominid Civilizations”? There’s no reason to assume that this would be the case.

Actually, there is EVERY reason to believe this should be the case if the ToE is true.

Quote
After Darwin, a new possibility was raised: that those at the top of the social pyramid deserved to be there for natural reasons rather than religious reasons. There has never been ANY doubt by those at the top that their position is deserved. So these "natural" justifications have been deployed both by nations (as in Germany) and by scientists (searching for natural explanations for why the French are superior to the Germans or vice versa (depending on who's doing the study), or why whites are superior to blacks (again depending on who's doing the study). In brief, it fell out of fashion for those born into privilege to say God put them there, and into fashion to say they are "more evolved" and rose to the top from sheer innate superiority.


Quote
The anti-semitic attitudes that allowed for various attrocities - including the Holocaust - came directly from Christianity.  The notion that Hitler just came up with the idea of killing off jews all on his own is simply absurd.  Christians had been discriminating against and killing jews for well over a thousand years before Hitler was born.  Hitler was just continuing a popular tradition, and adding his own spin to the process.

You need to remove the word 'Christianity' from this one and insert 'Catholicism' instead.  The two are vastly different as I will show on a future "Martin Luther" post.  That one should be fun!

Quote
How can you hope to find any flaws in something of which you have no understanding?

My 1st grader can easily grasp the truth that Apes are Apes and Humans are Humans and that they probably HAVE ALWAYS BEEN just that, and probably WILL ALWAYS BE just that.  It doesn't take very much understanding of biology.  The reason you don't grasp this is beyond me.  Maybe too much ToE indocrination in higher education?

Quote
But you come in with arrogance and attitude on top of that. You don't show any respect for the opinions of people who do know things.
I'll give you that one.  I did come in kind of cocky on the chimp chromo thing and you are right ... I should not be cocky, but I did show respect for people's opinions when they showed me the truth.  I have always said I would ... and I did.  You got me on that one, and now I agree with you that it does in fact appear that this supports ToE.  So basically now you are "one bucket full" of water closer to draining the ocean.  You should feel justifiably proud.

Quote
If creationism offered some explanations of the otherwise unexplained, if it made any predictions at all that worked, I still have my life and my work. It wouldn't cost me a thing to adopt it. If it worked. But it doesn't.
Stay with me.  I will be resuming my work on my "Creator God Hypothesis" thread and I hope for your sake that it makes sense to you.  The world is truly a fun place when you have the right view of it!

Quote
Now, let's talk about what you have invested in creationism. Suppose we were able to convince you that AiG is just as obviously, glaringly, unambiguously wrong about everything else as I hope you have come to realize they are about the chromosome fusion story. Suppose you had to accept what every scientist who's looked at the evidence objectively accepts: that the earth is billions of years old, and that humans are just one little twig on the tree of life, that has been on the scene for but an infinitesimal fraction of the planet's history. Would that make you reassess your thoughts on life and your alleged god?

Sure.  I'd probably think there ISN'T a God.  And yes, I would be disappointed.  I admit that I LIKE the idea of there being one.  But I don't think I am necessarily jaded by this.  I think everyone's thinking is affected somewhat by their "wanters", but we have to keep this "wanter" under control.  "Evos", like "Creos" also have "wanters" and many of them DON'T WANT there to be a God because they think their life would somehow be worse, or they'd have to tie half their brain behind their back, or some such thing.

Quote
What does this (Hitler) have to do with the biologically history of the planet Earth?
Simply this. If you compare the two "World Views" you have something like the following major points:

DARWINISM:  
Survival of the fittest
Humans are animals-nothing more
No God required-I'm not accountable to anyone but myself

CHRISTIANITY (American Protestantism specifically):
God created mankind in His image
All humans are created equal
Don't kill, don't steal, etc.
Treat others as you would have them treat you
Love one another
Turn the other cheek
Bless your enemies
If your enemy is thirsty, give him a drink
Do not repay evil for evil

Now ... which of these is more conducive to a Holocaust?  You tell me.  I'm not discounting other factors.  It's true that Hitler was influenced by Catholicism, the Occult, and other factors as well.  So my point is ...

NOT ONLY IS DARWINISM FALSE AND AN INSULT TO INTELLIGENCE ... demonstrably so as we saw for many years with Henry Morris and Co. and are now seeing with Dembski, Denton, Behe, etc.

BUT IT IS ALSO AN BAD FOUNDATION UPON WHICH TO BUILD A NATION.
I don't know of a single one that was built on the Principles listed above under "Darwinism" that I would want to live in.  Do you?

In stark contrast to that, we have at least TWO examples of nations who built their laws squarely upon the CHRISTIANITY principles listed above:  Great Britain and the USA.

Now you see what gives me such zeal in fighting Darwinism.

Again, so no one misses it ... the two reasons I fight Darwinism are ...
(A) IT IS FALSE
(B) IT IS HARMFUL TO SOCIETY

Are there any questions?  Is my position perfectly clear?

By the way, for those of you wise enough to "get off the Darwin train" BEFORE the train wreck, your buddy Bill Dembski has come up with a neat list of over 500 scientists who have had the kahoonas to sign their names to a public statement that says ...
Quote
A Scientific Dissent From Darwinism
"We are skeptical of claims for the ability of random mutation and natural selection to account for the complexity of life. Careful examination of the evidence for Darwinian theory should be encouraged."


It also notes that ...
Quote
The scientists on this list dispute the first claim and stand as living testimony in contradiction to the second. Since Discovery Institute launched this list in 2001 [in response to the PBS "Evolution" propaganda piece] over 500 scientists have courageously stepped forward to sign their names. The list is growing and includes scientists from the US National Academy of Sciences, Russian, Polish and Czech National Academies, as well as from universities such as Yale, Princeton, Stanford, MIT, UC Berkeley, UCLA, and others.


Here's the link ... [url="http://www.dissentfromdarwin.org"]

(What?  We have rebels in the Ivy League too?  Heaven help us! er ... Deep space help us! (?) ... er ... May the Force help us! ... er ... well ... anyway, SOMEONE help us!;)

THOUGHT QUESTION FOR THE DAY:  If over 500 scientists have actually had the kahoonas to SIGN such a document, how many others AGREE with the document, but are AFRAID to sign it because of peer pressure, fear of not getting tenured, etc., etc.

Hmmmm ....

Quote
so afdave, have you confronted AIG about the lies on their site as you said you were going to do yet?

Patience, my friend.  These things take time.  AIG is so popular right now that they get ZILLIONS of questions every day and it takes time to get to mine.  Actually, I think the only way I will get an answer in any reasonable amount of time will be if I use my connections.  But I don't even know for sure if that will work quickly.  Stay tuned, though.

Quote
The problem is not that chimps, and the animal kingdom in general, is so far behind.  It is that you are so completely unknowing of just how capable chimps really are and that you are full of species superiority about how far advanced humans really are.
Yes. Maybe we should take this up in Congress and maybe come up with an "Ape Bill of Rights."  Good idea.  I'll take this one with me on my next trip to Washington.  Oh ... and maybe we could have an "Ape Olympics" and make it a world class event ... and maybe we should modify laws to allow Apes free access to various public places like Walmart and the Public Library, etc.  Excellent idea.  I like your progressiveness.

Quote
Dave, the reason people are becoming frustrated with you is because most of the questions you have, which you seem to view as huge problems for evolutionary biology, are in fact a result of your limited understanding of evolutionary biology.
I have an alternative explanation for the frustration (imagine that!;)  Mine is like this ...

STAGE 1: ToE advocates are becoming frustrated because their explanations are sounding more and more like pro-geocentrism and pro-flat-earth arguments as time goes on.  
STAGE 2: The Ship of Darwin has hit an iceberg and a few brave souls are jumping into life boats before it sinks.  See www.dissentfromdarwin.org
STAGE 3: And now, ordinary amateur scientists like me are jumping in the fray and shining a light on a foolish theory.
STAGE 4: Frustration ensues, followed by name calling, arrogant and belittling comments, talk of censorship, and the like.
STAGE 5: This is turn fuels more doubts in people minds. ("Why would that guy resort to name calling?  Doesn't he have any GOODS?" etc.)  
STAGE 6: Which in turn fuels more frustration and mental anguish.  And so the cycle goes until finally for some ... in a desperate moment ... possibly in the middle of the night ... or out on a peaceful lake while fishing ...
STAGE 7: THE LIGHT BULB COMES ON!  (Trumpets) And one more Darwinist is rescued from the darkness of error.

Quote
How do you test for God?
With a God Meter of course.  No.  Seriously, there are some very good ways.  Cosmic fine tuning and Biological Machines are great for starters.  And if I could get everyone on this thread to agree with me, I could hop back over to that thread (AF Dave's UPDATED Creator God Hypothesis) and give you more.  Lots more.  Stay with me.  We'll get there.

Quote
Let's say someone drops AFDave into the middle of the Pacific with no raft, into a pack of sharks, to see which is "more evolved".  Any bets?
Aftershave ... you're in STAGE 4.  See above.  (Which means there's hope for you)

Quote
Why is my opinion shut out and vilified?

That's an easy one.  Because your ideas are not within the mainstream of scientific understanding today.  It's that simple.

Yes.  Galileo's ideas were not mainstream either.  Right.

Quote
Why do you ignore the fact that the chimp/human DNA thing is a PRETTY DURN BIG piece of evidence in favor of evolution, especially since it is the proof of predictions made before people even knew there was such a thing as DNA?
I don't ignore it.  In fact I've acknowledged it several times to prove my sense of fairness and honesty.  Go read the whole "Chimp Chromo" thread and you will see this.  I'm trying to set a good example for how someone should act when they are proven wrong on a point as I was.

And here it would be appropriate for me to repeat what I told Steve Story ... that with your "Chimp Chromo" victory ...

... you are "one bucket full" of water closer to draining the ocean.  You should feel justifiably proud.

Quote
AFDave, since you refer to 'more evolved' humans, do you admit that we are the result of some evolution?
No.  I do not believe there is such a thing as 'more evolved' humans.  I just asked our ToE advocates why there ARE NO EXAMPLES of 'more evolved' or 'less evolved' humans.  There should be some living today if ToE is true.

Quote
For the umpteenth time – science is NOT a democracy, and scientific truth is NOT decided by popular vote.  Your opinion based on ignorance  doesn’t mean jack sh*t to the scientific realities of the evidence. Dave, for an otherwise intelligent guy, you’re sure doing a good impersonation of a cement-headed dumbf*ck.
Not just STAGE 4.  SERIOUS, "E.R." STAGE 4.  See above.

Quote
We're teaching kids that this is science's best guess and its as factual as this kind of science ever gets.
There are apparently more and more scientists who have a DIFFERENT guess.  But let's not consider their guess.  They are obviously 'unscientific.'

Quote
Looking at human society, behaviour, anatomy, physiology and genetics, our close evolutionary relationship to the great apes is obvious. Remember the vitC gene?
No disagreement with any of this.  I just think it indicates COMMON DESIGN, not common descent.  Not a looney, fringe idea. Should be taught in school too.  I'm in good company ... Newton for one.  Apparently thousands of currently living scientists as well in all major universities.

Quote
But you have demonstrated here that you are not really competent to judge.
Agreed.  That's why I enlist the help of Morris, Dembski, Meyer, Denton, Behe, etc. etc.

Quote
And of course, evidence doesn't matter. But in the world of science, evidence DOES matter.
 Evidence DOES matter.  That's why we are having this discussion.  Because the EVIDENCE favors COMMON DESIGN, not common descent.

Quote
But what we are discussing here is science, and science is NOT a democracy.
Quite true.  Science is not a democracy.  We have to go with the evidence.  But politicians are elected by majority.  And politicians give funding to public schools and universities.  And if universities behave irresponsibly and teach junk science -- like Darwinism -- and vilify people who don't, then the electorate can demand that the politicians RE-direct the funds to responsible schools.

Quote
afdave, if you need retarded "science" (your idiotic AIG approved "science") to justify your faith in god you were in a world of hurt long before you came to this web site.
I think you must not yet know WHY I came to this website.

Quote
To trot out an over used but apt comparrison.  A recent poll came out that said barely 1/3 of questioned people could locate Iraq on a map.  Does that mean that:
1)  We should improve geographic education to make sure that Americans are more aware of the world around them or
2)  We should "teach the controversy" and show both sides of the issue, both those people who believe Iraq is in the middle east, and those people who pointed at Australia and said "I think it's around here somewhere".


Your analogy works if you assume that "Teaching Darwinism = Teaching that Iraq is Somewhere near the North Pole", which I of course do believe is a good equation.  And in this case, YES, I would advocate (2).  

Quote
Why are we standing up in science classes and teaching kids that Ape to Human Evolution is a FACT?  Because we teach them that gravity makes apples fall.
Jeannot, Jeannot.  Come now.  Look what you just did.  You compared something with ABUNDANT EVIDENCE THAT WE SEE EVERY DAY (Gravity), with something for which there is NO EVIDENCE OF IT OCCURRING (Apelike ancestor becoming Human).  Or do you see this occurring in France?  (I can think of a joke about the REVERSE occurring, but I will be nice and refrain.  Besides, I liked Lafayette.)  I was beginning to be impressed with your grasp of science (the DNA replication info). How could you make this basic error?

Quote
Speaking of which, how are you doing with supporting your three assertions? Eric is referring to these ...
1. The Bible is literally inerrant;
2. The earth is not billions of years old, but only thousands of years old; and
3. Evolution cannot explain the origin of species.

FIRST, these are not assertions that I made in my Creator God Hypothesis although I heartily agree with them all and they all have mountains of evidence to support them which I hope we can get into.  The reason I did not make them in my Hypothesis is that there are more important things to show evidence for first.  It is most important that I BEGIN with the PHYSICAL EVIDENCE ... namely, the Cosmos and the Living World around us.  This evidence includes Cosmic Fine Tuning, Biological Machines and Relativity.  Next we should observe Humanity and Moral Laws which in fact are REAL THINGS, although we cannot "see" them.  From this evidence we can postulate a Cause for all these phenomena.  There are other phenomena we can observe to get a better and better description of what this Cause might be like.  If we can establish a pretty good case for the existence of a Great First Cause, then we are not unreasonable to postulate than maybe He gave us a written message.  We posulate the Bible as a possible candidate for THE MESSAGE OF GOD TO MANKIND because of its uniqueness and seemingly supernatural character, then test our theory in detail.  If this theory is well supported from things easily verifiable, we can now move on and investigate various claims of the Bible such as the Flood, Young Earth, the Changing of Languages at Babel, etc. which are disputed widely today.  This is the general outline I am following.  Again, remember that I have never before published a "God Hypothesis" ... I am proposing one and working out the exact details of how it should go with YOUR HELP!  Thank you!  As for proving Evolution to be false, this is not my priority, as some others are doing a good job of that.  Henry Morris, Michael Denton and Michael Behe, to name a few.  Denton was more polite than I would have been in titling his book.  Instead of "Evolution: A Theory in Crisis", I would have named it "Evolution: Impending Train Wreck."

NOTE:  Let me emphasize again that for YECs showing evidence of YEC Theory, the Bible is a SOURCE FOR PLAUSIBLE HYPOTHESES, nothing more.  Belief in Biblical inerrancy IS NOT required in this discussion.  This is a SEPARATE ISSUE and stands or falls on its own merits.

Quote
But can you get it through the front door of that meritocracy honestly?
Yes.  This is happening as we speak.

Quote
No doubt my teaching about common ancestry (especially regarding humans and apes) makes you feel uncomfortable, since you deny the starting premise.
Again, I am perfectly comfortable teaching things THAT ARE TRUE.  What I am uncomfortable with is ASSERTING things AS IF they were proven, when in fact they are not, by YOUR OWN STANDARDS.

Quote
"More evolved" is a difficult term and issue.  However, I don't think that it is truly meaningless in biology, nor that it would necessarily apply to the highly successful micro-organisms better than to multi-celled eukaryotes.
Glen ... I enjoyed reading your entire piece.  Very insightful.  Thanks!

Quote
AFDave, it seems that the history of Christianity is another thing that you could learn more about. Next time you are researching, Google "Martin Luther" and anti-semitism. Read his actual writings. With regard to your claims about history, I will just observe that correlation is not causation.
I'm sure I would agree with you.  But this has nothing to do with my point.  Go back and read my point again.  We'll do another thread an ML.  He's one of my favorites.  But not now.  I have alot on my plate :-)

Quote
Indeed, Dave should not start thinking that all the Christians who mistreated Jews were all Catholics, and that Protestants all treated them well. Many high ranking Nazis were Protestants as well. Here's what Wikipedia says about Luther:
Agreed.  It was Protestants who burned William Tyndale at the stake.  You are absolutely right.  But this does not change the fact of history that the Protestant Reformation changed the world for the better.

Quote
Add American history to the list of subjects AFDave knows less about than he thinks.
Oh?  I'll take you up on the challenge sometime.  That will be fun too!

Quote
There are some rules here at ATBC, and I predict you won't persist in babbling your nonsense any longer.
Jeannot, have you never heard of a nifty little thing made famous by Americans called FREEDOM OF SPEECH?  Do you not have this in France?

BTW ... I salute Steve and Wes for honoring Free Speech!  You have my accolades.

Quote
Offer a "theological biology" class.....
The Darwinist Religious belief on Origins would be PERFECT for this class.

Quote
Exactly Paul. Individuals of our species get a HUGE leg up on our planet by being immersed in the current incarnation of human culture of whatever location they happen to be born. Where would they be if they were born into the wild and cared for by animals, or by parents that had no concept of language, and if they had no contact with anything manmade? That recent thread that touched on the subject of feral children leads me to think that they wouldn't fare very well. The extremely rare child that is raised by animals imprints upon their adoptive parents, crawling like dogs, or imitating chickens. We spend years with our families and in schools learning just the basics about the world and how to interact with it.

Seeing the capabilies of Koko, given the advantage of being taught an already established, open ended language that promotes structured thought, leaves me quite awestruck at how smart and similar to us gorillas are. Whoever said that these ape societies are the 'Hominid Civilizations' afdave is looking for is right. It just goes to show what a good ecological niche it is that we used to share. There's plenty of room in the jungle for apes.
I agree.  All the apes need is a good environment and they will become rocket scientists.  When I am in Washington next, I will suggest to Ike Skelton that he introduce legislation for a new, tax-funded, "Primate Education Program."  Maybe we could even have a new cabinet level office ... we already have the Department of Education ... why not have the Department of Ape Education.  

Quote
Is every aspiring AF pilot guaranteed to get his wings and then be allowed to fly fighter jets?  Or is there a winnowing out process so that only those who have passed a battery of rigorous tests will be deemed qualified?

And who gets to decide if an aspiring pilot has the right skills and attributes to fly F-22s instead of tankers or trainers, or gets to fly at all?  Is it AF cooks, and drivers, and mechanics?  Or is the judgment made by a group of senior pilots who have themselves put in the years learning the trade, and know what separates the real aviators from the wanna-be ones?

I think we should give wings and assign fighter duty to everyone who applies.
Why are we standing up in the Air Force Academy and teaching that some people make better pilots than others is a FACT?  This is dishonest and potentially damaging to society for any number of debatable reasons.  What we SHOULD be doing is telling them BOTH THEORIES—ONLY A FEW PEOPLE MAKE SUPERIOR PILOTS and ALL POTENTIAL PILOTS ARE EQUALLY CAPABLE and clearly let them know they are UNPROVEN THEORIES and it is up to EACH PILOT HIMSELF and HIS PARENTS to decide if he is qualified.  My tax dollars are funding the military budget for F-22’s, etc. just like yours are and I have a different opinion on something that is an unprovable fact in either direction.  Why is my opinion shut out and vilified?  Is this country supposed to be a representative democracy or is it not?  Last time I checked IT WAS. You do believe in the democratic process, don’t you Dave?  Shouldn’t it be applied here too?  I’m really curious to hear your answers.
Good question.  I knew you could say something substantive. Answer:  The generals who set the rules EARNED THE RIGHT to do so by exercising sound judgment regarding EASILY VERIFIABLE TRUTHS.  What is this EASILY VERIFIABLE TRUTH?  It's very easy to distinguish the good pilot candidates from the bad ones.  In science today, we are talking about a different matter.  We are talking about many qualified students who can do much in the way of good, useful scientific work regardless of their worldview.  To exclude people because of their worldview is like excluding people based on sex or religious preference, ESPECIALLY when there are thousands of "Darwin dissenters" among scinetists in all major universities AND half the US and British population rejects Darwinism.  This is a significant difference.  Contrast this with putting the following question on the next national ballot, "Do you think there should be a selection process in choosing fighter pilots?"  I think you'd be very close to 100% YES.

Quote
Why would somebody be offended by having been taught something that was believed by scientists at the time, but that found out later to be incorrect?
No problem with teaching Evolution as a Theory espoused by many good scientists.  Let's just be honest and call it a theory though and quit saying it is a proven fact and shutting out the ID view.

Quote
Now let's try this again.  Do you or do you not find the very idea that humans are evolved apes (as are, for Flint's benefit, all present-day apes) offensive?
I'm perfectly fine with the idea if it turns out to be proven true.

Quote
I said ... Do we not have plenty of LIVING HUMANS which could correlate very nicely with some of these fossil finds, but which we now know are completely human?
Let me explain this one again, since it was misunderstood.

I am saying that if we took an assortment of recently (let's say they all died at once yesterday, OK?) dead African pygmies, maybe some dead dwarfs, some dead Aborigines, some dead gorillas, etc. (a morbid thought to be sure, but you get the idea ... we are collecting 'ape-like bones';) ... but if we somehow collected all these bones, we could quite possibly bury fragments of them in various places throughout the world and have a 'hominid" fossil situation  quite closely resembling the naturally occurring situation which we do have.  Make sense?  Now that you understand what I am saying, please ... go ahead and refute me.  Who knows?  Maybe you can.


MAIN POINTS I LEARNED YESTERDAY
(1) Humans are Humans
(2) Apes are Apes
(3) No one has observed Apelike ancestors becoming Humans in their lifetimes and no one ever will.
(4) Fossil evidence is dicey at best
(5) Genetic similarities are striking, but can just as easily be explained by Common Design (probably better when we really get into it) as by Common Descent
(6) Creos and Evos have strong and opposite opinions about something which cannot be proven because NO ONE CAN OBSERVE IT HAPPENING.  Contrast this with Gravity, etc.
(7) Evos are the "rulers" in academia right now and they like to call the Creos "non-scientific"
(8) There's hope for academia in spite of this thanks to courageous people like Morris, Dembski, Meyer, Denton, Behe and apparently a growing number of good scientists (over 500 signatories so far on a Darwin Dissent Document)

I need to get back to my main Creator God Hypothesis today if I can.  So do me a favor and just agree with me quickly so we can get on with it, would you?   :-)

Date: 2006/05/09 06:00:40, Link
Author: afdave
Quote
Dave, sometimes your understanding of evolution seems very cartoonish. I really, really think you should read a few good books on evolutionary topics aimed at a general readership.
Is there a better author than Dawkins for this type of book?  I do read him some.

Date: 2006/05/09 06:43:56, Link
Author: afdave
Quote
But here we are, a few days later, and now you're back to insisting that humans aren't even related to apes (despite the fact that humans are apes). Are we now going to have to assume that points you conceded a week ago are no longer conceded? Does this mean we're going to have to go over the same ground again and again with you, à la Thordaddy? Because that will get old very quickly.


No, no.  We will not have to cover anything over again.  I DO agree with all those things I said I agree with.  

I agree that I need to explain more fully why I believe the similarities favor Common Design over Common Descent.  I will try to address this soon.

Thanks

Date: 2006/05/11 04:21:26, Link
Author: afdave
Good morning to all my "Evo" friends ...

The Vitamin C issue with apes and humans seems to be a very compelling evidence for you that Apes and Humans do indeed share a common ancestor.

OK.  Let's take a look.  I assume everyone is familiar with the Talk Origins article my Dr. Edward Max here and the AIG article by Woodmorappe here, right?

Dr. Max begins with an analogy to a plagiarism case ...
Quote
One way to distinguish between copying and independent creation is suggested by analogy to the following two cases from the legal literature. In 1941 the author of a chemistry textbook brought suit charging that portions of his textbook had been plagiarized by the author of a competing textbook (Colonial Book Co, Inc. v. Amsco School Publications, Inc., 41 F. Supp.156 (S.D.N.Y. 1941), aff'd 142 F.2d 362 (2nd Cir. 1944)). In 1946 the publisher of a trade directory for the construction industry made similar charges against a competing directory publisher (Sub-Contractors Register, Inc. v McGovern's Contractors & Builders Manual, Inc. 69 F.Supp. 507, 509 (S.D.N.Y. 1946)). In both cases, mere similarity between the contents of the alleged copies and the originals was not considered compelling evidence of copying. After all, both chemistry textbooks were describing the same body of chemical knowledge (the books were designed to "function similarly") and both directories listed members of the same industry, so substantial resemblance would be expected even if no copying had occurred. However, in both cases errors present in the "originals" appeared in the alleged copies. The courts judged that it was inconceivable that the same errors could have been made independently by each plaintiff and defendant, and ruled in both cases that copying had occurred. The principle that duplicated errors imply copying is now well established in copyright law. (In recognition of this fact, directory publishers routinely include false entries in their directories to trap potential plagiarizers.)


Now I have read both articles in their entirety, but before Dr. Max even gets into the details of gene "mistakes", there is one very large item jumps out at me. The analogy seems very clever, but there is a huge assumption that is made which I consider to be invalid and to me this destroys the whole analogy.  See what you think and please correct me if I am wrong.

OK.  Are you ready?  With the plagiarism case, we are talking about printed words in a well-known language.  In the GLO gene case, we are talking about genetic "words" in a poorly-understood language.  I hope I don't have to cite the recent literature to prove to you how poorly we understand the genetic language.  If you do a Google Scholar search, you will see numerous articles talking about pseudogene and "junk DNA" function and how much we are learning and how much there is remaining to be learned.  Here's just one with an appropriate comment from Woodmorappe ...
Quote
Balakirev, E.S. and Ayala, F.J., Pseudogenes: are they ‘junk’ or functional DNA? Annual Review of Genetics 37:123–151, 2003. The very title of this article would have, only a few years ago, been almost on a par with the following: ‘The Earth: is it spherical or flat?’


Are you with me so far?  I don't want to lose anyone.  Again, I am saying that ...

With the plagiarism case, we are talking about printed words in a well-known language.  In the GLO gene case, we are talking about genetic "words" in a poorly-understood language.  This is a big, big difference.

Notice again that Dr. Max's whole argument rests on the following ...
Quote
In both cases, mere similarity between the contents of the alleged copies and the originals was not considered compelling evidence of copying ... The principle that duplicated errors imply copying is now well established in copyright law.


Do you see where I am going?  Dr. Max is assuming that the state of the GLO gene in humans and apes is an error and with our as yet limited knowledge of gene function, genome function as a whole, pseudogene function discoveries, and "not-junk-after-all" discoveries about "junk DNA", this seems to be an enormous unwarranted assumption.  If, in fact, this GLO gene turns out to have some function, then Max's whole argument fails, because now the gene would be rightly interpreted as part of the correct informational content analogous to the correct informational content in the textbooks.

To emphasize this point, consider a passage of text from a language which you do not know, but I do (my dad's jungle tribe for whom he is a Bible translator).  In this case, I am playing the role of the hypothetical "Designer" and you are playing the role of the genetic researcher trying to unlock the code.    Let us say the above plagiarism case involved the following text ...

Quote

ORIGINAL TEXT:  Twaihsom me thakwa xatkene roowo pono komo ahnoro.  Yipinin yaw so tko xakne Kaan.  Ero ke Tumumuru tak nimyakne rma okwe twaihsom mera tak ehtome so.  Waipini ro me xa matko naxe Noro pona enine komo.

ALLEGED PLAGIARIZED TEXT:  Twaihsom me thakwa xatkene roowo pono komo.  Yipinin yaw so xakne Kaan.  Ero ke Tumumuru tak nimyakne okwe twaihsom mera tak ehtome so. Waipini ro me naxe Noro pona enine komo.


While a word by word comparison of the above text gives some evidence of plagiarism, i.e. they are similar, you cannot conclude this positively if we use the court case guidelines because you do not know the language so as to be able to detect errors.

Now I DO know the language, so I can identify an error, namely that the word "cewnaninhiri" which means "only begotten" (it is John 3:16) is left out of both texts.

So we see that for Dr. Max's argument to be valid, we have to know the language which obviously, genetic researchers do not yet very well.


Now there is something else interesting here.  This text of John 3:16 could be rendered in a number of different ways and yet communicate the same meaning.  For example, we could say ...
Quote
Yipinin yaw so xakne Kaan roowo pono komo poko. Ero ke Tumumuru tak nimyakne okwe twaihsom mera tak ehtome so. Waipini ro me naxe Kaan pona enine komo.


I know the language well enough to know that this would communicate the same message, but with different structure.

Now, back to biology.  It is my theory that this is exactly the situation which we will find in the genomes of various organisms as we understand more and more about them every year.  I predict that we will find that the genetic code is a very real language, complete with "words", "sentences", "phrases", "paragraphs", and different ways of saying the same thing.

Now, here is something else ...

How do you explain the similarity of the GLO gene "defects" of humans and guinea pigs? (you knew I was going to go here, didn't you)  Apparently, something like 36% of the substitutions are the same when compared to the functional rat GLO gene.  If we assume that there is some pro-simian ancestor that has a functional GLO gene, then it would appear that humans are more closely related to guinea pigs than to this pro-simian ancestor.  This would seem to defy the evolutionary scenario.  How do you explain this?

OK.  There's some food for thought.  Now pick me apart.


Oh ... and here the quote from Balakirev and Ayala for you

Quote
Annual Review of Genetics
Vol. 37: 123-151 (Volume publication date December 2003)
(doi:10.1146/annurev.genet.37.040103.103949)

First published online as a Review in Advance on June 25, 2003

PSEUDOGENES: Are They "Junk" or Functional DNA?

Evgeniy S. Balakirev1,2 and ­Francisco J. Ayala1­
1Department of Ecology and Evolutionary Biology, University of California, Irvine, California 92697-2525; email: fjayala@uci.edu

2Institute of Marine Biology, Vladivostok 690041,

Russia and Academy of Ecology, Marine Biology, and Biotechnology, Far Eastern State University, Vladivostok 690600, Russia; email: esbalak@bio.dvgu.ru

Pseudogenes have been defined as nonfunctional sequences of genomic DNA originally derived from functional genes. It is therefore assumed that all pseudogene mutations are selectively neutral and have equal probability to become fixed in the population. Rather, pseudogenes that have been suitably investigated often exhibit functional roles, such as gene expression, gene regulation, generation of genetic (antibody, antigenic, and other) diversity. Pseudogenes are involved in gene conversion or recombination with functional genes. Link to article




And here's one I like from Dr. Max that confirms what us YECers so often say about mutations ...
Quote
Mutations causing genetic diseases and malformations are generally so detrimental to the organism's survival and reproductive success that in the wild--i.e. in the absence of modern medical science--they would tend to be "weeded out" by the pressure of natural selection. Rarely, mutations can be beneficial to an organism: these rare cases form the basis for evolutionary adaptations that improve the "fitness" of an organism to its environment.Link to article

Date: 2006/05/11 04:26:20, Link
Author: afdave
And now, while you all are busy refuting me on this thread, I will hop back over to the "Creator God Hypothesis" thread and dive in again ...

It appears that no one accepts the evidence for a Creator I have given so far, so we will explore that some and find out why ...

See you there ... :-)

Date: 2006/05/11 04:36:50, Link
Author: afdave
Also check the "AF Dave wants you to prove Evolution to him" thread ...

I will be posting some questions there directly out of a children's book about evolution ...

It's called (ingeniously) "Evolution" and it is from the DK Eyewitness series.  It is pretty recent (2000).

That should be fun as well !!

Date: 2006/05/11 05:54:59, Link
Author: afdave
Quote
I haven't read any of those vitamin c articles you mentioned, but I think  your missing the point. The pseudogene may have function but is no longer a gene which produces a protein involved vitamin C synthesis. It is good evidence for common descent whether or not the pseudogene has function. Am I missing something there?


My point is that your statement and Dr. Max's statement assumes that somewhere back in time, the GLO gene functioned to produce vitamin C, but now no longer does.  I am just saying that I think this assumes too much, namely that we know what the gene used to be like.  We do not know this.  All we really know is that ... (a) it is somewhat similar to the functional rat GLO gene (149 out of 647 substitutions when comparing humans to rats, 96 out of 647 substitutions when comparing guinea pigs to rats), and (b) that humans cannot synthesize their own Vitamin C. (we are presuming that this is because the GLO gene is "broken", and we are assuming that other primates GLO genes are almost identical to ours) (a safe bet probably, but it has not been determined yet)

What reason do we have to assume that the modern GLO gene in humans ever was used for Vitamin C production?  As I said, we really don't know the language that well yet ... my understanding is that we have just scratched the surface ... it is entirely reasonable to me that the supposed "broken GLO gene" has always had a function which has nothing to do with Vitamin C production.  In any case, we cannot determine that it is broken until we know the language better, just as you could not determine the error in my text examples.

Quote
However, it somehow seems to have escaped your notice that large parts of this DNA language are well understood and that there was enough detail in the Dr. Max article to make good comparisons. Your question is even addressed in his article:

Quote  

Imagine a defendant at a murder trial defending himself--against overwhelming incriminating evidence--with the parallel argument: that since some convicted criminals have later been exonerated, he (the current defendant) should therefore be acquitted now, because someday in the future, evidence might be found to clear him! This defense would be as ridiculous as Dr. Gish's argument is.


No.  I read that part.  I am in no way defending Gish's argument.

I am making my own and it is entirely different.  The paragraph above is talking about letting the guy off because of future evidence we may have in the future.

My argument recognizes that we don't have evidence RIGHT NOW to convict the guy.  To make the analogy correct, imagine that the judge and jury only spoke French and there was no interpreter.  Now they could not convict him on evidence which was written in English because they could not even determine what an error is.

This is situation we have in genetics today.

Date: 2006/05/11 06:20:15, Link
Author: afdave
Quote
Then, you notice a paragraph of about 400 characters that's identical in both samples. It's not in the same place in both texts, but it is absolutely identical down to the individual character. You even note that at the end of the fifth sentence, there's an extra period. You have no idea what any of the text means, but is there any doubt, at this point, that one sample was in fact at least partially copied from the other? Is there any possible doubt that both articles share a common provenance?

You don't need to know anything whatsoever about the language to make this determination, Dave. And it is far from true that biologists know nothing at all about the genetic code. In fact, they may not know what all the "paragraphs" (i.e., genes) in the genetic code mean, but they sure know what the "words" (i.e., codons) mean.


Are you saying that this is what has been found?  I did not understand that from the findings of the authors below ...

My knowledge of this
Quote
All we really know is that ... (a) it is somewhat similar to the functional rat GLO gene (149 out of 647 substitutions when comparing humans to rats, 96 out of 647 substitutions when comparing guinea pigs to rats),

comes from this
Quote
Inai, Y., Ohta, Y. and Nishikimi, M., The whole structure of the human non-functional L-gulono-ã-lactone oxidase gene—the gene responsible for scurvy—and the evolution of repetitive sequences thereon, J. Nutritional Science and Vitaminology (Tokyo) 49(5):315–319, 2003.


Apparently we do not have a situation of identical sequences if I am reading this correctly.  Or maybe there is another study that I could not find which states that the human and ape GLO genes ARE identical?

Date: 2006/05/11 06:35:19, Link
Author: afdave
Again ... IF we find the GLO gene sequences identical (or very close) in apes (I think we only have rat, human and GP currently), why does this prove common descent of apes and humans?  We do not KNOW that the human (and presumable ape) manifestation is in fact an "error" because we don't know the genetic language well enough yet.  All we know is that BOTH apes and humans cannot synthesize Vitamin C.  It is and ASSUMPTION to say that "see it's because their GLO gene is broken."  How can you say that?  Maybe that's was never intended to BE a GLO gene in the first place.  You don't know because you don't know the language well enough yet.

My bet is that when we DO learn the language well enough, we will see it has a purpose far different that Vitamin C production.

Here's another analogy ...

Do you think that "The dog is barking" and "The dog is barfing" means that the second sentence is somehow "broken"??  Of course not.  They are both valid sentences but they mean ENTIRELY different things.

Also, in our language, the same words can mean two different things in different contexts, i.e. "bark" (dog) and "bark" (on a tree).

I really think Dr. Max is making a bad analogy and assuming too many things.

Date: 2006/05/11 07:18:58, Link
Author: afdave
It is obvious to me that many of you do not accept "Cosmic Fine Tuning" and "Biological Machines" as evidence that supports the idea of an Intelligent Creator (or at least Designer), in spite of the fact that Talk Origins does not refute Cosmic Fine Tuning when we all know they would if they could, and many scientists (non-YEC/ID) have written about the wonders of biological "machines" and "factories".  Soooo ....

Let me backtrack and re-establish those points first.

**********************COSMIC FINE TUNING*******************************

Again, Meyer summarizes evidence for Cosmic Fine Tuning quite well ...
Quote
THE BIG BANG AND GENERAL RELATIVITY
During the twentieth century, a quiet but remarkable shift has occurred in
science. Evidence from cosmology, physics, and biology now tells a very
different story than did the science of the late nineteenth century. Evidence from
cosmology now supports a finite, not an infinite universe, while evidence from
physics and biology has reopened the question of design.
In 1915-16, Albert Einstein shocked the scientific world with his theory of
general relativity (Chaisson & McMillan 1993: 604-5). Though Einstein s theory
challenged Newton s theory of gravity in many important respects, it also implied
(as did Newton s) that the universe could not be static, but instead was
simultaneously expanding and decelerating. According to relativity theory,
massive bodies alter the curvature of space so as to draw nearby objects to them.
Einstein s conception of gravity implied that all material bodies would congeal
unless the effects of gravitation were continually counteracted by the expansion of
space itself (Eddington 1930). Einstein s theory thus implied an expanding, not a
static, universe.
Einstein disliked this idea, in part for philosophical reasons. An actively
expanding universe implied a beginning to the expansion, and thus, to the
universe. As the Russian physicist Alexander Friedmann (1922: 377-86) showed,
general relativity implied that, in the words of Stephen Hawking, at some time in
the past (between ten and twenty thousand million years ago) the distance
between neighboring galaxies must have been zero (1988: 46). Relativity theory
suggested a universe of finite duration racing outward from an initial beginning in
the distant past. For Einstein, however, a definite beginning to the universe
seemed so counterintuitive that he introduced an arbitrary factor in his theory to
eliminate the implication. In 1917, he postulated a repulsive force, expressed by
his cosmological constant, of precisely the magnitude necessary to counteract
the expansion that his theory implied.1 Like Newton, Einstein inadvertenly
concealed an important cosmological reality implicit in his theory.
Yet the heavens would soon talk back. In the 1920s-30s, Edwin Hubble, a
young lawyer-turned-astronomer, made a series of observations that shocked even
Einstein. While working at the Mt. Wilson Observatory in Southern California,
Hubble discovered for the first time that our Milky Way galaxy is but one of
many galaxies spread throughout the universe. More important, he discovered that
the galaxies beyond the Milky Way are rapidly receding from ours. Hubble
noticed that the light from these distant galaxies was shifted toward the red-end of
the electromagnetic spectrum. This red-shift suggested recessional movement,
for the same reason the so-called Doppler Effect that a train whistle drops in
pitch as a train moves away from a stationary observer. Hubble also discovered
that the rate at which these other galaxies retreat from ours is directly related to
their distance from us just as if the universe were undergoing a spherical
expansion in all directions from a singular explosive beginning the big bang
(1929: 168-73).
During the remainder of the twentieth century, physicists and cosmologists
formulated several alternatives to the Big Bang theory that preserved an infinite
universe. Some of these cosmological models were formulated for explicitly
philosophical reasons. For example, in the late 1940s, Fred Hoyle, Thomas Gold,
and Hermann Bondi proposed the steady state model to explain galactic
recession without invoking the objectionable notion of a beginning. According to
their theory, as the universe expands new matter is generated spontaneously in the
space between expanding galaxies. On this view, our galaxy is composed of
matter that spontaneously popped into existence between other galaxies, which in
turn came out of the empty space between other galaxies, and so on (Bondi &
Gold 1948; Hoyle 1948). Thus, the steady state theory denied the need to
postulate a singular beginning, and reaffirmed an infinite universe without
beginning or end.
By the mid-1960s, however, Hoyle s theory had run aground as the result of
a discovery made by two employees of Bell Telephone Laboratories in New
Jersey. According to the steady state model, the density of the universe must
always remain constant, hence the creation of new matter as the universe expands.
Yet in 1965, the Bell Lab researchers, Arno Penzias and Robert Wilson, found
what physicists believed to be the radiation left over from the universe s initial
hot, high-density state (1965: 419-21). The discovery of this cosmic background
radiation, at roughly 2.7 degrees Kelvin equivalent, proved decisive. Physicist
George Gamow had predicted its existence as a consequence of the Big Bang
(1946: 572-73). Yet advocates of the steady state acknowledged that, given their
model, such radiation should not exist. The steady state theory also implied that
galaxies should have radically different ages, but advances in observational
astronomy have revealed that galactic ages cluster narrowly in the middle-age
range. By the 1970s, even Bondi, Gold, and Hoyle had abandoned their theory
(Kragh 1993: 403).
Following the demise of the steady state model, the oscillating universe
model arose as an alternative to a finite universe. Advocates of this model
envisioned a universe that would expand, gradually decelerate, shrink back under
the force of its own gravitation, and then, by some unknown mechanism, reinitiate
its expansion, on and on, ad infinitum. But, as physicist Alan Guth
showed, our knowledge of entropy suggests that the energy available to do the
work would decrease with each successive cycle (Guth & Sher 1983: 505-7).
Thus, presumably the universe would have reached a nullifying equilibrium long
ago if it had indeed existed for an infinite amount of time. Further, recent
measurements suggest that the universe has only a fraction about one-fifth of
the mass required to create a gravitational contraction in the first place (Peebles
1993: 475-83; Coles & Ellis 1994: 609-13; Sawyer 1992: A5; Ross 1993: 58).
Prior to the formulation of the oscillating universe theory, three
astrophysicists, Hawking, George Ellis, and Roger Penrose, published a series of
papers that explicated the implications of Einstein s theory of general relativity
for space and time as well as matter and energy (Hawking & Penrose 1970).
Previously, physicists like Friedmann showed that the density of the universe
would approach an infinite value as one extrapolated the state of the universe
back in time. In a series of papers written between 1966-70, Hawking and his
colleagues showed that as one extrapolated back in time the curvature of space
also approached infinity. But an infinitely curved space corresponds to a radius
(within a sphere, for example) of zero and thus to no spatial volume. Further,
since in general relativity space and time are inextricably linked, the absence of
space implies the absence of time. Moreover, neither matter nor energy can exist
in the absence of space. Thus, Hawking s result suggested that general relativity
implies that the universe sprang into existence a finite time ago from literally
nothing, at least nothing physical. In brief, general relativity implies an absolute
beginning of time, before which neither time and space, nor matter and energy,
would have existed.

The space-time theorem of general relativity was, of course, conditional. It
stated that, if general relativity obtains for the universe, then space and time
themselves must have originated in the same initial explosion that created matter
and energy. In a series of experiments, beginning just two years after Einstein
published his results and continuing on to the present, the probable error of
general relativity (estimated quantitatively) has shrunk from 10 to 1 to .05
percent, to a confirmation out to the fifth decimal place. Increasingly accurate
tests conducted by NASA, such as the hydrogen maser detector carried by a
NASA rocket in 1980 and 1994, have continued to shrink the probable error
associated with the theory (Ross 1993: 66-67; Vessor 1980: 2081-84). Thus,
general relativity now stands as one of the best confirmed theories of modern
science. Yet its philosophical implications, and those of the Big Bang theory, are
staggering. Taken jointly, general relativity and the Big Bang theory provide a
scientific description of what Christian theologians have long described in
doctrinal terms as creatio ex nihilo Creation out of nothing (again, nothing
physical). These theories place a heavy demand on any proposed causal
explanation of the universe, since the cause of the beginning of the universe must
transcend time, space, matter, and energy.
Link to article


Is this refuted at Talk Origins?  No ... all he does at the end of the paragraph is point out in effect "well, maybe that's true in OUR universe, but what about other universes?"  Now I don't want to get into other funky ideas like parallel universes as Faid tried to get me to do.  My point is made by noting simply that T.O. agrees that Yes, in fact, OUR universe is fine tuned for life.  Here's the T.O piece again.

Quote
In recent years, creationist theologians, and even a few physicists, have heavily promoted what they claim is a remarkable fine-tuning of the basic laws and constants of physics, without which life as we know it would never have developed (Barrow, 1986; Rolston III). If the universe had appeared with slight variations in the strengths of the fundamental forces or the masses of elementary particles, that universe would be pure hydrogen at one extreme, or pure helium at the other. Neither would have allowed for the eventual production of heavy elements, such as carbon, necessary for life. Similarly, if gravity had not been many orders of magnitude weaker than electromagnetism, stars would not have lived long enough to produce the elements of life. Long before they could fabricate heavy chemical elements, stars would have collapsed. Only the fact that the gravitational force was forty orders of magnitude weaker prevented this from happening. In a calculation similar to Hoyle's, mathematician Roger Penrose has estimated that the probability of a universe with our particular set of physical properties is one part in 1010123 (Penrose 1989: 343). However, neither Penrose nor anyone else can say how many of the other possible universes formed with different properties could still have lead to some form of life. If it is half, then the probability for life is fifty percent. Link to article




**********************BIOLOGICAL MACHINES********************************

Again we have numerous non-YEC/non-ID authors talking about all the wonderful "adaptations" and "molecular machines" and "molecular factories" and many of them trying very hard to say "these LOOK designed, but trust us ... they are not (wink wink)."  I won't bore you with Denton and Behe's examples again, but I will repeat this one.  Bruce Alberts, President of the National Academy of Sciences, introduced this issue with an article entitled, The Cell as a Collection of Protein Machines.  In his article, Alberts admits that
Quote
We have always underestimated cells . . . . The entire cell can be viewed as afactory that contains an elaborate network of interlocking assembly lines, each of which is composed of a set of large protein machines . . . Why do we call the large protein assemblies that underlie cell function protein machines? Precisely because, like machines invented by humans to deal efficiently with the macroscopic world these protein assemblies contain highly coordinated moving parts (Alberts, Bruce. 1998. The Cell as a Collection of Protein Machines: Preparing the NextGeneration of Molecular Biologists. Cell 92 (8 February): 291-94).


And again, we have Richard Dawkins standing with Paley in amazement at nature's innovations, spending an entire chapter on the intricacies of bat echolocation, then basically saying "We know this LOOKS like a duck, WALKS like a duck, and QUACKS like a duck, but let me spend the next 8 chapters convincing you it IS NOT a duck."

Come guys, this seems like snake oil at its best.


***********************OUR EVIDENCE SO FAR****************************

We observe Cosmic Fine Tuning and we say "Hmmmm ... what a conicidence that all these parameters are just right for life to exist.  If any of them were off, we would all die.  How can this just be coincidence?  Maybe its not!"

We observe Biological Machines and we say "Hmmm ... these are pretty sophisticated and capable little jiggers.  They exhibit many technologies FAR beyond some of our own 21st century technology. How do they do that?  Could these have self-assembled from the 100 or so elements on the periodic table by themselves.  Hmmm ... pretty unlikely.  I wonder if they could be designed?  Wow!  What a thought!"

Now I realize we still have a LONG way to go to prove the God of the Bible, but let's not even go there now ... we'll get there at the right time.  The only thing I'm trying to do now is show you ...

HOW UNREASONABLE SOUNDING IT IS TO NOT CONSIDER THE POSSIBILITY OF AN INTELLIGENT DESIGNER

Forget "God" for now ... forget the Bible for now ... forget inerrancy, and the Flood and all the rest ... let's just deal with this one basic issue.  Yes, Eric, we're going to get to age of the earth and all those other things, but let's just get this one out of the way first ... otherwise, the rest doesn't matter.

The two pieces of evidence -- Cosmic Fine Tuning and Bilogical Machines seem HUGE to me.

Can you really with a straight face rule out the possiblity of an Intelligent Designer (even a super alien or a super computer in space) ??

This seems like a massive logical mistake to me.

Date: 2006/05/11 07:22:39, Link
Author: afdave
Quote
Can you tell me what a "frameshift mutation" is?
Can you tell me the significance of a frameshift mutation?

Somewhat familiar ... I can read up on it quickly if I need to ...

But go ahead ... why is that significant here?  I honestly want to understand this

Quote
Yeah. Look at the cytochrome c gene.
I thought were talking about the GLO gene which supposedly formerly allowed Vit C production in primates, but now is broken and does not anymore.  Why do you mention Cytochrome C genes?

Date: 2006/05/11 07:40:26, Link
Author: afdave
Quote
What if "The dog is barking" and "The dog is barfing" were two sentences from two different novels that were 95+% similar?

You seem to be forgetting the Vitamin C stuff happens in that kind of context.


No I'm not forgetting.  But OK.  Let's write a "novel" describing how to make a pine tree and another "novel" that describes how to make an oak tree.  OK?

HOW TO MAKE A PINE TREE
Start with a 50 foot long piece of soft wood.  Add some rough bark.  Poke it upright in the ground.  Add some kinda straight branches that angle down.  Add leaves that are thin and poky.  Etc. Etc.

Voila!  Pine Tree!

HOW TO MAKE AN OAK TREE
Start with a 50 foot long piece of hard wood.  Add some semi-rough bark.  Poke it upright in the ground.  Add some kinda crooked branches that angle up.  Add leaves that are broad and smooth.  Etc. Etc.

Voila!  Oak Tree!

Now ... notice they are 95% (or so) similar?  Do they share a common ancestor?  No.  I assembled them in my backyard with raw materials following these highly detailed instructions. (I didn't really, but I could have)

The burden of proof for Common Descent seems to me to be much more difficult that the burden of proof on Common Design.

Thoughts?

Date: 2006/05/11 07:59:04, Link
Author: afdave
Quote
We call them "machines" because they have some trivial similarities to man made machines, that does not mean they are designed. They are complex, this does not mean they are designed. They perform functions, this does not mean they are designed. Dawkins writes popular science books, I will agree that they look designed to a layman who does not have a good grasp of the relevant topics in evolution and biochemistry.

Trivial!  Trivial!  I just choke on that!  To me, biological systems are the most profound antithesis of "triviality" that one can possibly imagine!

Have you waded through the supposed scenario for how a flagellum supposedly could have evolved on Talk Origins?

I have and it seems to me to be First Rate Alice in Wonderland!  The author proposes this and that and this and that and goes on and on proposing a myriad of things for which I can see absolutely no basis for believing it could possibly happen except for wishful, hopeful thinking.

How is this scientific to discard our intuition about things with "complex specificity" and build grand imaginary castles of how it "might have happened" when we really have never had any experience at all with it ACTUALLY happening that way?  Wishful thinking par excellence if you ask me.

Quote
Although I have not read much about cosmic fine tuning, my concern is this: If there is no divine creator, life can only exist in a universe that has the correct constants. If there is a divine creator, life could be created in a very unhospitable universe. Does this disprove God? No, but the point is there is no proof that these constants were set by a creator. For the purposes of the argument on evolution I am prepared to accept that they are however.

Well, yes life could exist in an unhospitable universe, but why in the world would the Creator do that?  Then he'd have to basically be performing miracles every nano-second to sustain life.  I would not postulate that.  This to me has nothing to do with it.  I am simply saying this -- nothing else -- that "Doggone it ... this universe sure is suited nicely for life ... how did that happen?  Is there maybe, maybe, maybe a possibility that maybe, maybe, maybe "someone" could have set the parameters that way?  It seems silly to not even consider this possibility.

Date: 2006/05/11 08:08:53, Link
Author: afdave
Quote
Wrong again, pine breath! You are the common ancestor of both.

Hey watch it, oak breath ... I am the common DESIGNER of both :-)

Quote
It's hard to judge as you haven't presented any evidence for common design.
This is what the ID movement is all about.  Stay tuned!  And tell your friends to quit throwing fire bombs and at least listen .... then make judgment.

That's the hard part -- even getting people to listen --because most people are so set in their thinking.

Well ... I'm quitting until evening ... so I guess I'm gonna start losing now by default.

Date: 2006/05/11 13:49:31, Link
Author: afdave
WORDS TO LIVE BY
Francis Crick in What Mad Pursuit (New York; Basic Books, 1988) p. 138

"Biologists must constantly keep in mind that what they see was not designed, but rather evolved."

OK, Francis ...

THIS IS NOT DESIGNED
(but it looks designed)
BUT IT'S NOT DESIGNED
(but it looks designed)
BUT IT'S NOT DESIGNED
(but it looks designed)
BUT IT'S NOT DESIGNED
(but it looks designed)
BUT IT'S NOT DESIGNED
(but it looks designed)
BUT IT'S NOT DESIGNED
(but it looks designed)
BUT IT'S NOT DESIGNED

HOMINA, HOMINA, HOMINA

AMEN and AMEN

Date: 2006/05/12 06:58:17, Link
Author: afdave
Good morning everyone--

We are getting close to wrapping up this thread and I feel it is an important thread because the differences between apes and humans are in fact immense, and whether you realize it or not, there are many major issues riding on the answer to the question, "Common Descent or Common Design?"  

The bottom line, of course, is ...

IF Common Descent is true, then there is no need for a Creator.  Humans are free to believe in one, or pretend there is one, or whatever.  None of the 'God talk' really matters much and those who don't care to participate in 'God think' are free to leave 'Him' completely out of their thoughts and discussions.  There is no afterlife, no heaven, no ####, no judgment for actions in this life, and the best we can do is live in harmony with our fellow man and have a good time until we die.  And when we die, that's the end of the story.

However, IF Common Design is true, then this raises a whole string of potentially life changing questions.  What is this Designer like?  Is it one Designer?  Or many?  If He designed ME, does he want anything from me?  The Creation myths are well known ... could there be any truth to any of them?  After all, there is one in particular that speaks of a Creator God who will someday hold humans accountable for their actions.  Could there be any truth to this?  Could it be that the Creator God spoken of in the Bible might in fact be one and the same as the Designer of the Cosmos and Biological Systems for which evidence continues to mount?

I think it was Renier (can't remember for sure) who said that he "used to be a YEC fundy" but is no longer because of the Vitamin C issue.

Just to recap yesterday ... Talk Origins has two relevant articles that I found

(1)  Plagiarized Errors and Molecular Genetics
Another argument in the evolution-creation controversy
by Edward E. Max, M.D., Ph.D.

and

(2)  29+ Evidences for Macroevolution, Part 2: Past History
Copyright © 1999-2004 by Douglas Theobald, Ph.D.
Prediction 2.3: Molecular vestigial characters

Abstracts for the 3 articles referred to by the second article are as follows:
Quote
Abstracts from Talk Origins:  29+ Evidences - Vitamin C Pseudogene

1: J Biol Chem. 1992 Oct 25;267(30):21967-72. Related Articles, Links  
Guinea pigs possess a highly mutated gene for L-gulono-gamma-lactone oxidase, the key enzyme for L-ascorbic acid biosynthesis missing in this species.
Nishikimi M, Kawai T, Yagi K.
Institute of Applied Biochemistry, Yagi Memorial Park, Gifu, Japan.
Guinea pigs cannot synthesize L-ascorbic acid because of their deficiency in L-gulono-gamma-lactone oxidase, a key enzyme for the biosynthesis of this vitamin in higher animals. In this study we isolated the L-gulono-gamma-lactone oxidase gene of the rat and the homologue of this gene of the guinea pig by screening rat and guinea pig genomic DNA libraries in lambda phage vectors, respectively, using a rat L-gulono-gamma-lactone oxidase cDNA as a probe. Sequencing analysis showed that the amino acid sequence of the rat enzyme is encoded by 12 exons and that all the intron/exon boundaries follow the GT/AG rule. On the other hand, regions corresponding to exons I and V were not identified in the guinea pig L-gulono-gamma-lactone oxidase gene homologue. Other defects found in this gene homologue are a deletion of the nucleotide sequence corresponding to a 3' 84-base pair part of rat exon VI, a 2-base pair deletion in the remaining exon VI-related region, and nonconformance to the GT/AG rule at one of the putative intron/exon boundaries. Furthermore, a large number of mutations were found in the amino acid-coding regions of the guinea pig sequence; more than half of them lead to nonconservative amino acid changes, and there are three stop codons as well. Thus it is clear that the guinea pig homologue of the L-gulono-gamma-lactone oxidase gene exists as a pseudogene that randomly accumulated a large number of mutations without functional constraint since the gene ceased to be active during evolution. On the basis of the neutral theory of evolution, the date of the loss of L-gulono-gamma-lactone oxidase in the ancestors of the guinea pig was roughly calculated to be less than 20 million years ago.

J Biol Chem. 1994 May 6;269(18):13685-8. Related Articles, Links  
Cloning and chromosomal mapping of the human nonfunctional gene for L-gulono-gamma-lactone oxidase, the enzyme for L-ascorbic acid biosynthesis missing in man.
Nishikimi M, Fukuyama R, Minoshima S, Shimizu N, Yagi K.
Institute of Applied Biochemistry, Yagi Memorial Park, Gifu, Japan.
Man is among the exceptional higher animals that are unable to synthesize L-ascorbic acid because of their deficiency in L-gulono-gamma-lactone oxidase, the enzyme catalyzing the terminal step in L-ascorbic acid biosynthesis. In the present study, we isolated a segment of the nonfunctional L-gulono-gamma-lactone oxidase gene from a human genomic library, and mapped it on chromosome 8p21.1 by spot blot hybridization using flow-sorted human chromosomes and fluorescence in situ hybridization. Sequencing analysis indicated that the isolated segment represented a 3'-part of the gene, where the regions corresponding to exons VII, IX, X, and XII of the rat L-gulono-gamma-lactone oxidase gene remain with probable deletion of the regions corresponding to exons VIII and XI. In the identified exon regions were found various anomalous nucleotide changes, such as deletion and insertion of nucleotide(s) and nonconformance to the GT/AG rule at intron/exon boundaries. When the conceptual amino acid sequences deduced from the four exon sequences were compared with the corresponding rat sequences, there were a large number of nonconservative substitutions and also two stop codons. These findings indicate that the human nonfunctional L-gulono-gamma-lactone oxidase gene has accumulated a large number of mutations without selective pressure since it ceased to function during evolution.

Biochimica Biophysica Acta, International Journal of Biochemistry and Biophysics,(ISSN: 00063002) 1999 Oct 18;1472(1-2):408-11.  Related Articles, Links
Random nucleotide substitutions in primate nonfunctional gene for L-gulono-gamma-lactone oxidase, the missing enzyme in L-ascorbic acid biosynthesis.
Ohta Y, Nishikimi M.
Department of Biochemistry, Wakayama Medical College, Japan.
Humans and other primates have no functional gene for L-gulono-gamma-lactone oxidase that catalyzes the last step of L-ascorbic acid biosynthesis. The 164-nucleotide sequence of exon X of the gene was compared among human, chimpanzee, orangutan, and macaque, and it was found that nucleotide substitutions had occurred at random throughout the sequence with a single nucleotide deletion, indicating that the primate L-gulono-gamma-lactone oxidase genes are a typical example of pseudogene.



The first article above compares the functional rat GLO gene with the supposedly homologous guinea pig GLO gene and finds significant differences.  They say "Thus it is clear that the guinea pig homologue of the L-gulono-gamma-lactone oxidase gene exists as a pseudogene that randomly accumulated a large number of mutations without functional constraint since the gene ceased to be active during evolution."

The second article does the same comparison for rats and humans and concludes ... "These findings indicate that the human nonfunctional L-gulono-gamma-lactone oxidase gene has accumulated a large number of mutations without selective pressure since it ceased to function during evolution."

The third article does the same comparison among humans, chimpanzees, orangutans, and macaques, and it was found that "nucleotide substitutions had occurred at random throughout the sequence with a single nucleotide deletion, indicating that the primate L-gulono-gamma-lactone oxidase genes are a typical example of pseudogene."

Dr. Max draws on these findings and compares the situation to a copyright court case.  His argument is that since apes and humans have the same "errors" in the "broken GLO gene", this shows that apes and humans have a common ancestor.

Now this has one HUGE assumption which appears to me to be entirely unwarranted.  now maybe it is warranted,  but no one gave me any reasons that it should be yesterday

DR. MAX's HUGE ASSUMPTION
The apparently homologous "GLO gene" in humans, primates and guinea pigs used to function to produce Vitamin C, but now no longer does.  As such this constitutes a "broken gene" caused by random mutation.  My question is ... why do you assume these 3 organisms EVER had a functioning GLO gene?  Maybe this gene DOES HAVE a function which we just don't know about.  After all, we are seeing a dramatic reversal in the area of pseudogenes.  Scientists are all of a sudden finding all kinds of purpose for them.  Do a Google Scholar search to see this.

Does anyone have any good arguments for why this is a good assumption to make?

Because Dr. Max's whole argument rests on this being a valid assumption.  If it is not valid, then his whole argument fails.

OK ... now tell me ... why is this assumption valid?

(By the way, Tom Ames, I didn't see that frame shift mutations have anything to do with this discussion, but please correct me if I am wrong)

Date: 2006/05/12 13:40:23, Link
Author: afdave
Thanks to Tom Ames for clarifying one point -- I thought you were bringing up something that was relevant to our discussion of the supposedly "broken GLO gene", but apparently I was mistaken.  

Maybe it's time for a review again.  I'll put it in bold so no one will miss it ... then I'll repeat it a few days from now for the slow ones

THINGS THAT ARE NOT AF DAVE'S GOALS
(1)  Get a biology degree
(2)  Become a genetic engineer
(3)  Get an advanced science degree
(4)  Become a biochemical researcher
(5)  Pretend I know more about biology than you
(6)  Become a geologist
(7)  Become an astrophysicist

OK?  ... again, I appreciate all the admonitions to get this or that degree or go buy this or that book ... but it's not necessary ... there are plenty of competent researchers like Mr. Nishikimi out there who give me the data I need, and of course I do have YOU ALL to keep me straight.

And I should point out that you guys do a great job of knowing biology and the workings of DNA and transcription and chromosomes and all these wonderful details.

Your problem is NOT your comprehension of the data or in understanding the mechanics of how things work.  You are even quite good at explaining this stuff -- Incorygible did a great job explaining the transcription thing.  Spent a lot of time on it too, I understand.

Your problem is simply your interpretation of data and your sometimes faulty logic.  I don't fault you for this ... it's understandable because of the overwhelming power of your Darwinian worldview.  You have been fed a steady diet of Darwinism since you were very young and it wields much power over your minds (much like a religion) and while this is not a problem for most of the things you do, it makes you fall into saying some illogical things when you start trying to explain your view of origins.



THINGS THAT ARE AF DAVE'S GOALS HERE AT PANDA'S THUMB
(1)  Find out firsthand why Darwinists believe humans and apes have a common ancestor and evaluate if this is reasonable.  We're making good progress here.
(2)  Find out firsthand why Darwinists are apparently losing the PR game in the USA.  I find it strange that Darwinists have been so unsuccessful in convincing the public of their views because of the virtual monopoly that Darwinists hold over schools, museums, magazines, the media, etc.
(3)  Present my evidence that supports a Designer, followed by evidence for YEC, the Flood, the inerrancy of the Bible, etc.
(4)  Help as many open-minded folks as possible who read my threads walk through all of my "SEVEN STAGES IN THE EVOLUTION OF A FORMER DARWINIST."

Again, these are ...

SEVEN STAGES IN THE EVOLUTION OF A FORMER DARWINIST
STAGE 1: ToE advocates are becoming frustrated because their explanations are sounding more and more like pro-geocentrism and pro-flat-earth arguments as time goes on.  
STAGE 2: The Ship of Darwin has hit an iceberg and a few brave souls are jumping into life boats before it sinks.  See www.dissentfromdarwin.org
STAGE 3: And now, ordinary amateur scientists like me are jumping in the fray and shining the light on their weak arguments.
STAGE 4: Frustration ensues, followed by name calling, arrogant and belittling comments, talk of censorship, and the like.
STAGE 5: This is turn fuels more doubts in people minds. ("Why would that guy resort to name calling?  Doesn't he have any GOODS?" etc.)  
STAGE 6: Which in turn fuels more frustration and mental anguish.  And so the cycle goes until finally for some ... in a desperate moment ... possibly in the middle of the night ... or out on a peaceful lake while fishing ...
STAGE 7: THE LIGHT BULB COMES ON!  (Trumpets) And one more Darwinist is rescued from the darkness of error.


Now that we have that clarified, the present issue that we are discussing is ...


THE SUPPOSEDLY BROKEN VITAMIN C GENE IN HUMANS AND APES
Again, some of you need to re-read yesterday's posts because someone made the same mistake today which was made yesterday, namely, someone today was basically saying ...

"Of course humans and apes have a broken Vitamin C gene.  Isn't that obvious?  Wouldn't it be obvious if there were some tires and broken car pieces laying on the side of the road that we were viewing a broken car?"

YES with the car.  NO with the genes.

Your mistake in logic is that you have ASSUMED that humans and apes at one time in their history actually had a functional GLO gene.  This has to be your assumption if you say it is "broken" now, and the fact is that you do not know this.  Also, you are assuming that you (or the genetics researchers, rather) know enough about the genetic language to even recognize an error.  My contention is that we (genetic researchers) know SO LITTLE about any genomes, that we cannot assert that this gene or that gene is broken.

Please tell me that you guys ARE aware of all the new information coming in about "junk DNA" that apparently isn't junk after all (the gene we are discussing IS one of those genes, right?)?  

You guys are the biology experts ... you should know this.

So am I clear now?  You guys did very well on the Chimp Chromosome thing, but on this thread, it seems you don't have much understanding of this particular issue and many of you apparently have not even read the relevant articles.

Do you really want me to go away from this thread thinking you guys are confused about this issue?  Because right now, that's what I think.  Remember, one of my goals is to try to determine why Darwinists have been only mildly successful in selling their views on the open market.  Your arguments on this thread so far help me understand why this is.

Maybe you can think about some of this tonight and redeem your arguments tomorrow.

Remember, you guys did good just last week on the chromo thing ... I know you guys can give me some substance on this thread as well.

Again, this is really simple ... all you have to do is present evidence of WHY you are so sure that humans and apes formerly had a functioning GLO gene, but now do not.  Simple, right?  Sleep on it ... it'll probably come to you.

(Oh, and BTW ... I think Atheists are very good, moral people ... it's the long term trend of society that worries me, but we'll get to that elsewhere ...)

Have a good night and I'll see you in the morning!

Date: 2006/05/13 03:59:22, Link
Author: afdave
Argystokes said ...
 
Quote
Hi AFDave,

Let me see if I can add something to the conversation.

You've been arguing that what appears to be a broken GLO in primates may not be in fact broken at all, but is rather a designed stretch of DNA that performs some unknown function (we'll call this "pseudo-GLO").  You haven't stated it explicitly, but I think we can infer that this putative function has nothing to do with Vitamin C synthesis (seeing as primates and guinea pigs can't do it).  That is, pseudo-GLO has a function entirely distinct from regular GLO.

If pseudo-GLO has a distinct function, we could use the framework of common design (as well as common descent) to predict that pseudo-GLO would be found in organisms that have functioning GLO.  This is because there is no reason to predict that a gene unrelated to Vitamin C would only be found in GLO-deficient species.

So there are two possible scenarios:
(1) Pseudo-GLO is found throughout the animal kingdom (either ubiquitously, randomly, or in nested hierarchies).  This type of scenario, where a species has a functional gene and a pseudogene is not uncommon.

(2) Pseudo-GLO is only found in species unable to synthesize vitamin C.

It seems to me that a design hypothesis would only predict scenario (1), for reasons discussed above.  Common descent would predict either scenario (2), or scenario (1) with nested hierarchies of Pseudo-GLO (this would be the result of a duplication of GLO followed by the inactivation of one of the copies, which still persists in the population).  Seeing pseudo-GLOs (especially those that look very much alike) randomly throughout the animal kingdom would certainly be a surprise to me (I can think of a mechanism by which it might occur, but we won't get in to that).  Ubiquitous pseudo-GLO would strongly imply that it has an important function, but would not really support either common descent or common design over the other.

I haven't done the research to find out which is the case, but there should be sufficient online tools to find out which is the correct scenario.  With the relatively low number of genomes sequenced, it is probably not possible right now (using good ole look-it-up-online methods) to differentiate between the subscenarios of scenario (1).

I'm willing to look up the information for you (assuming you don't know how to do a BLAST search) if you're willing to concede that scenario (2) does not logically fit with a special creation model.

So how's about it, Dave?  Shall we do some science?


This is an excellent discussion here.  I like the terminology you use to keep everything clear.  You are correct that I have lately focused on the question "Why are researchers so sure this is a broken gene?"  I think this is a legitimate question to ask (but I could be wrong) in light of statements like this from Watson (co-discoverer of DNA) in 2003 ...

 
Quote
‘The most humbling aspect of the Human Genome Project so far has been the realization that we know remarkably little about what the vast majority of human genes do.(Watson, J.D., DNA: The Secret of Life, Alfred A. Knopf, New York, p. 217, 2003.)

and we are obviously learning much about pseudogenes as the following title suggests ...
 
Quote
PSEUDOGENES: Are They "Junk" or Functional DNA?
Evgeniy S. Balakirev1,2 and ­Francisco J. Ayala1­
1Department of Ecology and Evolutionary Biology, University of California, Irvine, California 92697-2525; email: fjayala@uci.edu
2Institute of Marine Biology, Vladivostok 690041,
Russia and Academy of Ecology, Marine Biology, and Biotechnology, Far Eastern State University, Vladivostok 690600, Russia; email: esbalak@bio.dvgu.ru



And the answer may well turn out to be that it is in fact a broken gene, when more is known.  But if the answer is "Yes, it IS broken", then there is another question which immediately follows.  I mentioned this early on and we never explored it.  The next questions would be these ... "Did it break independently in humans and apes?  Or did it break in our ape-like ancestor and get transmitted to both apes and humans as Dr. Max asserts?"  Is it not just as plausible that both ape and human GLO "broke" independently?  Design hypothesis predicts similarity in the the two genomes also, but for a different reason than common descent advocates.  It seems to me that it is quite probable that IF apes and humans did in fact at one time have functional GLO, the functional genes would have been quite similar (is it not true that OTHER functional genes found today in apes and humans are similar?)and the large differences b/t apes and humans that we see today would have also been seen at that time in the past.  This scenario also seems to me to be supported by the 2003 Inai study comparing guinea pig and human pseudo-GLO.  Guinea pigs and humans are obviously not in sister groups, but they both have pseudo-GLO, which actually has 36% "identicalness" according to the report.  Are we to conclude that humans are more closely related to guinea pigs who (like humans) have pseudo-GLO, than to pro-simians who have functional GLO?  It seems that the guinea pig-human pseudo GLO similarity all by itself falsifies common descent for apes and humans.

So I think the following possibilities exist ...
(1) Pseudo-GLO is NOT "broken GLO" and is found throughout the animal kingdom (either ubiquitously, randomly, or in nested hierarchies).  This type of scenario, where a species has a functional gene and a pseudogene is not uncommon.
(2) Pseudo-GLO IS "broken GLO" and is only found in species unable to synthesize vitamin C ... this is because the gene "broke" in the ape-like ancestor, then this "broken gene" was copied throughout the evolutionary path to humans.  If this is true, however, you would still need to explain how the gene broke independently in the guinea pig ancestor, but wound up in modern guinea pigs looking "36% similar" to modern human pseudo-GLO.  You have the problem of the appearance that humans are more closely related to guinea pigs than to the pro-simians! (who have functional GLO)
(3) Pseudo-GLO IS "broken GLO" and is only found in species unable to synthesize vitamin C ... this is because all animals were designed with a functional gene, but now some have independently lost function because of mutations.


I realize that at this point, I have not given positive evidence for the Design Hypothesis regarding apes and humans, because that was not my goal on this thread.  I have only pointed out that Dr. Max's assumptions -- (a) this is a broken gene and (b) if it is broken, this proves common descent -- are unwarranted assumptions.

This whole thread started because someone (I think Renier) said he used to be a YEC advocate, but abandoned it because of this issue which he thought was a closed case.  If nothing else, I think I have shown that it is definitely not a closed case.

As for which of the above 3 scenarios is true, I obviously do not know yet.  It does appear that (2) is not consistent with the evidence that we DO have.  My suspicion is that (3) will turn out to be the correct one when more is known.  Either (1) or (3) appears to be consistent with the Design Hypothesis.



 
Quote
ps Once again could you confirm or deny that you don't think we can infer any of this stuff as we didn't see it happen.
I confirm that we can indeed infer many things in spite of the fact that we did not see it happen with our own eyes.  In fact, this is my exact argument on my other thread where I INFER a the idea of a Super-Intelligent Engineer from "apparently engineered" biological "machines."  I also INFER an Intelligent "Parameter Setter" from the "apparent precise setting" of the many parameters required for life in the Cosmos in which we find ourselves.

 
Quote
1- This is ironical, coming from someone taking the Bible as evidence for his hypothesis.
 Again, if you read my threads, you will see that Bible is  a source for plausible hypotheses.  It is not "evidence" to support them.  My evidence comes from scientific observation of nature.

 
Quote
It's not an assumption. It's a tested hypothesis that follows from the theory of evolution. It's been cross-checked in thousands of organisms and it fits neatly with all the data. I asked you to explain why Nishikimi could expect to find gulo-homologous sequences in humans, orangs and guinea pigs, if not because of common descent. No response.
Are you saying that the analysis proposed by Argystokes has already been done?  I know of GLO being analyzed in a few primates, guinea pigs and humans, but thousands of organisms?  


 
Quote
By the way, it's rather amusing to see you try to lecture people on mistakes in logic:  "IF Common Descent is true, then there is no need for a Creator....There is no afterlife, no heaven, no ####, no judgment for actions in this life, and the best we can do is live in harmony with our fellow man and have a good time until we die.  And when we die, that's the end of the story.
Is this what you consider logic? There couldn't possibly be a God, heaven, he##, and common descent? Why not?
Notice carefully what you just did ...

I said this ..."IF Common Descent is true, then there is no need for a Creator"

and you quoted me as saying this ...

"There couldn't possibly be a God, heaven, he##,and common descent?

BIG, BIG difference.  Think about it.  We need to be very careful in our quotes and our logic.  I believe these types of assumptions, rushes to judgment, and lack of sound logic are precisely why Darwinists are painting themselves into a corner which will ultimately be an embarrassment to them.  We have already seen the embarrasment to Darwinists of their failed predictions in the fossil record.  Darwinists predicted continuous transitional forms in the fossil record.  Creationists predicted ubiquitous gaps.  Creationists were correct.  Darwinists predicted true "vertical evolution" (or macro-evolution), but leading evolutionary scientists have now admitted that no true vertical evolution from one kind of organism to a more complex kind has ever been observed in all human history. Creationists predicted that any "evolution" would be lateral or downward and this has been confirmed.  Creationists also predicted the limited variation that we see in natural and artificial selection, but Darwinists try to use this as evidence for their failed predictions of true vertical evolution, when in fact it is better evidence for "designed adaptability" put in the originl created "kinds" by the Creator.  Since all this and many other things outlined by Denton and others have been embarrassing and unanswerable by Darwininsts, they are now repeating the same logical mistakes at the molecular level.  I predict the results will be the same.  And if that were not enough, they are calling Creationists and ID people stupid for questioning their theories!!


Quote
After all, it could be that the Flying Spaghetti Monster created us with his noodly appendage.
I admit this is a logical possibility.  I challenge you to find evidence which supports it.

Quote
AFDave: Your smugness is quite grating. I assume you're doing that on purpose, no? It always amazes me how the preachiest christians lack what I would have thought would be the "zeroth commandment" of christianity: humility.
Have I not demonstrated humility by "eating crow" graciously about the chimp chromosome issue?  I think what you perceive as smugness here is in reality a little bit of satire and poking fun at a theory.  I am trying very hard to use innovative tools to jar people's thinking.  I think Darwinists are so steeped in logical fallacies that it takes something rather jarring to make them wake up and see the errors.

 
Quote
I think that idea sounds a little screwy, but it does seem to me that some junk DNA won't be the vesigial stuff we are predicting. Supposedly 90 percent of our genetic material is this junk DNA, but our bodies don't support 90 percent  junk organs -- or vestigial organs -- why would our DNA?
 My point exactly.  I am not familiar with the "fractal" theory or whatever it was.  I do not claim to have an idea about what all that "junk DNA" does.  It will be fun to investigate it though.


 
Quote
No, dave. It's not an assumption. It's an inference, based on evidence. There's a difference.

Thank you for agreeing with me (and Meyer) that INFERENCES to the Best Explanation are valid.  This is exactly what I am doing on my other thread to try to explain a Creator.

Date: 2006/05/13 05:44:53, Link
Author: afdave
I'm fine if you delete the following threads ...

"Cain's Wife"
"Chimp Chromo"
oldest "Creator God Hypothesis"
I consider these to be done.

I only want 2 open currently ...

"Ape Questions" and
"UPDATED Creator God Hypothesis"

I will also re-read you rules and comply.

I want to offer you and Steve and whoever else may be responsible my sincere thanks for creating a forum like this where "Anti-Evolution" and related topics may be discussed.

In spite of a few insults and attacks on me, there have been a large number of nice people who have had good things to say.

Thanks again!

Date: 2006/05/13 15:27:40, Link
Author: afdave
Quote
I just performed a quick BLAST of GULO (exon 10), and the homology between human and chimp is 97%.
No surprises there, right?

So you want the original article? ... I can probably have it on Monday or Tuesday ...

Are you saying you will agree with me if I give it to you?

(Just kidding!;)

Date: 2006/05/13 15:58:46, Link
Author: afdave
Quote
It's not even necessarily true on that 'one little piece of DNA'. Whats the sequence similarity for the GLOs? We just know in this discussion that two are broken. It's absolutely idiotic to use this single fact to infer things about common descent.


Steve!  My buddy!  You and I agree on something ... I KNEW it would happen sooner or later.

That's what I've been trying to say ... Dr. Max's article on T.O. uses this as evidence of common descent for apes and humans.  My point has been all along that this assertion is not warranted with just this little bit of knowledge that we have.

But I'm also not saying it proves Common Design.  It obviously doesn't, but it at least argues that either one is a possibility.

Again, the whole thing started with Renier saying "Look ... Dr. Max has proven common descent with this Vitamin C thing" which I think he has not.

Date: 2006/05/13 16:37:42, Link
Author: afdave
Well, let's see ... what can I leave you with for the weekend?

Hmmmm........

I think I got a little bit of agreement on the cosmic fine tuning thing ... at least for THIS universe ...

But it seems that people don't want to say biological machines are designed ...

So ... here's your thought question for the weekend ...

You all know the SETI project, right ... I don't know the current status of it ... you could probably tell me, but here's some interesting info from your favorite website, Talk Origins ...
Quote
Claim CI190:
SETI researchers expect that they can recognize artificial signals, proving that there is an objective criterion for recognizing intelligent design.
Source:
Dembski, William A., 1998. Science and Design. First Things 86 (Oct.): 21-27. http://www.firstthings.com/ftissues/ft9810/dembski.html
Talk Origins Response:
SETI researchers do not expect to find recognizably designed messages in the signals they are looking for; in fact, they expect that the signal modulation would be smeared out and lost. They are looking for narrow-band signals, which are what people build and are not found in known natural radio signals (SETI Instutute n.d., Shostak 2005). The objective criterion for recognizing intelligent design is to look for things that look like what people build.


Whoa!  Did you see that?  Did I hear that right?!!  Wait a minute, let me clean out my ears and play the tape again slowly ...

Talk Origins said ...

T h e    o b j e c t i v e    c r i t e r i o n    f o r    r e c o g n i z i n g    i n t e l l i g e n t    d e s i g n    i s    t o    l o o k    f o r     t h i n g s    t h a t    l o o k    l i k e    w h a t    p e o p l e     b u i l d.

I can think of about a hundred different things inside a cell that look like what people build ... just read either Denton book you like ...

So if this is objective criteria for the SETI folks, it's good enough for us, right?  They are REAL scientists, right?

Have a good weekend!

(I'm really not trying to harrass you guys ... just trying to get you to see the truth about some things)

(I won't trot out my "Seven Steps" anymore ... I got to thinking that's probably mean :-)   and I'm really not trying to be mean)

(I'll be at church tomorrow so I guess I can 'confess';)

Date: 2006/05/13 16:56:00, Link
Author: afdave
Quote
afdave, that's just retarded! And you're quote mining. steve is talking about that so called 36% similarity being poor evidence of our relatedness to rats.


Aw come on ... you mean Steve isn't agreeing with me here?  Bummer ...

Oh well ... gotta keep trying!  Gonna happen sooner or later ...

I AM interested in hearing the outcome of the big Saturday night event ... "Max vs. Woodmorappe"

Faid?  Any more analysis from your corner?

Date: 2006/05/14 00:50:30, Link
Author: afdave
Steve Story said ...
Quote
I like opening new topics for news items. A bunch of people see them, and if they don't start a discussion, they slowly drift down the page and are gone.


So this is not allowed any more?  I would like to do this occasionally also ... but I would not do it more than once a week ... probably less than that

I see Mr Christopher has 3 of these open right now

Jeannot said ...
Quote

I personaly think that Dave's doubts regarding chromosomal fusions and other patterns of primate evolution deserved their own threads.


Wesley--

again you can delete these 3 if you like ...
"Cain's Wife"
"Chimp Chromo"
original "Creator God Hypothesis"

Quote
And if someone with better judgement cares to open a thread that is about the topic of chromosomal changes in evolution, and not just about AFDave's particular disagreements, then that would likely be peachy.


So I don't have good judgment (other than I don't support Common Design Theory)?  What criteria do I need to meet to be able to start a new topic?  (not that I need one now -- I only need the two I specified -- but several people have asked me off-topic questions in my threads and at some point, it would be appropriate to start a new thread and answer them if I have time.)

Date: 2006/05/14 01:14:05, Link
Author: afdave
Quote
Dave, given William Dembski's absolute lack of credibility when it comes to critiques of evolution, why do you even bother quoting him? Have you spent any time at talkorigins or pandasthumb or talkreason to find out what actual scientists who actually have the training to have actual opinions on evolutionary biology have to say about Dembski?


Eric ...  I'm very aware of PT and TO opinions of Dembski ... how could anyone NOT BE?

I'm not quoting Dembski, I'm quoting TALK ORIGINS !!  Isn't that what you guys have been instructing me to do?  I understand the claims Dembski makes about SETI and I have no knowledge about them ... that is not my point.

Did you not notice the bold print?  Here it is again ...

Talk Origins (not Dembski, not AIG, not ICR) Talk Origins said ...

T h e    o b j e c t i v e    c r i t e r i o n    f o r    r e c o g n i z i n g    i n t e l l i g e n t    d e s i g n    i s    t o    l o o k    f o r     t h i n g s    t h a t    l o o k    l i k e    w h a t    p e o p l e     b u i l d.

Now it does not get much plainer than that.  The logical conclusion of this is if SETI looks for things that look like people build to indicate intelligent life out there somewhere, why shouldn't we also?  There are oodles of things that resemble things that people build all through nature:  bat "radar", bird wings, eyes like cameras, ad infinitum ... maybe there is Someone out there who designed this!

I read all you guys' links ... I know what they say ... I always do read your links if they are on topic

You cannot dodge this one ...

There is no escaping the fact that YOUR FAVORITE SITE (not Dembski) made a statement that agrees with AF Dave on one of my MAJOR POINTS--THERE IS OVERWHELMING EVIDENCE THAT BIOLOGICAL "MACHINES" LOOK DESIGNED BECAUSE THEY PROBABLY ARE DESIGNED.

I understand that this may bring frustration, but I cannot help what Talk Origins writes -- go get mad at them, not me.

Date: 2006/05/14 01:29:41, Link
Author: afdave
Quote
Or, maybe, you know, explain to him that the people at the SETI project are not making metaphors on purpose when they talk about products of intelligence: They mean the real thing. They are looking for actual intelligent design, not "Intelligent Design". The reason they are looking for things that people build is, well, that they are looking for "people" who build things.
You don't have to explain this to me ... I already understand and agree with you ...

I ALSO am looking for ACTUAL intelligent design, not "Intelligent Design."

I ALSO am looking for "people" who build things.  I just have a theory that these "people" are ONE person and he just might be known in some circles as "God."

Date: 2006/05/14 01:40:00, Link
Author: afdave
Quote
Why do you ask? Got anything to share?


I thought you were going to show why Dr. Max of Talk Origins is correct and Woodmorappe of AIG is wrong on this "Vitamin C gene" issue.

That's what we were talking about ...

Date: 2006/05/14 01:48:39, Link
Author: afdave
Quote
There it is.  They [AIG] don't do science, they do apologetics.  They don't do any scientific research for themselves--the best you can say is that they are armchair critics.


Armchair critics ... er, yes ... sort of like you, right?

It's funny that Evos think that Creos should "do their own research."  That would be like me saying   "PT and TO people shouldn't quote researchers like Nikimishi and Inai ... they should do their own research!!"

Pretty silly argument, now, isn't it?

Yeah, I thought so ... you can take it back if you like ... I won't embarrass you by quoting you further.

Date: 2006/05/14 02:08:32, Link
Author: afdave
Quote
So Dave, since 36% of similarity between the broken GLO genes in guinea pigs and human are very low and support our view, what is your interpretation?

My view is that Dr. Max made an unwarranted assertion by saying that "GLO mistakes" were copied from the common ancestor of apes and humans.  I think the GLO situation we have in humans and apes today could just as easily support Common Design Theory.  

Of course, it is fine for him to have that interpretation if he chooses.  I just think we know too little to be dogmatic as he seems to be.

Renier said that basically this was a closed case for him and was the very issue that made him abandon the YEC position.

*********************
Separate issue:  the guinea pig thing

This is interesting, but I'm not saying anything dogmatic about it.  I really don't understand enough about it and I would value Jeannot's analysis of the AIG article.  Jeannot, do you also have the Inai article that AIG quotes?

It appears that they are saying that humans would be more closely related to guinea pigs (because humans also have broken GLO) than to pro-simians (functional GLO) if we followed evolutionary logic, but this is obviously absurd, because they are not related.  Again, I don't know if I agree with this or not.

I think they are also pointing out that evolutionists agree that guinea pig GLO broke independently from the simian line, so why shouldn't we expect ape GLO to break independently from human GLO?

We should.  At the very least, we cannot dogmatically say that the GLO gene definitely broke in the common ancestor, then was copied to apes and humans.

Do you agree?

Date: 2006/05/14 03:40:16, Link
Author: afdave
Face it, Faid.  You lost one point.

Talk Origins supported my position on this one.

Shake it off! ... it's only ONE point you lost.  It's a new day tomorrow.

I also have lost one point here at PT ... and I admitted it ... you can too.  It's not that bad.  It's not like this disproves your whole theory or anything.

Date: 2006/05/15 03:01:08, Link
Author: afdave
Quote
When they say "things people build" they mean j u s t   t h a t (there, was that right?).


No, Faid that is close, but not exactly what they said ... they did not say "things people build."  Talk Origins said "things that look like what people build."  

 
Quote
But what is intelligence? Does an intelligent thing necessarily have to have any or all of these qualities:

1) Desire, wants, will
2) Foresight
3) Memory
4) Awareness of itself
5) Creativity and originality
6) Sensory organs
7) Perceptions
8) Communications

Evolution has some of those qualities, memory, creativity and a form of communication.

But evolution lacks others, like foresight, self awareness and desire. The animals it creates has some of them, but not the system that is evolution.

Does your God have all those qualities?

What does a system have to have to be called intelligent?

What SETI is looking for is something close enough to us we might talk to it. Do you talk to God?
Sure I do.  You all could probably guess that I at least imagine that I communicate with God -- it's a well known claim by Christians and others -- of course I'm talking about prayer.  But I have no proof to offer you of the sort you would be looking for to prove that He hears me.  All I can do is offer evidence that "ET" is out there somewhere because in biological machines, we have exactly the kinds of things SETI is looking for (and apparently T.O. acknowledges this).  I can point to the finely tuned universe and show you that Someone probably set all those parameters.  I can look at the phenomenon of a universal "moral code" and conclude that "Someone probably created this moral code" (C.S. Lewis -- I will get into this shortly), and I can show how the Laws of Relativity make it conceivable that someone could "live outside of space and time" (even though I don't understand how this works).  And this is about as far as I can go with just observations of nature.  After that, I will get into "religious books", then my reasons for commencing an investigation into one particular "religious book" -- the Christian Bible.  Then we will begin getting into some of the stuff you all keep asking about -- age of the earth/universe, evidence for the Flood of Noah, the changing of languages, the historicity of the Bible, the Messianic prophecies and the prophecies of Daniel regarding the nations of the world, and the amazing accuracy of human nature description of the Bible.  We will deal with philosophical questions about God -- the problem of evil in the world, and we will look at some perceived Bible difficulties, among other things.  Here is an overview of my approach:

(1) Observe nature and draw inferences:  this only gets us so far, i.e. we conclude that there is an "ET" (or ET's) out there who is a Super-Intelligent Engineer, this ET might possibly live outside of space and time, and this "ET" might be the originator of this stange, universal "moral code" which we observe.  So we hold these thoughts and move through the rest of the process.

(2) If we accept (1), then we can make some predictions, one of which would be: "This 'ET' probably can communicate to humans."  How?  Dunno, but there certainly are a lot of competing claims out there -- many "prophets" and "holy books" claiming to be speaking for God or Allah or whoever. Could any one of them stand up to scrutiny?  So we compare some "holy books" and investigate the claims.  We focus in particular on the Christian Bible.  Why would we waste our time on this?  Well ... several good reasons.  We have reason to believe that the Christian Bible is unique among "religious books" for some pretty big reasons.  Former agnostic Josh McDowell gets into this in "Evidence that Demands a Verdict." I will explain some of these later, but it's enough to say for now that I have a convincing case for at least taking the time to honestly investigate the claims of the Bible.

(3) I begin investigating the Bible and I find many weird things.  But I know from experience that often times truth is stranger than fiction, so I keep investigating.  One by one, the supposed "difficulties" in the Bible keep falling as I learn more.  By the time I am done investigating the historicity of the Bible, its amazing predictions and fulfillments, the evidence in favor of Genesis 1-11 as actual history, its accurate description of the human condition, and other factors, there is not anything sensible to me to conclude except that some Unseen, Incredible Mind somewhere caused this book--the Bible--to be written.

(4) This is the end of the evidence that I can detect with my senses.  From this point forward, I have no choice but to make a "leap of faith" in some direction.  My choices are to A--do nothing B--reject the evidence I have just discovered or C--put 2 and 2 together and make what appears to me to be only a small "leap of faith" and conclude that the "Mind" that superintended the writing of the Bible is the same "Mind" that created the wonders of Nature.  Is this so unreasonable?

(5) Risk analysis.  Having walked through this entire process, I now am faced squarely with the claim from the Bible:  "Believe me and spend eternity with me when you die." (God supposedly speaking) or "Don't believe me and spend eternity separated from me.  It's your choice, Dave.  I won't force you.  I have given you abundant evidence for My existence.  If this evidence is not enough, what evidence WOULD be enough?"  I have to choose, and it basically boils down to risk analysis.  Which of the two possible choices seems less risky?

(6) And so I did choose.  I chose to believe the Bible based on what I considered to be overwhelming evidence in favor of believing it.  To me, it appears to be sheer folly to go against such evidence as I have seen.

(7) Now that I have made that choice, all I can tell you is that I am a changed man.  Ask my wife.  I know this is not scientific evidence.  That stopped after Point 3.  I can only tell you that I used to be interested in myself only.  I have not become perfect (I'm too cocky and too smart-alecky among other things), but there is now a new force for good within me which many times overcomes my selfish desires--the Bible tells me that this is the Spirit of God which apparently comes and somehow "dwells within" believers.  Now I genuinely care for others as well as myself and it really doesn't bother me much if people make fun of me.  I have a very single minded goal in life -- to be used by my Creator for His purposes during my brief stay here on this earth.  I don't know what those purposes will be during the next 40 or so years that I may have left.  But right now I have a (God given?) desire to share with others the truth that I have found.  They may reject it and I understand that.  It's OK.  Everyone has to make their own choice.  But I would be remiss if I held this information to myself.  Not only am I a changed man, but I can also tell you that the native people my dad worked with in Brazil are changed people.  When he went there in 1950, they numbered less than 400.  They were killing each other and their own babies and openly spoke about the time when they would all be gone.  They asked my dad who he would preach to when they were all gone.  But my dad persisted in showing them the truths in the Bible in spite of unspeakable personal difficulties.  After 5 years, the chief made THE CHOICE that I speak of and the whole group turned around.  Today they are a happy, productive people.  Their population has blown through 3000 and is growing rapidly.  They now know how to read and write, give medical care, speak Portuguese and many other productive things.  They are even traveling to other villages who used to be in the same predicament as them and helping them.  It is truly amazing!  You can get the two books which tell the story of my dad on Amazon.com:  Christ's Witchdoctor and Christ's Jungle both by Homer Dowdy.

 
Quote
Ok half a dave no problem.
You will have us all 100% convinced if you produce your god and say a phone number we can speak to him, he does speak English doesn't he?  Old English or New English BTW? Should be no problem for you since you have 100% certainty. how much time do you need?
I would turn this around and ask, "What would it take to convince you that the God of the Christian Bible exists and is really as He is described there?"  I'm serious.  What would it take?

 
Quote
Dave, did you read the SETI article? Because it completely contradicts your point! What SETI is looking for is something that resembles what people would design, not what some purported "creator god" would design.

We have a very good idea of what something created by a civilization would look like, because we know firsthand what civilizations build. We have no idea what an "intelligent designer" (in the sense that the creationists mean it) would build, because we have no idea what the "intelligent designer" is like.

 Quote  
T h e    o b j e c t i v e    c r i t e r i o n    f o r    r e c o g n i z i n g    i n t e l l i g e n t    d e s i g n    i s    t o    l o o k    f o r     t h i n g s    t h a t    l o o k    l i k e    w h a t    p e o p l e     b u i l d.

Yes, Dave. What people build. Not what supernatural intelligences build. Do you see the distinction?
Yes.  I see the distinction, but why limit ourselves to searching for ET's that are like human "people"?  Why would we not entertain the possibility of a Super-human of some sort.  Are we really so narrow minded that we rule out the possibility of some advanced life form out there somewhere?  And maybe this life-form has no physical body.  Why do we think that having a physical body is some sort of advantage?  I would actually think NOT having a physical body would be much better--my idea of what a spirit might be (if there is such a thing) is quite fun indeed.  Imagine being able to walk through walls and not having to go to the doctor (sorry Faid), or be able to "beam" ourselves instantly to other parts of the universe and actually survive because we need no oxygen!  I think this would be fantastic!  And I think it is entirely possible and actually quite probable that there really is an "ET" out there who may in fact be more like a "Mind" with no body--a spirit, if you will, who made all these "artifacts" we find here on earth.  And this has nothing to do with "religion" for me, which is why I place this in the category of science.  I consider myself to basically be a sort of private SETI researcher.  And my idea of how this "Mind" did it was basically that he created a perfect environment for life--the Cosmos and Earth--then placed a relatively small number of "biological machines" on Earth, which in turn diversified into the many species which existed before the Flood.  A similar thing happened after the Flood -- i.e. a relatively small number of "kinds" diversified into the present diversity that we see today.  I think some people think that I think God created each individual species.  I do not think this.  I think God basically created the original "kinds" each with their own unique DNA software, then He basically "let the software run" and let the free spirits attached to the minds of the "human biological machines" have free choices to do as they would do.
 
Quote
And more to the point, Dave, you have to admit that basically nothing biological really looks like anything humans would build. Does a bat's ear look anything—anything at all—like a human-designed radar receiver? Does a bird's wing bear anything but the most superficial resemblance to a plane's wing? Does a mitochondrion look like anything humans have ever built?

You've been stating as if it's a fact that biological structures look like something humans would build, but it's far from true. Look around, Dave. Take off your creationist spectacles and really look at things.
Actually, I think that many, many things we find in Nature strongly resemble things humans would build.  The difference that I observe is that they have a much higher degree of sophistication than our technology.  They do appear to me to be, in fact, the "products of an advanced civilization."  We all know the Bill Gates quote about DNA being software which is far advanced beyond our own software.  I think he should know.  And if you think about it, much of our technology already existed in Nature before we invented it.  Airplanes are a perfect example.  Nature had airfoils  and propulsion systems before we did.  Nature had vision devices before we did.  Nature had "radar" before we did.  Nature had submarines before we did.  Nature had "robot arms and legs" before we did.  Nature had food production factories before we did (plants). Nature had chemical factories before we did.  Nature had assembly lines before we did.  Nature had under-water breathing apparatus before we did.  Nature had chemical "light sticks" before we did (fireflies). Nature had computing systems before we did (brains).  

And Nature still has many things which we do not have.  Dupont has studied gecko feet to understand how the adhesive works.  Scientists are studying molecular machines and now are making nano-machines themselves.  I constantly read about scientists observing Nature and trying to mimic it.  This is great stuff!  I love it!  But it highlites the fact that Nature has technology far, far, far advanced beyond our own in every direction we look. If this is not evidence for and "advanced civilization" somewhere that produced this, then I don't know what is.

Many people have this strange (to me) idea that natural "technology" is somehow fundamentally different that man-made technology.  Maybe it has some "vital force" or something that makes it different.  Someone mentioned that it is "blobby" or something and this means it is in a different category.

I would submit to you that it is only different in degree of high-techy-ness. Other than this there is no difference at all in the physical bodies of plants and animals that we see to man-made technology.  They all use the same atoms from the same periodic table as human engineers have access to.  What we really observe is a brilliant software system residing in an ingenious arrangement of molecules which in turn are nothing more that atoms arranged just so, and we call this a cell.  Because of the sophistication of the DNA software, cells have the ability to assemble raw materials and thus grow into organisms as diverse as giant redwoods and horse-flies.

Do you deny this?

 
Quote
This is similar to the 'if people copy nature nature must be designed' thread they had at UD a couple of weeks ago. Can you come up with a good reason why this makes any sense? Because I certainly can't think of one.
Yes.  It makes total sense and is very intuitively obvious to me.  And people like Bill Dembski are trying to reduce it to mathematics so not only will it be intuitively obvious, but it will also be rigorously provable. (I'm not saying Bill's there yet ... I don't know much about his stuff)

 
Quote
Which leads back to your earlier point. Yes, maybe there is Someone out there who designed this. I personally don't believe that, but I don't claim it's impossible. But "looks designed" is not really evidence for this Someone. "Looks designed, therefore maybe is designed" is just a hypothesis.

Now what you need to do is make and test some predictions. Let me get you started:

IF Someone designed all this, THEN I predict I should see X. HOWEVER, if I see Y, that would be evidence that Someone did NOT design all this.

Can you supply objective specifics for X and Y? If so, your concept of Someone may be testable. Otherwise, not.
I agree that it is only a hypothesis and never will be provable.  Put I do make predictions. See my steps above. (and there are more besides this)

 
Quote
Do you want people to admit that the teleological argument is a strong indication of a designer?
or
Do you want us to admit that the teleological argument is a proof of God?
The former.

 
Quote
It certainly IS possible to disprove the qualities normally associated with God.  For instance, omnipotence is self-contradictory and, therefore, cannot exist (que "the rock" question).  Similarly, omniscience and free will are mutually exclusive: if we humans have free will, then God cannot know what we're going to do before we do it.  Furthermore, ignoring those two contradictions, God cannot know that a disaster is going to happen and have the power to stop it and still be benevolent/morally perfect for allowing it to happen.

What says you about this, Dave?
PuckSR answered for me very well.

OK?  There you have it.  If no one has any more questions about these items, we will move along.

Date: 2006/05/15 03:53:43, Link
Author: afdave
Quote
There are many things in nature that seem very efficient to us, but there are also a great number of things that are horribly inneficient and badly 'designed', which is what we would expect if evolution were true.
But it is also exactly what we would expect if the Bible were true, because it speaks of a "Curse" as well as an originally perfect "Design."  I know the "Curse" idea seems strange--I have not yet explained my understanding of it--but it all makes sense if you accept the whole package.  It makes perfect sense to me that a Creator designed everything perfectly, but then "cursed it" as a result of man's choice to not obey God.  One of the biggest reasons I see for the Curse is to show man very clearly that "this world is not our true home."  There is something better coming which our Creator will someday give us if we choose it, and we should not place too much value on our material possessions here on earth.

Date: 2006/05/15 06:49:56, Link
Author: afdave
Faid said ...  
Quote
Dave, we're referring to AiG and all their proclaimed experts, like Woodmorappe, not you. You reply by referring to us.
And AiG does not quote scientific research that supports Genesis (because there isn't any, and they cannot come up with any), so they take existing scientific research and try to twist and distort its data to their liking. They're liars, dave.


I was not referring to you.  What I said was ...  
Quote
That would be like me saying "PT and TO people shouldn't quote researchers like Nikimishi and Inai ... they should do their own research!!"


My point was that people like Dr. Max on Talk Origins use other people's research (Inai, Nikimishi, etc.) and draw conclusions ... why shouldn't AIG do the same?  Obviously they are going to have different conclusions because they hold a different world view.  This is not lying.  You have not shown me one lie they have told.  You have shown me that Dr. Wieland was uninformed about transcription direction being unimportant.  And I agreed with you. But you have not shown me that they lie.

 
Quote
It's not simply the fact that GLO is 'broken.' It's the exact nature of the 'breaks.' That's what supports evolution & common descent.

You realize that genes are generally a few thousand base pairs long (or longer), right? And you realize that there are many, many, many different genetic changes that can 'break' (inactivate) any given change?

So, if humans and other great apes all have an inactivated GLO gene, and the cause of the inactivation is virtually identical in all of them, that's evidence for evolution via common descent. Not proof. Evidence.

I do understand all this, yes.   I think my understanding is correct that human and ape genes are about 95% (or 97) similar.  My assumption would be that the inactivated GLO gene would likewise be approximately 95% (or 97 or whatever it really is) similar also.  Is this correct?  Or am I to understand that human and ape GLO is 100% IDENTICAL?  Can someone confirm this for me?

If the former is true, then to me it is clear that Dr. Max's assertion that this proves common descent is an OK guess, but it doesn't close the case.  One could just as easily say that apes and humans are separate designs and the GLO broke independently in each.  Why should we think it would not?  Apparently it did also break independently in guinea pigs.

And again, the 36% thing to me is a side issue.  What I am trying to show is simply that Renier said that Dr. Max said that the broken GLO in humans is exactly 100% the same as in apes.  Enter Dr. Max's copyright case. And yes, IF this is the situation we in fact have, then I would agree ... it looks like common descent.

 
Quote
What we can say is that evolution not only provides detailed, mechanistic explanations of the available data, is also accurately and reproducibly predicts new observations. Creationism does neither of those things. That's why evolution is science, and creationism is not. That's why evolution should be taught in science class, and creationism should not.
Creationism HAS provided many detailed explanations of the available data and has accurately predicted many things, including ubiquitous gaps in the fossil record and the inability to induce "good changes" or "vertical evolution" in fruit flies by "speeding up the evolutionary timescale." It has predicted a certain "fixity of kinds" and "downward evolution" (not "upward") (note we are using MY terminolgy here in which humans are "at the top" of the hierarchy and single celled organisms are at the bottom--this is my convention, of course, but I believe it to be a good convention which in many ways can be a useful organizational tool) which in fact has been observed--i.e.  our bodies continue to accumulate more and more harmful mutations and the bacteria are winning, among other things.  It hypothesized that coal does not require millions of years to form, but can be formed quite quickly.  This has now been shown.  It hypothesized that sedimentation such as that seen in the Grand Canyon is not formed gradually over millions of years, but is formed catastrophically.  This has now been proven at Mt. Saint Helens where there is a "miniature Grand Canyon which was not there before 1980.  Creationism and the idea of the the Curse has the only sensible description of human nature which lines up with what we actually observe.  And many other things which we have already begun to get into on my "Creator God Hypothesis" thread.

 
Quote
According to common design, the creator would have put broken copies of a gene in each species, copies that reflect the current phylogeny, built with coding genes. Why would he? A broken gene is not part of a design, it's useless.

You said you would readily accept any evidence for common descent. I don't think you are sincere. What kind of proof would convince you?
Please see above.  Can you confirm that the broken GLO gene is 100% identical to the broken ape GLO gene?  If so, then I think you have something.

 
Quote
And what are your thoughts on the fact that AIG only referred to the 36% homology between guinea pigs and humans, but forgot to mention the 97% identity between us and chimpanzees? Silly mistake again?
No.  Just irrelevant to their discussion.  The whole Inai paper discussion (I think) is intended to show that "Guinea pigs GLO gene broke independently.  Why shouldn't apes and humans GLO gene ALSO break independently?  They may be trying to say something further than this also when they get into the pro-simian discussion and 36% etc., but I don't really follow that part of their argument.  They freely acknowledge elsewhere that there is great similarity in ape and human genes, so it is clear they are not trying to obfuscate.  They may think it will come in a bit less--maybe 90%--when more is known, but even if it stays at 95-97, this does no damage to their idea that apes and humans DO NOT share a common ancestor.  A house builder builds many houses that look similar--97% similar probably--but this is obviously because of a Common Designer, not Common Descent.

By the way, the 36% 'similarness' number comes from 47 out of 129 substitutions, i.e. 47/129=0.36.  I do have the complete Inai article, and they themselves say "A high percentage of the same substitutions in the total substitutions (36%) indicates that there were many hot spots for nucleotide substitution throughout the sequences examined." (Journal of Nutritional Science & Vitaminology, 2003, Vol. 49, Issue 5,p. 316).  This does not lead to any profound conclusions for me ... how about you?

I did not see anything in this article which would confirm 100% identicalness of human GLO to ape GLO.  Possibly some other article has this?

 
Quote
I keep asking, and you keep not answering: what, in the "common design theory", would have led Nishikimi to expect to find gulo homologs in humans and guinea pigs?"
To me it is quite conceivable that a Designer designed functional GLO genes in all the distinct "originally created kinds."  The fact that Human Designers make similar structures to perform similar function should have led Nishikimi to expect to find homologues in the natural world as well.  I don't think the genes have to be identical to be functional.  Just as several different codons can code for a particular protein (I think that's correct, right?--help me all you genetics experts). Similarly, in the English language, I can say I'm going to go grocery shopping in a variety of different ways ... "I'm going to go buy some food" and "I'm gonna drop by Safeway and restock our vittles" and "I'm going to go to town and get our pantry restocked" all communicate the same idea but with very different words.  There is no reason in my mind to think that the situation in genetics is any different than this.  

 
Quote
Apparently the fossil evidence, DNA sequence analysis, chromosome structure, and a coherent theory are not enough. What kind of proof would convince you?
100% identicalness of the GLO gene between apes and humans would be a good piece of evidence to me.  The whale evolution sequences presented to me are very unconvincing.  The chromosome thing is the best one I have been given yet, but again, considering the above discussion, why couldn't a Designer have used the '2A and 2B' chromosome info that he used for apes, modified it slightly by fusing it and a few other changes, then inserted this into the human genome?  Or vice versa.  Maybe He used Human chromosome 2, split it into two and put it into the chimp genome as 2A and 2B.  When an artist creates two pieces of artwork, they may be very similar, and the artist may reuse certain pieces of one in creating the other.  Certainly software 'artists' do this.  I've done this myself many times.  Why write a second program entirely from scratch when you can reuse some code snippets and save yourself some time?  Again, I am not saying here that I can prove this definitely happened.  I am just saying that it is perfectly plausible and exactly what we should expect from a Designer.  Some kind of 'upward evolution' (my definition of upward -- humans at the top, one-celled organisms at the bottom) in fruit flies would be impressive.  I think these experiments try to 'fast forward' evolution.  But all I've ever heard of is dead fruit flies, deformed fruit flies, etc.  Never 'advanced' fruit flies with major increased abilities.

Jeannot said ...  
Quote
Anyway, the percentage of identical substitutions between human and chimp is certainly well above 36%.
I would expect it to be around the same as the general genetic similarity -- 95-97%.  This would be consistent with Design Theory.

 
Quote
To check that, we should gather several sequences from rodents, primates (and maybe other mammals), if available, and build a maximum likelihood our parsimony phylogeny. The three sequences alone (rat, guinea pig and human) won't do.
Agreed.  Does anyone have a paper comparing human and chimp GLO, for example?  Is it 100% identical?  Or 95-97% as I predict.

 
Quote
...You know, it's a good thing creationists like Dave drop by from time to time and try to "enlighten" us: It helps us refresh things we had forgotten, learn things we didn't know, have constructive debates (such as this) we'd normally not have, and in the end appreciate science even more.
See ... even ugly, flea-bitten dogs are good for something ... to throw rocks at, kick when your mad, etc. :-)

Faid said ...  
Quote
Did I mention that this is fun?
Well ... at least I am contributing entertainment value to everyone if nothing else ... think of me a side show at the carnival that you didn't have to pay for!

 
Quote
I wonder why AFDave isn't hear setting you all straight about your convergences and your BLASTs and what have you.
 Oh, I was there alright.  I actually read these posts on my Blackberry at church during the boring announcements.  I just have never tried posting from my Blackberry.

 
Quote
From what I hear, he's busy posting over at his newfound haven at UD right now. But I'm sure he'll be back...
Oh yes.  I'll be back.  I wouldn't call UD a haven.  Those guys all agree with me.  What fun is that?  I just thought I'd better spread the word about that fun quote from TO before someone at TO changes it to sound ... er ... less supportive of Creos.

 
Quote
And he has a website:
http://airdave.blogspot.com

He gets Warren Buffet quoting Jesus:
http://airdave.blogspot.com/2005....te.html

But he doesn't seem to know that Warren Buffet is an atheist, like Bill Gates and George Soros.
Oh I know he is.  That's irrelevant to me.  I posted this in response to a friend that maintains that you shouldn't be quoting Jesus at work.  My response was "Well, why not?  Warren Buffet does!"

While you are at my blog site, you guys HAVE to try my "Mist, Ghost or Computer Graphics?" link ... but turn your speakers up loud.

 
Quote
When did the split occur Dave? around the time of pharoah? Oh right you don't think there WAS a split. Interestingly, you sparked a conversation between two people who DO know what they are talking about and got some interesting info.
Of course.  I like it when this happens.  BTW, I did see your questions and I have good answers, but I'm on a particular train of thought and would like to answer them in my own sequence.  Did you read the latest page on my "God Hypo" thread?

Date: 2006/05/15 07:00:02, Link
Author: afdave
Quote
But what is intelligence? Does an intelligent thing necessarily have to have any or all of these qualities:

1) Desire, wants, will
2) Foresight
3) Memory
4) Awareness of itself
5) Creativity and originality
6) Sensory organs
7) Perceptions
8) Communications

Evolution has some of those qualities, memory, creativity and a form of communication.

But evolution lacks others, like foresight, self awareness and desire. The animals it creates has some of them, but not the system that is evolution.

Does your God have all those qualities?

What does a system have to have to be called intelligent?

What SETI is looking for is something close enough to us we might talk to it. Do you talk to God?


Norm--  Didn't mean to dodge you.  Here's your answers.

All I can tellyou for sure is that the Intelligent Agents that I know about do have all those items in (1) through (8), and of course the Bible claims these same attributes for God.  It is my opinion that these claims are true ... however, I am not asking anyone to join me in that belief until I show my evidence supporting these claims.  This is why I did not answer these in detail yet.  My understanding of an intelligent agent is something similar to animal and human intelligence.  I do not have rigorous criteria yet.  Does God talk to me?  Not in an audible voice, no.  I will explain this more fully in the proper sequence.

More answers later.  I'm breaking for lunch :-)

Date: 2006/05/15 11:09:28, Link
Author: afdave
Quote
Dave, no one understand why you want GLO to be 100% identical between human and chimps, since that's precisely what evolution doesn't predict. This pseudogene is not selected, so it can freely accumulate mutations at a high rate.


I just thought this was the whole premise of Dr. Max's argument -- that a mistake was copied identically from the common ancestor to apes and also to humans.

If this is not the case, then he does not have an argument, in my opinion.

Date: 2006/05/15 11:18:40, Link
Author: afdave
He does not have an argument, in my opinion, if the error is not copied 100%.  Remember the copyright case that Dr. Max made an analogy to?

If we are just talking about the same difference as with other genes, then this is just as easily explained by common design as common descent.

Everyone else--I'll look at your points in the morning.

Date: 2006/05/16 04:27:08, Link
Author: afdave
OK.  It's time for a review.  I started this thread with 3 items which to me argue powerfully against common descent of apes and humans.  You can go back to the start of the thread and read them fully if you like, but here they are ...

1-Complete Absence of Hominid Civilizations Today
2-Unconvincing Fossil Record
3-Enormous Non-physical Differences Between Apes and Humans

I also mentioned 2 possible implications of common descent which to me are kind of interesting to think about, but have nothing to do with proving or disproving common descent, so I will not bring them up again.

I then brought up the Vitamin C issue which was raised to me by Renier in another thread.  Renier said that he used to be a YEC but the "broken Vitamin C" commonality between apes and humans was the major issue that made him abandon the YEC position.

I read the link that Renier referred me to, "Plagiarized Errors and Molecular Genetics" by Dr. Edward E. Max, MD, PhD at Talk Origins.  I think you all know Dr. Max's argument.  He says that in the same way that plagiarism was proven in the copyright case because an error was duplicated, so also common descent is proven with apes and humans because their genomes contain the same error, namely the broken GULO gene.

I said that Dr. Max is making an unwarranted assumption in saying this for two possible reasons.  And at that time, I did not have enough information to know which was the most probable reason for his unwarranted assumption.  The two possible reasons were (I now put them in the order that I believe most likely) ...

Scenario 1-The GULO gene could have broken independently in apes and in humans.  The Inai article shows that it did indeed break independently in guinea pigs, so why should it not break independently in apes and humans?       OR ..

Scenario 2-The "broken" GULO gene was never a functional GULO gene in either apes or humans.  It always has had some unknown function and still does to this day.  Argystokes called this possibility "pseudo-GLO" and rightly asserted that we should be able to find this gene's homologue throughout the animal kingdom--even in animals that do have a functional GULO gene.

We went through some logic exercises comparing the DNA code to relatively unknown languages, and we went down a small rabbit trail with the AIG article and the whole "humans are more closely related to guinea pigs since they both have broken GULO and 36% similar substitutions" idea that AIG seems to be promoting.  To tell you the truth, I honestly don't even know what AIG is asserting exactly, but to me it has very little bearing (if any) on the main issue that we are discussing.

We ended up yesterday determining that the "broken" GULO gene is not 100% identical between apes and humans and you say that this is not predicted by evolution anyway.  OK fine. I think we agree that there is roughly 95% similarity as is also the case for most other genes compared between apes and humans.

So now we are back to Scenario 1 (I'm not sure anyone has ruled out Scenario 2, mind you ... if anyone has info to rule this out, please say so) and your contention is that 95% similarity of the broken GULO gene is powerful evidence of common descent, right?  

Well I disagree and here is why.

1-We have already seen that the GULO gene "broke" independently in guinea pigs.  Why should it not "break" independently in humans and apes?  I think Common Descent or Common Design can explain this equally well.  It is not deterministic between the two competing views.
2-You give me analogies of houses designed without steps but this is not analogous to the situation we have.  I will explain why, but let me first review the Creationist position.

Again, my Creationist Theory regarding apes and humans is that there was one pair of human "kind" ancestors and one pair of ape "kind" ancestors.  Now I do not have a formal definition of "kind" yet and I admit there may have been a "monkey kind" pair as well, but this is not important for the present discussion.  The general idea of Creationist Theory is that there were a relatively limited number of "kinds" created by God, and that God "programmed" enough genetic information into each separate genome so that each "kind" would be able to adapt to the various environments in which they found themselves as they spread out all over the earth.  Today, of course, we find that monkeys and apes have diversified into many different species and that humans also have diversified greatly.

If Scenario 1 above is confirmed, then it is perfectly logical to assume that the Creator designed apes and humans separately, then mutations later caused the GULO gene to break independently in both.  What is so unbelievable about this?  After all, it is a creationist prediction that organisms will accumulate more and more harmful mutations with each generation.  This has been heartily confirmed with fruit flies with "evolution on fast forward."  Why should it be any different with apes and humans?  The "missing steps on the houses" analogy does not apply because no creationist is proposing that apes or humans were originally designed with a broken GULO gene.  It is also perfectly consistent with Creationist Theory that apes and humans have 95% similarity in their genomes.  After all, why shouldn't they?  They do look about 95% similar in their morphology.  But this supports Common Design just as well as it supports Common Descent.  Sure, apes and humans could have had a common ancestor.  And if they did, we would expect to see 95% similarity, an apparently fused gene, etc.  But we would then have what I consider to be 3 enormous challenges outlined above.

Now I do realize that proposing a Creator is an enormous challenge to the intellect as well.  And I do appreciate your objections to this idea that you have voiced.  I admit that I have absolutely no idea how the Creator designed these creatures.  Does he have a neat "Animal Design Software" package that he has on His computer that he can "drag and drop" different animal parts, then hit "Process" and the computer spits out the genome?  I have no idea and I know it challenges the mind to try to imagine how any Supernatural Being could achieve the designs we see in Nature.  But to me it is an even larger mental challenge to envision how it all comes about by random mutation and natural selection.  The probabilities against evolution of gross morphological changes are staggering.  The experimental evidence is non-existent.  The fruit flies get damaged or killed when we "speed up evolution."  And where did the first single cell organism come from?  I don't think anyone has a clue about that.  The proposals for how the bacterial flagellum and other innovations might have evolved are just as "Alice-in-Wonderland-ish" to me as proposing a Creator.  I have read them.  They are a joke to me. The fossil record is extremely weak.  The "evidence" that the earth is millions of years old is based on unwarranted assumptions which I will show.  The typological perception of nature shown by Denton to exist at the molecular level is powerful confirmation of the Creationist model, not the common descent model (in spite of Talk Origins lame attempt to discredit it).  It is obvious that a global tectonic and hydraulic catastrophe was responsible for the universal phenomenon of sedimentary, fossiliferous rocks, not uniformitarian processes over millions of years.  More on all of these issues on my other thread.

But just because I have no idea how the Creator might have designed these creatures does not mean that He did not.  And I admit that I am not going to be able to "prove" to you that He did with the "Scientific Method" as you understand it. This is an extremely important point.  Scientists today do not admit certain kinds of evidence into the arena and I (and Meyer, et al) believe this is an enormous mistake.  To explain this simply, what you are really saying when you say that a "God Hypothesis" is unscientific, is that you rule out the "ET Hypothesis" that maybe an advanced civilization "planted" life here, and you rule out any possibility of any kind of Intelligence that could have been responsible for life here on earth.  This to me is ultra-naive.  Why are we so proud as to think there could be no advanced civilization that is far advanced in their technology so that they would be able to sit down at their computers and design 1000 or so distinct, original "kinds" and "plant them" here on earth?  Maybe we are one big "science experiment" to them. Or maybe it's not a civilization at all. Maybe its ONE SUPER-MIND, like God, for example.  To me, it is utter folly to rule out these possibilities.  And to really explore these issues, we need a broader definition of science than your definitions.  Falsifiability and some of the other demarcation criteria proposed last century must be dispensed with.  We need a robust science that admits all possibilities.  Quackery should not be defined and dictated by a ruling elite of naturalistic scientists.  We should allow quackery to take its course and wind up on the rubbish heap of junk science all by itself through action of the free market of ideas.  Allow astrology into the arena.  It will die a quick death on its own.  Allow Scientology and "Christian Scientists" into the arena.  They will die as well.  Allow homeopathy and acupuncture and everything else you can think of into the arena.  Who cares?  They will not gain a majority if they don't have any merit.  The only reason flat earthism and geocentrism gained a majority was because the ruling elite (the Catholic Church) force fed it to the people.  In my opinion, this is why neo-Darwinism has any following at all among the people.  It is basically being force fed by the "ruling elite" of the scientific community, which I think is quite heavily funded by the government.  

Now don't accuse me of thinking there is some kind of conspiracy among scientists.  I don't think that.  I just think there is a powerfully tempting idea out there among scientists called Darwinism, or naturalistic evolution, or whatever you want to call it.  Scientists like it because it requires no Creator and that has a lot of good implications from their perspective.  Younger scientists are taught this theory and want approval from superiors and peers alike.  So naturally they overlook some of the glaring difficulties and explain them away.  And so the cycle goes in academia.  But I do not think there is some hierarchy somewhere that is somehow planning to brainwash everyone with Darwinism.  I just think there is a government funded consensus and the result is that it has a similar effect as the medieval Catholic church did in that the people are force fed some rather strange views of Origins.

Anyway, back to the Vitamin C issue.  Let's get to the bottom line.  

It appears to me that no one here has a convincing argument that favors Common Descent over Common Design to explain the "broken" gene in both apes and humans.  Either one can explain it just as well.

Am I correct?  Or am I missing something?

(Note for Faid:  I know you are trying very hard to get me to see that the AIG people are a bunch of liars, so I'll tell you what I'll do.  I'll agree with you that they are all a bunch of liars and we all know what a liar I am--I've been told this many times here--and I would add that the Talk Origins people are probably liars as well, and probably many of you are also liars, and of course, the President is a liar and all Republicans are liars.  So why don't we just agree that we are ALL a bunch of liars, then we can agree on something and get on with arguing.  What do you think?  :-)


(One more note:  As a side issue, I am interested in hearing continuing dialog about the AIG paper by Woodmorappe and what your analysis is regarding what their argument even is and the various data which may confirm or refute it.  But I am more interested in people presenting actual relevant data to me as opposed to evolutionary analysis of that data.)

(And remember ... I WILL become an evolutionist if the evidence is convincing enough to me.)

Date: 2006/05/16 05:58:54, Link
Author: afdave
Quote
If you went to church and saw half a dozen kids sitting together, and all had HUGE noses (way bigger than anyone else there, except for one of the adults sitting with them), you could conclude that each kid had a separate set of parents, and just happen to all be sitting together.  Or you could bust out Occam's Razor and conclude that they are siblings.  Oh, they also look a lot alike aside from their noses as well.  And there's no such thing as a bignose club.


Kids with big noses and other features that look alike is in an entirely different universe than what we are talking about.

What we are talking about is going to church and seeing some chimps on the same pew as some boys.  The creationist says "Gee, I think they are not related."  The evolutionist says, "Gee, I think they ARE related."

No you go figure who's right.

Russell said ...
Quote
You seem to have missed the entire point of the Max article. Shared ancestry predicts shared errors. That's what you see in the primate gulo gene. A completely different set of errors is seen in the guinea pig gulo gene, indicating a separate origin. Got that? Common ancestry predicts the same errors in humans and the other primates; a separate set in guinea pigs. If the errors occurred independently in guinea pigs, chimps, monkeys, and humans, you would expect the errors to be similarly diverse in all of them.


Shared ancestry predicts shared errors ... no problem.  I agree.  But Creationism predicts the same thing, namely, the Creator made apes and humans as separate kinds with functional GULO, then both might lose function through mutational degeneration.  Big deal.  This is what creationists expect.  I would expect other species to lose the function in years to come also.  What do we find in apes and humans?  Voila!  95% similar broken GULO!  No surprise there.  Even if it is the same substitution (or deletion or whatever) in apes and humans, so what?  Humans and Guinea Pigs have 36%  (High percentage to use Inai's words) identical substitutions.  Why shouldn't apes and humans also have an even higher % of identical substitutions?

Dr. Max does not even say the error itself is identical.  He just says both apes and humans have broken GLO.  But even if there were some "identicalness" this proves nothing for evolutionists.

Also note the bold print in Dr. Max's article where he makes the goofy assertion that Creationists believe that humans and guinea pigs were designed to function without GLO.

Baloney.

I just got through telling you what THIS creationist believes--they were both designed with functional GLO (if Scenario 1 is true), but then it broke.

Russell-- you have proven nothing.  

From Dr. Max's article ...

 
Quote
Guinea pigs and primates, including humans, get sick unless they consume ascorbic acid in their diet. For humans and guinea pigs, ascorbic acid is thus a vitamin (vitamin C), while most other species can synthesize their own ascorbic acid and thus do not require this molecule in their diet. The reason humans and guinea pigs cannot manufacture their own ascorbic acid is that they lack a functional gene encoding the enzyme protein known as L-gulono-gamma-lactone oxidase (GLO), which is required for synthesizing ascorbic acid. In most mammals functional GLO genes are present, inherited - according to the evolutionary hypothesis - from a functional GLO gene in a common ancestor of mammals. According to this view, GLO gene copies in the human and guinea pig lineages were inactivated by mutations. Presumably this occurred separately in guinea pig and primate ancestors whose natural diets were so rich in ascorbic acid that the absence of GLO enzyme activity was not a disadvantage--it did not cause selective pressure against the defective gene.

Molecular geneticists who examine DNA sequences from an evolutionary perspective know that large gene deletions are rare, so scientists expected that non-functional mutant GLO gene copies--known as "pseudogenes"--might still be present in primates and guinea pigs as relics of the functional ancestral gene. In contrast, Creationists believe that humans and guinea pigs were each created independently of all other species and must have been "designed" to function without GLO. If this were true, these two species would not be expected to carry a defective copy of the GLO gene. In fact, GLO pseudogenes have been detected in both guinea pigs and humans (Nishikimi et al. J Biol Chem 267: 21967, 1992; Nishikimi et al. J Biol Chem 269:13685, 1994), consistent with the evolutionary view; presumably, related pseudogenes also exist in non-human primates that require dietary vitamin C. The kinds of mutations found in the human and guinea pig pseudogenes are typical of the ones seen in genetic diseases like those mentioned earlier. In this essay I call the human and guinea pig GLO DNA sequences "unitary pseudogenes" to distinguish them from two other kinds of pseudogene occurring in a species that also possesses a functional copy of the same gene (see below). Readers should note that the term "unitary pseudogene" is used here for convenience; there is no standard nomenclature to describe this rare type of pseudogene.

Date: 2006/05/16 06:03:11, Link
Author: afdave
I said ...

Dr. Max does not even say the error itself is identical.  He just says both apes and humans have broken GLO.  But even if there were some "identicalness" this proves nothing for evolutionists.

And I add that ...

the reason this "identicalness" proves nothing for evolutionists is because of the 36% "identicalness" with guniea pigs!  Are you going to tell me that Guinea pigs and humans are related?  I hope not.

Date: 2006/05/16 07:56:04, Link
Author: afdave
Quote
You are aware, of course, that God, being all-knowing and "out of time", already knew all that when he was making the world and man in all their perfection, right? And yet he went on to impose that pointless command (not to eat a fruit, a fruit that suppoesdly did something they already could do, A fruit that had no reason to be there in the first place than to "test" them for something God knew they'd do all along when he made them), And then "cursed" them, and all their unborn children who did not even exist yet, for eternirty? And all this because he loves us? Doesn't this look like some kind of twisted game?

That was the first question I asked you, and you never answered...

Anyway, all this is NOT science, and we both know it, so nevermind.


It should be science.  Theology was once known as the Queen of Sciences, and it should be reinstated as such.  Here's just a snippet from my argument for that from the "Ape Questions" thread.
Quote
And I admit that I am not going to be able to "prove" to you that He did with the "Scientific Method" as you understand it. This is an extremely important point.  Scientists today do not admit certain kinds of evidence into the arena and I (and Meyer, et al) believe this is an enormous mistake ... and I wrote lots more which I won't repeat here ... go read it on the other thread ...


The Genesis story makes perfect sense if you really examine it.  The creation of mankind with a choice necessarily requires the possibility of evil, which by definition is "opposition to the will of the Creator."  What other definition makes sense?  What fun would it be for parents to have "robot children"?  It's a lot more fulfilling for parents to have kids that have a free will.  There is risk, to be sure.  Think about Jeffrey Dahmer's mom, but every day parents all over the world deem it worth the risk.  Why?  Because of the greater good which may result.  Their child may grow up to be the next Louis Pasteur or Mother Teresa.  And even if they don't achieve to this level, there is the wonderful blessings of home and family ... riding bikes, reading stories to them, watching them take their first steps, watching them play little league ball, answering their funny questions, and on and on.  Why is this any different to visualize with God?  To me, it makes perfect sense that God would feel exactly the same way.  Does he want an earth full of zombie robots?  Of course not.  He wants people that have the ability to hate His guts, but make the conscious decision to love Him ... just like human parents do also.  And you can't escape this argument by saying "Well, it's different with God because supposedly He's all-powerful and all-knowing.  Why doesn't He intervene and just stop all this rot?"  Well, He does sometimes--like with the Flood--and He will again at the End of Time.  This also is just like human parents.  They intervene sometimes in the lives of their children and they choose NOT to intervene sometimes because they want the child to learn some lesson.  What is so strange about this when it comes to thinking about God?

Quote
I don't mean things that are 'wrong' nesseceraly, I just mean the odd enzyme that isn't as efficient as it could be, or a pathway that has more components than it could have because it evolved that way (and no I am not talking about redundancy).

Examples?  Are you sure these less-than-optimum items could not be explained by mutational loss of function over time as Creationism predicts?

Quote
Ok so if we say God make very small molecular changes in man fair enough, even though it doesn't appear that way. Why would he then make the same changes in all other organisms, which don't have any phenotypic effect on man at all in his interaction with them You can shrug off 'bad design' but you can't escape the fact that these sytems look like they have evolved as opposed to been engineered.
Creationists don't say God makes very small molecular changes in man.  We say this ...  
Quote
Again, my Creationist Theory regarding apes and humans is that there was one pair of human "kind" ancestors and one pair of ape "kind" ancestors.  Now I do not have a formal definition of "kind" yet and I admit there may have been a "monkey kind" pair as well, but this is not important for the present discussion.  The general idea of Creationist Theory is that there were a relatively limited number of "kinds" created by God, and that God "programmed" enough genetic information into each separate genome so that each "kind" would be able to adapt to the various environments in which they found themselves as they spread out all over the earth.  Today, of course, we find that monkeys and apes have diversified into many different species and that humans also have diversified greatly.
Of course, we say similar things about other "kinds" of organisms.

They do not at all look evolved to me.  There are some things which could be construed that way.  But when everything is considered including stuff like Michael Denton's sequence analysis (Talk Origin's rebuttal is lame), then the evidence is much more convincing in favor of design.

Quote
What qualities are necessary to call something "intelligent"?

For example, how intelligent is a computer and computer program system like "Deep Blue"? That's the chess playing computer -- it has a kind of foresight, it plays chess and looks ahead, it has memory, but does it have "desire," "awareness of self," "Perceptions"?
My only experience with "intelligence" is human, animal and as you point out machine "intelligence" and they are all different.  I think when more research is completed, intelligence will be more rigorously defined.  Dembski obviously is all over this one and he says that it really boils down to the ability to make choices.  Maybe he's right.  I don't know what definitions will ultimately hold up to scrutiny.  One possibility for intelligence that naturalistic scientists rule out, however, is what might be called "spirit intelligence."  My theory is that what really makes me ME is some sort of immaterial "spirit" that somehow interacts with the neurons of my brain.  The real "me" is the spirit and it controls and directs the conscious choices my brain makes all day long.  Of course, I also theorize that there are other spirits which to a greater or lesser degree can compete with my own spirit for control of my mind.  My theory includes both "evil" spirits and "good" spirits, and of course the ultimate spirit--God Himself.  

Science should expand its horizons and investigate these types possibilities.

Quote
I hope there will be more besides this. You only listed one: "This 'ET' probably can communicate to humans."  And your only cited evidence for this prediction is the Bible.

The problem there is that the Bible is more readily explained as a product of purely human activity. We know humans exist. We know they write books. We know different human groups have claimed the existence of different (and often mutually incompatible) Gods throughout history. We know humans sometimes believe things that are objectively false. We know that groups of humans sometimes share common beliefs that are objectively false.

Thus, we can explain the Bible using entirely known phenomenon, without recourse to an undemonstrated God.

Which does NOT, of course, disprove God. Nor does it disprove the Bible as His word. It just means that the Bible is not useful evidence of God communicating with us.
I would challenge your next to last statement.  I agree that the Book of Mormon can be easily explained as a forgery of Joseph Smith.  I have my opinions about other "sacred" texts. But the Bible is so unique when compared to these other texts, that it is really in a class all by itself as Josh McDowell makes such a clear case for in "Evidence That Demands a Verdict, vol.1".  My whole belief system hangs on two major premises for which I have found overwhelming supporting evidence:

A--The Wonders of Nature can best be explained by a Supernatural Agent
B--The Bible can best be explained by a Supernatural Agent


Everything else I say flows naturally out of these two premises.  And it is these two major premises which I am seeking to show my evidence for on this thread.

Quote
Any of the following would certainly make me give it stronger consideration:
*  An objectively verifiable burning bush talks to me and/or to others.
*  A sea gets parted, preferably accompanied by a booming voice.
*  The earth stops rotating for a while, then starts up again, all without killing us.
*  A new species of dats appears suddenly, preferably in a place where there were definitely no previous dats. Molecular analysis shows that half the dats' genes came from dogs, and half from cats.

If the Bible is true, God did all those sorts of things before, so he can presumably do them again, right?

You may say that the Bible shows he already did them, and i should accept that. Unfortunately, we have no corroborating evidence that those things happened. In fact, objective evidence frequently contradicts modern translations of the Bible, e.g. regarding the age of the earth, claims for a global flood, etc.

On the other hand, we do have evidence that people sometimes make up stories like those, or misinterpret 'natural' phenomena as being the work of God.

So, if God exists, and He wants to do some of those things again now, when we're better equipped to observe and record them objectively, I'll reassess my non-belief. Or, maybe you can present actual evidence that is not more readily explained by known phenomena. You haven't done so yet, and I strongly doubt you can, but maybe I'm wrong.
May I submit to you the idea that God does not need to make burning bushes and part oceans anymore to show his power and brilliant intelligence?  We now see different "miracles" down the tubes of our microscopes and telescopes and we don't need the other miracles anymore.

Quote
Dave, if your arguing for the "philosophical validity" of the teleological argument....then you may need to stop.  I, as well as most others, will admit that it is a valid argument.  I will even go as far as to say that the "fine-tuned" universe argument is my rational reason for believing in God.

You need to realize however that everyone you are talking with is arguing against the scientific validity of the argument.
In that case the teleological argument falls short of any sort of validity.  It makes a great deal of assumption, and while those assumptions may turn out to be true....they arent scientifically valid.

Do you understand the difference between validity and factual?  They are mutually exclusive concepts.  

BTW....you never did explain your belief in the divinity of Jesus.  Im still a little curious about that.
Please refer to my discussion above about my view that the definitions of science need to be expanded to what they once were in the past.

I do believe that Jesus was in fact, the Creator in a human body.  Weird I know, but well supported I believe.  More on that as we progresss.

Quote
Dembski assumes against the evidence of neuroscience and  computational explorations of A.I. that intelligence is something supernatural. Minsky tried to build naturalistic intelligent machines and programs.

So, when you say that the Intelligent Agents that you know about do have all those items -- is that because you don't know about robots like Cog? Or chess playing computers like Deep Blue? -- or is it because you don't consider those things composed of intelligent agents?

And where do roaches, ants and other insects fall in  your estimation of intelligence? Ants and  termites do build things like people do -- homes and cities of a sort -- does that similarity imply that ants and termites are intelligent in your view?
 I'm not sure what I think about machine intelligence.  Of course, the ultimate machine intelligence would be to take the human genome, synthesize it artificially, modify it to our liking--blond hair, blue eyes, good looking, smart, etc. and place it into an egg and let it grow.  Would it be alive?  I'm not talking about cloning.  I'm talking about true "organism production."  Weird to think about, no doubt.

Quote
Because, Dave, we wouldn't know what to search for. We know of exactly one "intelligent designer": ourselves. If we have no idea what a "designer" is capable of, how would we know what to look for in its designs?

Every time we've been able to determine "design" (the pyramids, Stonehenge, etc.) it's been by direct reference to what we know humans are capable of. How would we determine, even in principle, whether a mitochondrion was "designed" if we can't even make any guesses as to the capability of the "designer"? As I pointed out in a post a few pages ago, that becomes the task of scientists whether they believe in natural or supernatural causes. And the difference is, scientists who believe in natural causes already have an idea of how something like a mitochondrion could have come about; creationists have no idea at all how a "designer" could have come up with a mitochondrion.

And if a "designer" is capable of anything, then how would go about ruling out "design"? It couldn't be done, which means the "creator god hypothesis" is unfalsifiable, if you're using "biological machines" as evidence in favor of the hypothesis.


Of course we do not have any idea how the Designer might have come up with a mitochondrion design.  That is precisely why humans study nature to get inspiration for their own designs.  But if we can figure out how He did it, maybe we can duplicate it ... this is what happens all the time and it is really cool!  But just because we don't know how He did it does not make it sensible to a priori rule out the possibility that He might have and don't even allow the discussion.  It also doesn't make the assertion that it happened by chance any more plausible to sensible people.

Quote
Good for you, Dave. Now, would you care to favor us with your hypothesis as to how this "ET" out there actually "made" these "artifacts"? Because evolutionary biologists already have a good idea of how these artifacts are created. What's your guess?

And, how would you go about falsifying your "ET" hypothesis? What evidence would lead you to believe that life wasn't "ET"ed into existence?

Okay, Dave. How did he do it? You don't know? He just "willed them into existence"? What's the method? Because without that, you're not talking science. You're talking wild-assed speculation
No.  I have no idea how He did it.  But it's fun studying it and trying to figure it out.  This is a productive form of inquiry which yields many fruitful new technologies.  Your definition of science is too limited if you cannot be expansive enough to consider the possibility of Someone somewhere out there who just might have higher tech than you.  My wild-assed speculation is less "wild-assed" than your wild-assed speculation.  Falsification is a bogus demarcation criterion if we are talking about expanded science definitions.  See Meyer's discussion.

Quote
See, here's the problem with argument by analogy. You think these natural structures resemble man-made structures; I submit that they do not. Bird wings bear only the remotest resemblance to aircraft wings. About the only thing they have in common is cross-section. Bird wings are much more similar to tetrapod limbs than they are to aircraft wings. The internal structure isn't remotely similar to aircraft wings, but there is an almost perfect one-to-one correspondence between the bones in a bird's wing and the bones in your arm.

And what human-designed thing does a mitochondrion resemble? Don't say "a factory," because no human factory looks even slightly like a mitochondrion.

The fact that two structures that have similar function have similar form isn't really evidence for anything other than the engineering constraints imposed by natural law. How many different forms of a wing are theoretically possible, Dave?
Agreed that the internals are vastly different.  And better, I might add from several perspectives.  What airplane have you seen that can reproduce itself?  Or feed itself?  Or maintain itself?  Wouldn't that be great if Boeing came up with that?  American Airlines could lay off their whole maintenance division!  And they wouldn't have to acquire new aircraft unless they wanted new capabilities.  They could just have two existing, old aircraft "mate" and presto ... baby airliners!  And for fuel, just put those airliners out to pasture ... no more fuel trucks!  The possibilities are endless!  Now before you say I'm crazy, just think about what we are doing with nano-technology.  The airliners are a silly example, but the fact is that we are mimicking nature at an ever accelerating pace precisely because we find such brilliant designs there.

Quote
And besides, you're putting the cart before the horse. The notion that human-designed structures bear resemblance to natural ones is better evidence that humans know how to copy than it is that natural structures were designed.

I disagree.  To me it is so obvious that living systems were designed because of the higher-than-our-technology involved (by several orders of magnitude) that it stands as the 8th Wonder of the World to me that so many scientists don't see it.

Quote
This argument would be more compelling if the earth were six thousand years old, but it isn't. Humans have had about 30,000 years to develop any sort of technology, maybe 90,000 at the outside. Meanwhile, natural processes have had almost five billion years to develop solutions to varying problems. Is it any surprise that natural solutions are often more "advanced" than human ones? Well, I guess it would be to you, but that's only because you think the earth's age is .0001% as old as it really is.
If you had 5 billion TIMES 5 billion years, it would still not be a plausible story to me, the odds are so staggeringly small for life as we see it to come into existence and develop the way evolutionists say it developed.

Quote
Which makes the whole thing meaningless: ANYTHING you think is positive you explain as good design; ANYTHING you think is negative you explain as curse; since you can account for anything, post hoc, you can predict nothing and explain nothing.

Also this reflects your anthropocentric world view: the whole universe is supposed to be about US. Your only evidence for this point of view is the myths of ancient tribesmen who thought that the sun went round the earth. Some of those myths are very poetic, others are horrible, but all of them stem from ignorance rather than knowledge.
Creationism explains everything MUCH better than Evolution does.  It explains designs in nature, it explains the human condition, it explains the fossil record, it explains coal beds and oil wells, it explains the races of mankind.  It explains dinosaurs and the ice age.  It has predicted many things including the ubiquitous gaps in the fossil record and support for the typological view of nature when the molecular data was examined.  It has predicted "downward" evolution of increasing harmful mutations and continued loss of function over time.  It predicted that the universe had a beginning and predicts that it will have an end, and many, many more things.  

My evidence for the anthropocentric world view is NOT what you say.  It was originally from the Bible which has been proven to be real history.  This view has been recently been confirmed by science by Michael Denton and others.

Quote
See, Dave? That's how rational people admit they were wrong.
I have admitted when I was wrong.  Have you not read the "Chimp Chromosome" thread?

Quote
I really do hope you were joking, Puck.  Dave, I already knew was a mental midget who'd gladly claim that God can create square circles, married bachelors, and five-legged tetrapods.

Dave, I've asked before, but haven't gotten an answer: can God create another God?  Can God create a better God?
I have no knowledge if God can do those things.  To me they are silly questions.

Quote
Ahhhh...it just wouldn't be the same, having a scientifically illiterate fundy proselytizer prattle on without bringing up Pascal's wager.

Gee Dave, shouldn't you subscribe to the practices of Buddhism, and Hinduism, and Islam at the same time too just to further reduce your risk?  Think of it as buying extra insurance to hedge your bets. One can't be too careful about the afterlife, you know.

Christianity is an all-or-nothing proposition.  Jesus made it quite clear that He is the only Way.   If you study the Christian scriptures, you would see that the above suggestion is not an option.

Quote
No....Davey should obviously either become a Muslim or a Mormon.  They were both religions dictated directly by God himself.  They obviously have more validity than the New Testament of the bible which was thrown together by men.

Either that or maybe Buddhism/Hinduism, since almost everyone agrees that it is more spiritually fulfilling than Christianity...and it actually has an answer to the question of necessary evil
No.  As you will see if you stay with me, the Bible is in a class all by itself and is best explained as the sole, authoritative message of the Creator to mankind.

I know there are a lot of unfulfilled "Christians" in the world.  I don't know their story.  Maybe they don't really understand Christianity.  I can tell you that I am fulfilled.  And I know tons of spiritually fulfilled Christians who are an absolute gas to be around.

I don't know many Buddhists and even fewer Hindus.  My sister tried Buddhism and later committed suicide.  I've read stories about Hudson Taylor in China and his encounters with Bhuddhism and they were not pretty.  Ditto for William Carey with Hinduism in India.  But that's about the extent of my experience with these religions.

************************************************************************

I am about ready to move on to my next piece of evidence for a Creator God.  Does anyone have any more questions?

Date: 2006/05/16 11:39:33, Link
Author: afdave
Quote
*It could be just me, but I'm pretty sure that earlier in the thread (i.e., before you shifted gears) you argued that they WERE designed that way for an unknown function.  Is my memory faulty, Dave?

No.  Your memory is not faulty.  I think the 2 scenarios I mentioned early today are possibilities.  You have not given me enough information to decide which one is correct.  All you have given me is that ape and human "broken" GULO is about 95% similar.  No one has confirmed for me if this "broken" GULO gene also occurs throughout the animal kingdom and may have some unknown function, as Argystokes suggested.

Date: 2006/05/16 16:53:47, Link
Author: afdave
Keep trying to insult me, Aftershave.  It might work yet if you just keep it up long enough!  I like the new angle of insult ... very innovative.  Maybe you could insult my wife next.

You go right ahead and send your kids after those "competitive jobs" so they can spend their life working for someone else.  Mine already have their own business like their dad ... maybe my kids will hire some of your kids if they are smart and work real hard.  

:-)

Date: 2006/05/17 00:36:18, Link
Author: afdave
I take it you're surprised ...

I keep telling you guys ... we're taking over!  

But it's not too late to get off "The Darwinic"

www.dissentfromdarwin.org






(For you slow ones, that's a take off on the Titanic ... get it?)

Date: 2006/05/17 01:01:43, Link
Author: afdave
Hey Beery!

Thanks for giving me a new site to read ...

Later ...

Your YEC buddy,

AFD

Date: 2006/05/17 03:51:30, Link
Author: afdave
Where to start?  Probably the best place would be to float a reminder to you about "The Big Picture of This Thread" and "Your Role" vs. "My Role" and how this little discussion of GULO fits into the big picture.

(1)  One reason I am here at PT is to see if there really is anything substantive to evolutionary arguments.  Seems like a good place to find out would be a forum where evolutionary scientists hang out.
(2)  Notice that on this thread, it is not my primary goal to prove to you something positive about the Creationist view of Apes and Humans.  It is to see if YOU have some positive, convincing proof that would make me rethink my position that Apes and Humans are separately created kinds.
(3)  Someone has pointed out that I just want everyone else to run around chasing data and I myself don't want to do any "real scientific work."  Well, in this case, YES.  The burden is upon you to try to convince me.  I have always felt sorry for evolutionists in a way, because I have always thought it would be a huge undertaking to try to defend many aspects of it, and so many arguments have crashed and burned in the past when new information is known.  I'm finding this to be true with Ape/Human issues in general and with the GULO issue in particular.  Sorry if this observation frustrates you, but it's an honest observation.
(4)  Someone has correctly observed that I am an apologist for YEC.  I'm glad someone has figured this out because it is true.  I have said many times that I don't want to become a specialized scientist in a particular field--we have many of those already.  But I am being honest when I say that I would abandon the YEC position if given some convincing evidence for NOT being a YEC.  It's just that no one has yet.

Now that we have that "role review" under our belts, let's dive in.

Just so Faid is not insulted that I never look at his links, I'll post something from one of his links ...
 
Quote
B-1: The GULO Gene as an Example of Shared Deletions:
Given below is the alignment for the same part of the GULO gene that we examined in lesson A on Vitamin C,
along with the corresponding sequences from 3 primate species that are incapable of synthesizing Vitamin C, the
chimpanzee, the orangutan, and the crab-eating macaque.
Human TACCTGGTGGGGGTACGCTTCACCTGGAG-GATGACATCCTACTGAGCCCC
Chimpanzee TACCTGGTGGGGCTACGCTTCACCTGGAG-GATGACATCCTACTGAGCCCC
Orangutan TACCCGGTGGGGGTGCGCTTCACCCAGAG-GATGACGTCCTACTGAGCCCC
Macaque TAACCGGTGGGGGTGCGCTTCACCCAAGG-GATGACATCATACTGAGCCCC
Rat TACCCCGTAGAGGTGCGCTTCACCCGAGGCGATGACATTCTGCTGAGCCCC
Link to article


Oh, by the way ... maybe I should have clarified this earlier ... YECs have no problem with the idea of Apes and Monkeys having a common ancestor.  We actually agree that they did.  I think Noah took a pair of genetically rich "ape/monkeys" on the ark and these diversified into the many varieties we see today.

So the only thing I care about here is the Ape-Human thing ... the supposed shared ancestry.  

Now let's analyze this.   As I have found in so many areas, you make many assumptions:

1)  You assume that the ONLY reason human and ape GULO does not work is because of this single deletion.  Am I correct?
2)  You are assuming that pseudo-GULO is in fact "broken GULO".  Argystokes has not yet demonstrated that to me.  To me it is a possibility that "pseudo-GULO" has some as yet undiscovered function.  Remember the good old "vestigial" organs that turned out to have function after all?  Why wouldn't "vestigial" GULO turn out the same way?
3)  You are assuming that this "deletion" is in fact a deletion.  The word deletion implies that it was there at one time in history and now is not due to a mutation.  I think you base your idea that it is a deletion by comparing it to rat GULO.  A tempting comparison and I do see your logic, but how is this conclusive?  An interesting experiment in this regard would be to delete the "C" in question in the rat GULO, then see if rat Vitamin C production ceases.  Has this been done?  Is it even possible?  How about inserting a "C" into some ape GULO, then seeing if Vitamin C production commences?  I did read the Rat/GP/Trout experiment and it is interesting, but does this prove that the "C deletion" is definitely the cause of non-functionality?  
4)  You assume that this "C deletion" occurring independently in apes and humans is a highly unlikely event.  Why is it so unlikely?  After all, there are many identical substitutions in an unrelated ... er ... *cough* ... distantly related (yes, yes, I forgot my head yesterday for a moment ... it is still a challenge for me to remember that you all think ALL organisms are related through common ancestry), i.e. our furry friend, the guinea pig.


 
Quote
Dave, this is the part you're not getting: Creationism predicts everything. Creationism is an ad hoc hypothesis that can always fall back on the proposition that the Creator could always have done something in a particular way, and given we know almost nothing about the Creator, we cannot make assumptions about why it would do something.

Now, Dave. Tell me something you could in principle find in the natural world that Creationism would not predict. Can you do it?
 

Creationism does NOT predict everything.  Here are 5 things it does not predict. (but evolution does predict and has been proven wrong)

1) "Upward evolution" ... it predicts "downward"
2) "Seamless fossil record" ... it predicts ubiquitous gaps
3) "Hominid civilizations" (or half-human to make Norm happy on terminology) ... it predicts fully human civilizations and fully ape "civilizations."
4) "Millions of years coal production" ... it predicts rapid coal formation
5) "An infinite universe" ... it predicts a finite universe that had a beginning

How far do you want me to go on?  I could keep going a long time, but you get the idea.  So you are incorrect.  Creationism does not predict everything.  

Evolution, on the other hand is almost "God-like" (actually fairy-talish) in its supposed explanatory power.  If a guy like Michael Behe comes at you with an irreducibly complex biological system like the flagellum, the "Evo Fairy Tale Machine" goes into high gear cranking out stacks of "just so" stories about how you all wish it might have happened.  None of this can be tested experimentally, of course, and no one has ever observed such an innovation happening in nature, and we all know what happens to fruit flies when you "speed up" evolution, but who cares about all of that.  On they go creating large volumes of "scholarly articles" which in reality are nothing more than "Alice-in-Wonderland" tales without the "fun story appeal."  Have you ever waded through one of those "How a Flagellum Evolved" technical papers?  I don't blame you if you haven't.  You would no doubt have headache afterwards if you did.


 
Quote
Also, as a side note, does Creationism make any predictions as to the number of "kinds" there are out there? Or does Creationism even have an estimate of the number of "kinds"? Because evolution does. It has a nice little diagram of the organizational structure of life on earth. Does Creationism have its own diagram, or does it just plagiarize the one created by real scientists?

I think they do somewhere.  I can find out pretty easily from AIG or ICR or someplace.  I just threw out that 1000 number.  I have no idea what a good number might be.  The actual number was not important to my argument yesterday, so I just picked one out of the air.


 
Quote
Seriously Dave, you are trying to do rocket science when you don't have basic physics down. Before any of this works, you need to understand why scientists believe that the earth is around 4 1/2 billion years old.
Yes.  The magic potion of evolution ... millions and billions of years.  I hate to be so unkind as to tell you that you might need to pay attention, but if you read this thread, millions of years doesn't have anything to do with the questions I have raised on this thread.

 
Quote
If you still refuse to address them, I'll have no choice but to infer that:
a) either you're in some OCD state, where you think that checking the link is like "giving in to temptation", expressing doubt in the eyes of you-know-who, or
b) You have already checked the links, but don't want to address them- and that is dishonesty.
Whew! I cut and pasted Faid's quotes.  Now he won't think I'm in an OCD state!

 
Quote
Mine says that you will not find a functional GULO region in this primate.  Yours has no reason to predict this.  Note that despite argystoke's interesting proposed experiment, we have no reason to expect the converse.  That is, we might well expect to find additional broken GULO regions in rats and other animals that still have functioning GULO and can synthesize vitamin C.  This would indicate duplication (similar to that found in hemoglobin genes and many others).  It would not indicate some vital and as-yet unknown function of the pseudo-GULO.  So, while it's an interesting idea, it wouldn't provide any magic bullet to decide between your "scenarios".  I notice that you didn't have enough understanding of the question to realize this.

Mine says that if we spliced a rat or mouse GULO gene into the primate's liver cells (as we have done for humans), it would be able to synthesize vitamin C.  Yours has no reason to predict this.  Mine says we couldn't do the same for a fish.  Yours?

Mine says that this pseudogene is likely the result of a retrovirus, and that the mutation occurred about 40 million years ago, in the shared ancestors of that primate and us.  Yours?

What does your "theory" predict for our newfound primate, Dave?

Or let's leave the hypothetical primate.  Let's look at a hamster, Dave.  What does your "theory" predict for hamster GULO?  Is a hamster part of the guinea pig kind?  The rat kind?  Its own kind?  Does it matter?  Can you -- without peeking at those hocus-pocus evolutionary phylogenies tracing ancestry -- predict anything about hamster GULO and vitamin C production?  Can you test your predictions on your own?

Who doesn't know the language here, Dave?
You are the biology expert.  I am the apologist.  Remember the role discussion above?  By the way, I am very impressed with some of the technical knowledge displayed here.  I don't want to trivialize that.  I am just pointing out some items which appear to be logical fallacies to me.

OK.  Over to you ...

Date: 2006/05/17 04:22:48, Link
Author: afdave
Quote
OA asks AFDave for the fourth time

New thread, my friend, new thread.  This one is about "Ape Questions" as you might find out by scientifically analyzing the title.

Go start a new one if Wesley will let you and I'll see if I can find time to come over and visit ...

Cheers!

(I did enjoy "Top Gun" ... glad to see you did too!;)

Date: 2006/05/17 05:10:23, Link
Author: afdave
Quote
How is a 'supernatural agent' explanatory?
it appears to be words strung together and declared an explanation rather than being an explanation.
You do know what an explanation is, don't you?

Second question:
given the examples you've provided, we must assume that God is physical and is, in fact, embodied as a matter of essential nature.
Otherwise, you undercut your recourse to "it's like human intelligence but more so" -- the only examples of intelligence we have or can legitmately conceive are embodied.
Intelligence is always action in the world.

Finally, please deal with the apparent fact that the world is causally closed.
You are correct that it is not explanatory in the sense that we know how the SA did it.  But please note that the 'Gods of Evolution' -- i.e. Millions of Years and RM/NS also do not have any explanatory power in the sense that you use.  I know you all try very hard to make it look like you have explanations, such as the stack of books displayed at the Dover trial, but these are nothing more than fancy "Alice-in-Wonderland" just so stories of how you wish it happened, or how you think it might have happened, or whatever.  None of this stuff can be demonstrated experimentally and when you have tried to demonstrate evolution experimentally, we have just the opposite of what you predict, i.e. dead and damaged fruit flies, etc.

Take my Creator God Hypothesis, on the other hand.  While admittedly we have no idea HOW the Creator did the things He did, at least we are honest about this and don't make up fairy tales about how we think He might have done it, unless we come across some experimental evidence that gives us a good reason to believe He did some piece of it in a certain way.  My Hypothesis fits well with observed phenomena in the universe which we live in and predicts many things which actually have turned out to be true as more knowledge has been gained.  My Hypothesis (the YEC has position) also has not changed over the last 140 years as yours has, and I doubt it will change.  As more information turns up, the YEC position will continue to be explained more and more fully and will itself explain more and more phenomena.

I don't follow why we must assume that God is physical.  I don't think I said "it's like human intelligence but more so."  I think I said that my hypothesis proposes that the Mind of God is like human intelligence in some respects, but far, far more advanced and powerful in its computing ability (or something like that).

Causally closed?  Please explain.

Return hugs,  AFD.

Quote
Im not sure this applies to nature. What does happen all the time is people use the principles of evolution.
For what?  I hear Evos claiming that to reject ToE is to reject progress and scientific productivity.  The only thing productive that I know of that comes out of ToE is Designed Adaptability and Natural Selection (which you call ambiguously ... 'evolution';), i.e. we now understand that bacteria adapt to anti-biotics and develop resistance and this helps us by prompting us to develop new anti-biotics, etc.  Here's a suggestion from a progressive minded YEC:  instead of trying to 'stay one step ahead' of the bacteria, how about we all recognize they were designed and then chase after a smarter way to defeat them more permanently than just developing a new anti-biotic every year.  That's just one suggestion.  There are many more.

Quote
You're dangerously misinformed and a perfect example of everything that is poisonous about Christianism, fundamentalism and the intelligent design movement.
You don't know logic.
You don't know what a scientific explanation is.
And when things are explained to you they don't penetrate your mental barriers.
And yet, you would have the arrogance to replace this mightly success that modern science is with your vague and backward notions of theology.
I hope one day you'll become a witness in another Dover type trial.

Yes. I'm dangerous and so was Newton and Maxwell.  Look out world!

Quote
No, Dave. Wrong, Dave. Saying a "Supernatural agent did it" explains exactly nothing. In fact, it's the ultimate admission of intellectual defeat. When you ask, "What caused this particular natural phenomenon?" and answer, "A supernatural agent did it," that's exactly equivalent to saying "I have no idea whatsofuckingever what caused it."
See response to Shirley's question on this thread.  I have also answered this criticism on the "Ape" thread.  Please re-read it.

Quote
You keep saying your "hypothesis" is "science," but in fact it's a "science killer." It annihilates any inquiry into how something actually happened, or what its cause was. If the answer to every question really was, "God Did It," we'd all still be living in caves.

I always think it's funny when Evos try to imply that "Their Blessed Theory" ToE is somehow responsible for all that is good in science, when in fact, the opposite is true.  The General ToE is in reality a "black eye" on the otherwise beautiful face of science. Have you never read the actual writings of the founders of modern science?  Do you really have no idea that most of them were theists?  Many of them YECs?  Living in caves!  What a hoot!  This is like Clinton bragging about the economy being so good when he had nothing to do with it.

Outta time.  Gotta run.  Tomorrow ... drum roll ...

Morality.  Why do we all have a sense of it?  Why do none of us live up to it perfectly?  Where did it come from?  How does this phenomenon give support to the Creator God Hypothesis?

Psychology ... that's science, right?

Reading assignment for tonight:  Mere Chrisitanity, Part 1 - Right and Wrong as a Clue to the Meaning of the Universe, by C. S. Lewis.

See you tomorrow!

Date: 2006/05/17 05:31:54, Link
Author: afdave
Quote
Tell us Dave, what incentive would anyone have in doing hours and hours of research and writing just so a disingenuous knucklehead like you can reject the data with a few flip sentences?

Dunno.  A lot have done it so far though.  Why would they not continue?  Maybe they have an insane fascination with 'brain damage' ??

(As someone here put forward)

Date: 2006/05/17 05:35:46, Link
Author: afdave
Or maybe it's the 'sharpening knives on dull stones' idea.

Who knows!

Date: 2006/05/17 16:49:52, Link
Author: afdave
Excellent cartoon ... Here's one of my favorites ...

Date: 2006/05/17 16:57:03, Link
Author: afdave
You mean BC?  As in Before Christ?

Date: 2006/05/17 17:06:17, Link
Author: afdave
AF Dave  said ...
Quote
Creationism does NOT predict everything.  Here are 5 things it does not predict. (but evolution does predict and has been proven wrong)

1) "Upward evolution" ... it predicts "downward"
2) "Seamless fossil record" ... it predicts ubiquitous gaps
3) "Hominid civilizations" (or half-human to make Norm happy on terminology) ... it predicts fully human civilizations and fully ape "civilizations."
4) "Millions of years coal production" ... it predicts rapid coal formation
5) "An infinite universe" ... it predicts a finite universe that had a beginning

How far do you want me to go on?  I could keep going a long time, but you get the idea.  So you are incorrect.  Creationism does not predict everything.


qetzal said ...  
Quote
Just in case there are any lurkers out there who think this is persuasive, I'll point out that none of these are predictions of evolution. I will also ask afdave: if we observe any of these things, do you agree that it's evidence against Creationism?


*Ahem* ... sorry ... I should have said these used to be predictions of evolution ...

Until they were disproven ...

Now, of course they are no longer predictions of evolution.

********************************

More ape fun tomorrow morning!  See you then!

Date: 2006/05/17 17:21:16, Link
Author: afdave
A good guess for the Flood of Noah is probably somewhere between 2000 and 3000 BC.

I don't do BCE.  Jesus the Christ earned the right to get the dates named after Him.

If some other religous leader wants to have a crack at it, they are welcome.

Just be as influential as Jesus was and you too can have dates referenced to your birth!

Date: 2006/05/18 01:14:32, Link
Author: afdave
Quote
Yes. I'm dangerous and so was Newton and Maxwell.
It's pretty funny that some people think I was claiming equal status with N and M in this quote!  You might go read the context if you are as intellectually honest as you say you are.  On the other hand, if you are as intellectually honest as I think you are, don't bother, and I'll just continue in my perception of you.

Sounds to me like everyone is very interested in hearing about my evidence for the Flood, young age of the earth, etc., so we will move quickly through the CS Lewis morality thing.  It's an important foundational one, though, because it is just one more evidence for a Creator.

Date: 2006/05/18 04:16:35, Link
Author: afdave
BWE said ... [quote] Also, I can run faster, jump higher and screw better than you can. [/quote]

Eric, Chris, Jeannot, Incorygible, Norm, Qetzal (others also)... I truly admire all of you for your knowledge of your field and your ability to express your thoughts matter-of-factly (even though I disagree with you).  (End serious comment, begin sarcasm) I also wanted to highlite some of the abilities of one of your team members.  These abilities may come in handy in a future debate.  Just kidding.  Don't worry.  I really don't lump you in with anyone else, and my judgment of your character has nothing to do with my judgment of anyone else's ... I just saw a chance for a joke.  I wouldn't want people lumping me in with certain other YECs.  As for BWE, I congratulate you.  I have been insulted a lot of different ways, some creative, some boring.  I have to say that this one takes the cake as the most innovative I have ever heard.  If you tell me your mailing address, I would like to send you a certificate for "Most Creative Insult of All Time."  I will be interested to see if you or anyone else can top this one in the future :-)

[quote]Also, I assume you don't believe that humans once had a tail although you think that the monkape kind either evolved one or lost one. [/quote]

If it was one original kind, then there would originally have been a tail and it would have been lost over time.  Creationism predicts the loss of function, not gain.  There may, however, have been a separate monkey kind and an ape kind.

 
Quote
Science itself is evolutionary and a thousand wrong ideas are tested before we hit on ideas that work. So, if there were an ID research program I wouldn't object. What I object to is the fact that they're faking having any  research program and instead spending millions on PR and lawyers and think tanks that  invent ways to lie and distort.
Science is not evolutionary because it is directed by intelligence.  I am glad that you would support an ID Research Program.  ID has to spend millions on PR to even get any research off the ground to see if there is support for this promising theory.  

     
Quote
You're an arrogant SOB, you know that, Dave?  From whence this audacity to dictate OUR roles in educating YOU in the absolute absence of any effort on your part?  See above.
Look, Incorygible.  I'm a businessman with a science/engineeering background and a financial contributor to causes, I'm politically involved, I'm an apologist for YEC, and I'm a little bit like an investigative reporter at the moment.  If you don't want to accept the role of "Evolution Apologist" and jump on the opportunity to make your theory look plausible to an outsider, then don't.  No one is making you.   The ape/human questions and the Creation/Evolution controversy are absolutely to vital to society.  I'm spending 4+ hours a day on this effort. You can't say I'm not putting in any effort.  Now, if you don't like your role, then you don't have to assume it.  On the other hand, if you want to stick around and not get mad, you might have some fun. Others have said they are having fun.  You can too.  By the way, I have encountered scientists who seem very resentful of businessmen in general because they feel that businessmen "use" them for their own purposes.  Do you feel this way?  The truth is that both businessmen and scientists are necessary.  Businessmen need scientists to invent and discover new things.  Scientists need businessmen to market their innovations.   And by the way, apologists and politicians are necessary too.  Your side has a famous apologist in Richard Dawkins.  Why shouldn't our side have some too?

     
Quote
It is a "huge undertaking" to understand volume upon volume, journal upon journal, paper upon paper of published, peer-reviewed science, Dave.  Takes decades of full-time devotion.  In light of that, your observation, your opinion of "burdens", and the roles you have set out are anything but "honest".
Again, scientists do much wonderful work.  Where they go wrong is when they write volume after volume of speculation about how the immune system might have evolved and similar things.  They would be much more productive if they hypothesized that it was designed and studied it from that perspective.

     
Quote
So you recognize the huge undertaking to become knowledgeable in this subject, but think you can have it for free.  I would have suspected you'd have come across the term "no free lunch" in your IDiot meanderings, Dave.  In this case, however, it actually applies.
I understand there is no free lunch.  I was born in poverty and have worked very hard to be where I am now.  No one asked you for a free lunch.  Some of you act as if I am asking you to give me a biology degree for free or something. Again, I am basically a YEC apologist and an investigative reporter asking for a convincing story.  If you don't want to give it, then you don't have to.  If I were in your shoes, though, I would want to try to give a convincing one.

     
Quote
No.  You are looking at one small region of the gene.  The deletion may have broken the gene.  It may not have.  Other mutations could have occurred before, and others since.  We've shown you the exact nature of the mutations that we see now.  We've pointed you in the direction of references where you can find out more.
 Exactly.  So Faid was making an assumption when he told me that the deletion in his article is the cause of broken GULO.

AF Dave said ...        
Quote
3)  You are assuming that this "deletion" is in fact a deletion.  The word deletion implies that it was there at one time in history and now is not due to a mutation.  I think you base your idea that it is a deletion by comparing it to rat GULO.  A tempting comparison and I do see your logic, but how is this conclusive?  An interesting experiment in this regard would be to delete the "C" in question in the rat GULO, then see if rat Vitamin C production ceases.  Has this been done?  Is it even possible?  How about inserting a "C" into some ape GULO, then seeing if Vitamin C production commences?  I did read the Rat/GP/Trout experiment and it is interesting, but does this prove that the "C deletion" is definitely the cause of non-functionality?


Incorygible said ...        
Quote
Yes, Dave, it's all been done.  We can easily knock out vitamin C production by breaking rat GULO in any way you desire.  No functioning gene -> no functioning protein -> no vitamin C synthesis.  This is basic.  Look at the medical literature.  That Ha et al. (2004) paper I referenced earlier is titled "Functional rescue of vitamin C synthesis deficiency in human cells using adenoviral-based expression of murine L-gulono-gamma-lactone oxidase" (Genomics 83:483-492).  They took murine (rat/mouse) GULO, spliced it into human liver cells via a virus (we do this all the time, Dave), and those cells began synthesizing Vitamin C.  I've already told you this.


Incorygible, that's not the same thing ... read my quote again.  I asked if anyone has knocked out the "C" in rat GULO at the position indicated in Faid's article which I quoted.  You responded by saying "Yes, we spliced rat GULO into a human and it worked."  Hello?  That wasn't what I asked.  It's not the same thing.

     
Quote
If someone wanted to tell you how wrong you are about how to fly planes, and they didn't even know basic things about lift, stalls, air pressure, and when you tried to explain the basics they just kept telling you how wrong you were, wouldn't you be a little intrigued?
Yes.  But I wouldn't get mad.  I'd just think it was funny.  The fact that people get mad about this stuff is interesting to me.  Why do they?  Oh, I know all the superficial reasons ... I'm thick headed, etc.  But it seems like there must be a more basic reason for the frustration.

     
Quote
And besides, if it's not your goal to present positive evidence about the Creationist view, why did you waste several hundred words on your "Creator God Hypothesis" (which, let the record show, you have not yet supported with any positive evidence)? If you weren't going to support it, why did you even bring it up, and waste our time waiting under the misapprehension that you were going to try to support it?
Absolutely.  On that thread, not this one.  This thread is all about "Ape Questions" and seeing what your answers are to those questions.  I have given excellent positive evidence on my other thread for the existence of God, and will over time give much evidence for all the things I said I would.  I know some don't accept my evidence so far, but I cannot help that. All I can do is give it.

     
Quote
Dave, you're simply not equipped to evaluate the evidence in favor of evolution. That's been pointed out to you innumerable times. No one here is under the slightest obligation to educate you on that evidence.
I agree with you.  I am not equipped.  This is why I am giving evolutionary biologists the chance to speak for themselves and explain why their theory is plausible.  If they cannot do this, who can?  I understand that no one is under any obligations here.  There are certain roles, though, and I can tell you that I am certainly not going to assume the role of 'Evolution Apologist.'  So that leaves the job to either you guys or else no one at all. I think people here rightly want to try to answer these questions as best they can because they truly believe in their theory.  And it is important to them for others to understand and agree with this theory.  We all want people to agree with out theories.

     
Quote
Explain to me why "downward evolution" is predicted by Creationism. How does this follow from the idea that God created everything? Is his creation so defective that everything eventually breaks down and collapses?
It is predicted in Genesis and is known as the "Curse."  Yes.  Everything in this world has been cursed because of sin, and God will RE-create the world at some point in the future.  Of course, I cannot prove this last piece to you scientifically, but I can show you that the Bible is both reliable and supernaturally originated.  Then it is but a small step of faith to believe the unverifiable stuff.

     
Quote
2) To talk about a "seamless fossil record" versus ubiquitous gaps is a demonstration of  your ignorance of what the fossil record is. Fossils happen rarely and not all fossils have been found. What you don't believe in here is  called a "transitional fossil."
OK.  Fair enough.  Let's use your term.  Evolution predicted many transitional fossils and now that the evidence is coming in, there have been only a handful of equivocal ones.

     
Quote
The convergence for this deletion may not be unlikely, but primates share dozen mutations. And these mistakes in the broken GULO produce the same phylogeny built with other working genes. This cannot have happened by chance. Would you drop this argument?
Why would I drop the argument if you agree with me that the deletion is not unlikely?

     
Quote
And what does "upward evolution mean"?
The evidence shows that there is no such thing, but Evolutionists wish there were.  To me it means addition of wings where there were no wings before, addition of eyes where there were no eyes before, etc.  The reverse happens a lot, however.  Organisms lose function quite often and Creationists predict that this will continue until the time that the Creator RE-creates all things.

     
Quote
Even so, bacteria have developed the ability to digest nylon. They didn't have that ability in the past. It's new. We can identify the pre-existing genes that were co-opted to achieve this. Isn't this "upward" evolution by your definition? Does it disprove Creationism?
I do know there are a few mutations that could be construed as "upward" or "increased or new function."  Do you know of many like this?  To disprove Creationism, it would take a multitude of  mutations like this.  And by multitude, I mean thousands or even millions.

     
Quote
Your "ubiquitous gaps" are gradually disappearing. Isn't that evidence against Creationism?
To say that the gaps are disappearing is sort of like saying that you are well on your way to emptying Lake Superior because you have removed 10 buckets full of water.

     
Quote
Let's simplify. Is there any conceivable objective observation (or combination thereof) that could disprove Creationism? If so, please explain.
Yes.  There are many possible ways to disprove Creationism, and evolutionists have been hoping for years that just such evidences would come to light as more is known.  They just haven't yet.  The opposite is actually happening.

     
Quote
But how much has the Bible changed to reflect more recent observation, Dave? Has it changed much in the last thousand years? Science gets better all the time. Religion stays the same, getting left further and further behind every year.
It hasn't changed, unless you are talking about the equivocal "Apocrypha."  Or maybe you are referring to modern Bible translations?  Translations are not changes.  The translators typically work from the original Greek and Hebrew to make their translations.  I don't know about religion.  I'm not a religionist.  I'm interested in truthful science of which the Bible and a God Hypothesis are a legitimate part.

Renier said ...        
Quote
Afdave is showing off his amazing faith. Since I feel that he just waisted our time, asking to be educated and then revealing he is just here to preach, I feel we need to test Dave on the claim that he is indeed a Christian and not just someone who is fooling us.  Chimps and Humans -- This is interesting. Now the fundies are REALLY going to fume.


Renier, my friend, you're back!  You were the one (I think) that gave me the idea to start this thread.  Wasn't it you that said you used to be a YEC, but abandoned the position because of the Vitamin C issue?  Well, as I hope you have seen, there are many assumptions here and I think you were too quick to abandon your position.  I read your new article about Chimps and Humans, but it does not look as interesting as the Vitamin C issue.

***************************************************************

So there you have it.  We're on page 16 of this thread, and there has been some very good discussion.  After all of this, of the two possible scenarios that I mentioned ...
     
Quote
Scenario 1-The GULO gene could have broken independently in apes and in humans. The Inai article shows that it did indeed break independently in guinea pigs, so why should it not break independently in apes and humans?       OR ..

Scenario 2-The "broken" GULO gene was never a functional GULO gene in either apes or humans.  It always has had some unknown function and still does to this day.  Argystokes called this possibility "pseudo-GLO" and rightly asserted that we should be able to find this gene's homologue throughout the animal kingdom--even in animals that do have a functional GULO gene.

it seems that Scenario 1 is the most likely, although who knows what will turn up as more is known about "pseudo-genes."

I have confirmed my suspicion that Dr. Max's assumptions are not necessarily warranted, although I would not go so far as to say they are wild assumptions.

It is clear to me that the theory that apes and humans had a common ancestor, while it has some apparent support, is by no means a closed case, and there is plenty of evidence supporting Common Design Theory as well.  I don't think we can 'prove' either one of them.  And if I were in Renier's shoes, I certainly would not have abandoned the YEC position because of this issue.

So, as you probably expected would happen, my position remains that Apes are Apes, and Humans are Humans, and as far as anyone really knows for sure, it's always been that way.

Thanks for your participation!  I have nothing further to add on this thread.  If anyone wants to keep going, by all means, go ahead.  But I have completed what I set out to do.

I will now spend all my time presenting evidence for a Creator God, a Young Earth, the Global Flood, the accuracy of the Bible, etc. etc. on my other thread.

Thanks again.

AF Dave.

Date: 2006/05/18 04:43:09, Link
Author: afdave
Quote
Translation: "Since everyone is asking for evidence, it's time for afdave to change the subject again."
Qetzal-- I have not changed the subject on this thread or any other thread.  I have stayed right on topic on other threads, and will continue on topic on this thread also. I have given you three good evidences for the veracity of the Bible's claims about God, namely that Someone  Somewhere is a Brilliant Designer and Engineer, that Someone Somewhere probably set the parameters in the cosmos just right for life to exist, and that Someone Somewhere likely caused the universe to have a beginning because it looks like it did indeed have a beginning.  And I have shown you the plausibility of the concept of some Being "living outside of time and space."  Now if that is not evidence to you, then I cannot help that.  It is what it is and it's excellent evidence to me.  To all the lurkers out there, I trust you will have sense enough to read all my posts on this thread and make your own judgment.

And now we will look at the "Phenomenon of Morality in the Universe."  Why does this provide evidence of a Creator?

Date: 2006/05/18 04:50:54, Link
Author: afdave
Quote
How is PR a requirement for starting research?
PR raises money for doing research.

Quote
afdave, please point me to the post in which I claimed that that particular C deletion was the cause for the loss of the gene's function.

Otherwise, please retract your claim and all assumptions derived from it.

You probably told me five times to go look at your link which supposedly proves Dr. Max's assertions.  I did so, as you asked me to.  What else am I to conclude from that article?

If you really don't believe what I thought you believe, fine.  I'll retract my statement.

Date: 2006/05/18 05:19:00, Link
Author: afdave
Quote
I thought you'd ignore what I posted, Dave, and plow ahead without addressing it. See, this is the thing about debate, Dave -- you're supposed to address counterarguments *before* plowing ahead. You're supposed to follow a basic protocol of give-and-take.
Your counter arguments have nothing to do with the evidence for a Creator God presented by me so far.  They are all about the Flood which comes later in my sequence.  If I run off down every rabbit trail out of sequence, it will do no one any good.  Your question will be answered in detail in the proper sequence.

Date: 2006/05/18 05:55:50, Link
Author: afdave
Quote
Dave, you BEGAN this thread with the premise of an inerrant Bible and God. Don't LIE. I am questioning your basic PREMISES for a reason -- because as I said, your entire house of cards rests on it. There is no "proper sequence" that can avoid this fundamental issue, since you MADE it a FUNDAMENTAL issue of your argument. Deal with what I asked, Dave. Be a man. Have some ethics.


AF Dave said ...  
Quote
UPDATED HYPOTHESIS
A. There is a God -- My hypothesis proposes that there is a Super Intelligent, Incredibly Powerful Being -- I choose to call him God -- who has knowledge of scientific laws far more advanced than anything ever discovered by 21st Century humans.  These scientific laws are so powerful that this Being can literally "speak" material things into existence and destroy things with a simple command.  This Being lives "outside of time" and can view what we call "the future" and "the past" with equal ease.


This is my first proposal on this thread.  Do you seeing anything about an "inerrant Bible"?  I don't.

As for my sequence, you can also find it on this thread on May 15, but I'll repeat it for you ...  
Quote
(1) Observe nature and draw inferences:  this only gets us so far, i.e. we conclude that there is an "ET" (or ET's) out there who is a Super-Intelligent Engineer, this ET might possibly live outside of space and time, and this "ET" might be the originator of this stange, universal "moral code" which we observe.  So we hold these thoughts and move through the rest of the process.

(2) If we accept (1), then we can make some predictions, one of which would be: "This 'ET' probably can communicate to humans."  How?  Dunno, but there certainly are a lot of competing claims out there -- many "prophets" and "holy books" claiming to be speaking for God or Allah or whoever. Could any one of them stand up to scrutiny?  So we compare some "holy books" and investigate the claims.  We focus in particular on the Christian Bible.  Why would we waste our time on this?  Well ... several good reasons.  We have reason to believe that the Christian Bible is unique among "religious books" for some pretty big reasons.  Former agnostic Josh McDowell gets into this in "Evidence that Demands a Verdict." I will explain some of these later, but it's enough to say for now that I have a convincing case for at least taking the time to honestly investigate the claims of the Bible.

(3) I begin investigating the Bible and I find many weird things.  But I know from experience that often times truth is stranger than fiction, so I keep investigating.  One by one, the supposed "difficulties" in the Bible keep falling as I learn more.  By the time I am done investigating the historicity of the Bible, its amazing predictions and fulfillments, the evidence in favor of Genesis 1-11 as actual history, its accurate description of the human condition, and other factors, there is not anything sensible to me to conclude except that some Unseen, Incredible Mind somewhere caused this book--the Bible--to be written.

(4) This is the end of the evidence that I can detect with my senses.  From this point forward, I have no choice but to make a "leap of faith" in some direction.  My choices are to A--do nothing B--reject the evidence I have just discovered or C--put 2 and 2 together and make what appears to me to be only a small "leap of faith" and conclude that the "Mind" that superintended the writing of the Bible is the same "Mind" that created the wonders of Nature.  Is this so unreasonable?

(5) Risk analysis.  Having walked through this entire process, I now am faced squarely with the claim from the Bible:  "Believe me and spend eternity with me when you die." (God supposedly speaking) or "Don't believe me and spend eternity separated from me.  It's your choice, Dave.  I won't force you.  I have given you abundant evidence for My existence.  If this evidence is not enough, what evidence WOULD be enough?"  I have to choose, and it basically boils down to risk analysis.  Which of the two possible choices seems less risky?

(6) And so I did choose.  I chose to believe the Bible based on what I considered to be overwhelming evidence in favor of believing it.  To me, it appears to be sheer folly to go against such evidence as I have seen.

(7) Now that I have made that choice, all I can tell you is that I am a changed man.  Ask my wife.  I know this is not scientific evidence.  That stopped after Point 3.  I can only tell you that I used to be interested in myself only.  I have not become perfect (I'm too cocky and too smart-alecky among other things), but there is now a new force for good within me which many times overcomes my selfish desires--the Bible tells me that this is the Spirit of God which apparently comes and somehow "dwells within" believers.  Now I genuinely care for others as well as myself and it really doesn't bother me much if people make fun of me.  I have a very single minded goal in life -- to be used by my Creator for His purposes during my brief stay here on this earth.


Notice that I do not claim Biblical innerrancy until after the hard work of slogging through the first 3 points in this sequence.

And I am out of time for today ... The C.S. Lewis Morality argument will have to wait until tomorrow!

Date: 2006/05/18 10:20:51, Link
Author: afdave
Aftershave said ...
Quote
I'll just note that the sum total of AFDave's scientific knowledge and integrity would comfortably fit inside a thimble, with plenty of room left for his genitalia.


BWE's was funnier. He's still in first place.  But keep trying.  You might pull off a good one yet.

Date: 2006/05/18 11:29:22, Link
Author: afdave
Quote
letting your personal and petty anger through

I was? Hello??  McFly?  

Toejam-- Could you use some of that straight talkin' of yours and tell Mrs. Rilke what planet we're on ...

Date: 2006/05/18 17:21:12, Link
Author: afdave
Well, well ... the old 'Prove Evolution to AFD' thread came back from the dead ...

Don't tell Wesley!  He thinks I have too many balls in the air already!

Yes.  I knew about the planet thing.  I actually speak quite a bit of Spanish and Portuguese (which of course is Spanish and French mixed).

I'm not sure which is the older tradition ... the planet thing or the 'God made the world in seven days' thing.  Nice item for study some time though.

I've pretty much got Google down pat ... sometimes I just like to hear what links you guys refer me to, but thanks for the tip!

Date: 2006/05/19 00:26:56, Link
Author: afdave
Quote
Uh, Dave?  If you knew how to google, you'd have found out that Portuguese is not Spanish and French mixed.   Quote  
Portuguese developed in the Western Iberian Peninsula from Latin brought there by Roman soldiers and colonists starting in the 3rd century BC. The language began to diverge from other Romance languages after the fall of the Western Roman Empire and the barbarian invasions in the 5th century, and started to be used in written documents around the 9th century. By the 15th century it had become a mature language with a rich literature. In all aspects — phonology, morphology, lexicon and syntax — Portuguese is essentially the result of an organic evolution of Vulgar Latin, with relatively minor influences from other languages.
from a source that even you can probably find.

Idiot.


Oh really?  How much money do you want to risk that I'm wrong?  Here's the specific statement that I am defending:

1)  AF Dave says that Spanish and Portuguese were essentially the same language until 1143 AD when Portugal broke away from Spanish control under a French nobleman by the name of Henry of Burgundy.  From this point on, the languages diverged into the modern situation.  The primary influence on the linguistic divergence was the French language.

2)  Rilke and Toejam say I am wrong

How much are you willing to bet?  

(You need a Paypal account to be eligible)

Date: 2006/05/19 03:28:58, Link
Author: afdave
MORALITY AS A CLUE TO THE MEANING OF THE UNIVERSE

Before we dive in, I'll answer one criticism and reproduce one quote that I especially enjoyed yesterday.

A common criticism around here ...    
Quote
Notice in your "evidence" that you use the words "likely", "probably", "looks like", and "plausibility".  These are not words used in evidence.  The are words used when making assumptions.  Quit lying and claiming that you have presented evidence....you havent.
This person claims that my 'evidence' is not evidence at all ... he says evidence would be something like bits of hair or blood from a murder scene.  Where you go wrong is this.  The bits of hair and blood from the murder scene do the very same thing for the truth search that my evidence does.  They make it "look like" so-and-so committed the murder and the judge really can only say that "probably" this man is guilty--he really cannot say for sure and there have been plenty of people that were erroneously prosecuted, or the reverse--they were guilty, but got let off.  Sorry ... your objection doesn't fly, but I'm sure people will keep raising it around here because you all apparently have been programmed to reject certain classes of legitimate evidence.  Hopefully you will see in time that this is a mistake.

   
Quote
Because the Bible is the source of his claims about God, I merely sought to question him on the truthitudosity of said mish-mosh before he launches into the rest of his monomaniacal diatribe.

Masterpiece of a sentence and a really cool new word!  Thanks!

For those of you in the running for most innovative insult, BWE is still in the lead by a long shot in my opinion, although I did get a good laugh at the submission by Seven Popes and at the 'none of your business' dialog between Carol and Rilke.  I'm still waiting on Aftershave to 'one-up' all of these.  I think he is hoping to claim the title.

******************************************

Well, now that I have regained my composure from laughing ...

Some people here sound frustrated because they want me to answer specific questions that they have such as when did the Flood occur, how do you know the earth is less than 10,000 years old, etc.  Another point of confusion is that some people think that Biblical inerrancy is somehow foundational to everything I believe.  So let me again clear some of this up for you.

First, my goal is to make a clear, logical defense of the theistic worldview.  This involves observation of the physical universe and the phenomena we find in it, observation of human behaviour and some common problems people have with the concept of an all-powerful, omniscient, loving God.

Second, once we establish evidence for the truth of the theistic worldview, we are then ready to make some predictions that we can investigate.  One of these key predictions is that this 'God' has probably communicated to humans in some way.  Makes sense, right?  If we have shown that there is a Super Intelligent Mind out there somewhere, it would be a safe bet that He knows how to communicate.  We find many claims of this prediction in the world in the many religious writings, claims of various 'prophets', etc.

So no one gets lost ... notice that we have only used the Bible in Step One as a source of one piece of our hypothesis.  We are not saying it is inerrant yet.  Are you with me?

Third, we survey the various 'holy books' and realize pretty quickly that there is one that stands head and shoulders above the rest in its unique characteristics.  That book is the Christian Bible.  We will present reasons why it is so unique, and we will commence a detailed investigation of some of its key claims.

Fourth, we will investigate the major claims of the Bible in detail but focus primarily on the major events in Genesis 1-11.  We will also touch on some points of Biblical history and see how these have been confirmed by archaeology, investigate some of the 'Messianic' prophecies, and discuss the failure of the Documentary Hypothesis.

Fifth, we will argue that because of the detailed investigation that has been made in this study and by many others throughout history, it is safe to conclude that the Bible is (1) accurate in its history, (2) uncanny in its predictions, and (3) dead on in its observation of human nature.  This will give us good reason to believe in its Supernatural origin and inerrancy in its original form.

So you see that I will cover all points in my Hypothesis, but not necessarily in the order the you would have chosen.  But after all, this is my hypothesis, so I guess its fair for me to arrange the flow, right?


*************************************************************


C.S. Lewis is known for his children's books, but he was also a very clear thinking apologist for the Christian faith.  He was agnostic for many years, but eventually became a Christian and was very prolific in his writings which were tailored specifically for non-believers.  One of his greatest non-fiction titles is Mere Christianity which not only is easy, entertaining reading, but also a clear picture of the essentials of the Christian faith stripped of all the often confusing man-made religious trappings that so often encumbers it.  I highly recommend this book to everyone ... it's easy reading guys and less than 200 pages.

Section One of Mere Christianity is called "Right and Wrong as a Clue to the Meaning of the Universe" ... an intriguing title to be sure.  Here's how he begins in Chapter 1: The Law of Human Nature ...
   
Quote
Every one has heard people quarrelling.  Sometimes it sounds funny and sometimes it sounds merely unpleasant; but however it sounds, I believe we can learn something very important from listening to the kind of things they say.  They say things like this: "How'd you like it if anyone did the same to you?" -- "That's my seat, I was there first" -- "Leave him alone, he isn't doing you any harm"-- [and so on.]  People say things like that every day, educated people as well as uneducated, and children as well as grownups.

Now what interests me about all these remarks is that the man who makes them is not merely saying that the other man's behaviour does not happen to please him.  He is appealing to some kind of standard of behaviour which he expects the other man to know about.  And the other man very seldom replies: "To he11 with your standard."  Nearly always he tries to make out that what he has been doing does not really go against the standard, or that if it does, there is some special excuse ... It looks, in fact, very much as if both parties had in mind some kind of Law or Rule of fair play or decent behaviour or morality or whatever you like to call it, about which they really agreed.  And they have.

Lewis goes on to call this the Law of Human Nature and he argues that this Law has been in operation throughout all of human history in every culture whether or not that culture had some sort of 'holy book' or not.  I will not give all his arguments ... you can read the book.  But suffice it to say that he ends the first chapter with two important points ...
   
Quote
These, then, are the two points I wanted to make.  First, that human beings, all over the earth, have this curious idea that they ought to behave in a certain way, and cannot really get rid of it.  Secondly, that they do not in fact behave in that way.  They know the Law of [Human] Nature; [and] they break it.  These two facts are the foundation of all clear thinking about ourselves and the universe we live in.

The second chapter is titled Some Objections and deals with things like "Isn't what you call the Moral Law simply our herd instinct and hasn't it been developed just like all our other instincts?"  Lewis dismantles this objection by noting that many times humans behave in a way contrary to our instincts, such as the man who dives into floodwaters to save a drowning man, or leaves a girl alone who he would like to have.  Another objection Lewis deals with is "Isn't what you call the Moral Law just a social convention, something that is put into us by education?"  Lewis counters that many things are mere conventions, such as driving on the right or the lefthand side of the road, but other things are real truths, such as the rules of mathematics.  He shows that the Law of Human Nature belongs to the 'mathematics class' of absolute truths because it is universal throughout all ages and applies to all people with only minor variation.

In the third chapter, The Reality of the Law, Lewis re-establishes his two main points ...

(1) Human beings, all over the earth, have this curious idea that they ought to behave in a certain way, and cannot really get rid of it.  
(2) Human beings do not in fact behave in that way.  

They know the Law of [Human] Nature; [and] they break it.

After some discussion of people's failed attempts to get rid of this Law, and some more discussion of how this Law differs from the Law of Gravity or other scientific laws, Lewis concludes ...
   
Quote
Consequently, this Rule of Right and Wrong, or Law of Human Nature, or whatever you call it, must somehow or other be a real thing--a thing that is really there, not made up by ourselves.  And yet it is not a fact in the ordinary sense, in the same way as our actual behaviour is a fact.  It begins to look as if we shall have to admit that there is more than one kind of reality; that, in this particular case, there is something above and beyond the ordinary facts of men's behaviour, and yet quite definitely real--a real law, which none of us made, but which we find pressing on us.


In Chapter 4, What Lies Behind the Law, Lewis points out that throughout history with all men everywhere, there have been basically two views of the universe--the Materialistic View which includes most of you, and what he calls the Religious view, which proposes some type of Intelligence which caused the phenomena in the universe.  Lewis says that ordinary science cannot tell us anything about a supposed 'Mind' outside the universe [you would agree with him and I would agree if we are talking about your definition of limited science ... I would say that the 'non-science' that Lewis is discussing here should be included in a broader definition of Science].  Lewis continues ...
   
Quote
Supposing science ever became so complete so that it knew every single thing in the whole universe.  Is it not plain that the questions, "Why is there a universe?"  "Why does it go on as it does?" "Has it any meaning?" would remain just as they were?

Now the position would be quite hopeless but for this.  There is one thing, and only one, in the whole universe which we know more about than we could learn from external observation.  That one thing is Man.  We do not merely observe men, we are men.  In this case we have, so to speak, inside information; we are in the know.  And because of that, we know that men find themselves under a moral law, which they did not make, and cannot quite forget even when they try, and which they know they ought to obey ... We want to know whether the universe simply happens to be what it is for no reason or whether there is a power behind it that makes it what it is.  Since that power, if it exists, would be not one of the observed facts but a reality which makes them, no mere observation of the facts can find it.  There is only one case in which we can know whether there is anything more, namely our own case.  And in that one case we find there is.  Or put it the other way around.  If there was a controlling power outside the universe, it could not show itself to us as one of the facts inside the universe--no more than the architect of a house could actually be a wall or a staircase or a fireplace in that house.  The only way in which we could expect it to show itself would be inside ourselves as an influence or a command trying to get us to behave in a certain way.  And that is just what we do find inside ourselves.  Surely this ought to arouse our suspicions?  In the only case where you can expect to find an answer, the answer turns out to be Yes; and in the other cases, where you do not get an answer, you see why you do not.


In Chapter 5: We Have Cause to Be Uneasy, Lewis points out that he has not got as far as the Christian God, or the God of any particular religion, and he says ...
   
Quote
We have only got as far as a Somebody or Something behind the Moral Law.  We are not taking anything from the Bible or from the Churches, we are trying to see what we can find out about this Somebody on our own steam ... and what we find out ... is something that gives us a shock.  We have two bits of evidence about the Somebody.  One is the universe He has made ... the other bit of evidence is that Moral Law which He has put into our minds.  And this is a better bit of evidence than the other, because it is inside information.  You find out more about God from the Moral Law than from the universe in general just as you find out more about a man by listening to his conversation than by looking at a house he has built.  Now from this second bit of evidence we conclude that the Being behind the universe is intensely interested in right conduct--in fair play, unselfishness, courage, good faith, honesty and truthfulness ... [but the Moral Law is not] indulgent, or soft, or sympatheitc ... It is hard as nails.  It tells you to do the straight thing and it does not seem to care how painful, or dangerous, or difficult it is to do.  If God is like the Moral Law, then He is not soft.  It is no use, at this stage, saying that what you mean by a "good" God is a God who can forgive.  You are going too quickly.  Only a person can forgive.  And we have not yet got as far as a personal God--only as far as a power, behind the Moral Law, and more like a mind than it is like anything else.  But it may still be very unlike a Person.  If it is a pure impersonal mind, there may be no sense in asking it to make allowances for you or let you off, just as there is no sense in asking the multiplication table to let you off when you do your sums wrong.  You are bound to get the wrong answer.  And it is no use either saying that if there is a God of that sort--an impersonal absolute goodnes--then you do not like Him and are not going to bother about Him.  For the trouble is that one part of you is on His side and really agrees with His disapproval of human greed and trickery and exploitation.  You may want Him to make an exception in your own case, to let you off this one time;  but you know at bottom that unless the power behind the world really and unalterably detests that sort of behaviour, then He cannot be good.  On the other hand, we know that if there does exist an absolute goodness it must hate most of what we do.  That is the terrible fix we are in.  If the universe is not governed by an absolute goodness, then all our efforts are in the long run hopeless.  But if it is, then we are making ourselves enemies to that goodness every day, and are not in the least likely to do any better tomorrow, and so our case is hopeless again.  We cannot do without it, and we cannot do with it.  God is the only comfort, He is also the supreme terror: the thing we most need and the thing we most want to hide from.  He is our only possible ally, and we have made ourselves His enemies.  Some people talk as if meeting the gaze of absolute goodness would be fun.  They need to think again.  They are still only playing with religion.  Goodness is either the great safety or the great danger--according to the way you react to it.  And we have reacted the wrong way.

Now my third point ... Christianity simply does not make sense until you have faced the sort of facts I have been describing.  Christianity tells people to repent and promises them forgiveness.  It therefore has nothing (as far as I know) to say to people who do not know they have anything to repent of and who do not feel that they need forgiveness.  It is after you have realised that there is a real Moral Law, and a Power behind the law, and that you have broken that law and put yourself wrong with that Power--it is after all this, and not a moment sooner, that Christianity begins to talk.  When you know you are sick, you will listen to the doctor.  When you have realized that our position is nearly desperate you will begin to understand what the Christians are talking about.  They offer an explanation of how we got into our present state of both hating goodness and loving it.  They offer an explanation of how God can be this impersonal mind at the back of the Moral Law and yet also a Person.  They tell you how the demands of this law, which you and I cannot meet, have been met on your behalf, how God Himself becomes a man to save man from the disapproval of God ... All I am doing is to ask people to face the facts--to understand the questions which Christianity claims to answer.  And they are very terrifying facts.  I wish it was possible to say something more agreeable.  But I must say what I think true.  Of course, I quite agree that the Christian religion is, in the long run, a thing of unspeakable comfort.  But it does not begin with comfort; it begins in the dismay I have been describing, and it is no use at all trying to go on to that comfort without first going throught the dismay.  In religion, as in war and everything else, comfort is the one thing you cannot get by looking for it.  If you look for truth, you may find comfort in the end: if you look for comfort you will not get either comfort or truth--only soft soap and wishful thinking to begin with and, in the end, despair.  Most of us have got over the pre-war wishful thinking about international politics.  It is time we did the same about religion.


Lewis obviously goes farther than is necessary to establish another piece of evidence for the existence of God, and I do to.  The last portion of this is for those who accept the existence of God, but have not yet considered the claims of Christianity.

For those of you that have joined us late, we are about 2/3 done with the "First" goal listed at the beginning of this point.  We have previously shown that Biological Machines and Cosmic Fine Tunig speak powerfully about some Super Intelligent Designer outside the universe.  Now, C.S. Lewis' Morality argument give us more clues as to the nature of this Designer.  Next we will deal with the Problem of Evil in the World and touch on Miracles.  This will complete the "First Goal" listed above and we will move to the Second.

I welcome your comments.

AF Dave

Date: 2006/05/19 03:37:23, Link
Author: afdave
Rilke--

You keep saying I'm wrong, but you haven't put your money where your mouth is.  Just tell me how much money it's going to be ...

$500 says I can prove my statement (my later, more specific statement).  Are you willing to put up $500 and prove me wrong?

You know the wager ... it's as clear as a bell ...

Now are you going to back up your claim?  Or are you going to retract it and apologize?  Or shall I embarrass you publicly in front of all your friends?

Your choice, sweetie.

Date: 2006/05/19 04:04:02, Link
Author: afdave
Incorygible said ...  
Quote
Again, Dave, why do you think you know where scientists go wrong?  You've admitted you're not on their level in their respective fields.
I admit that I am not on their level, but there is a relatively small but rapidly growing group of scientists who are disillusioned with Darwinism ... Michael Denton, Michael Behe, Dr. John Baumgardner of Los Alamos to name just a few.  When top notch people like this stand up and say there's a problem, I at least investigate.  Now why is that so unreasonable?

Quote
After all, the current crop of scientists aren't doing anything worthwhile, and you seem to know how to correct that, given your science/engineering/religious background.  Why not cure cancer with your "design perspective"? As a politically active businessman who wishes to contribute to humanity and help the YEC cause, would there be anything better?
I have never said the current crop of scientists aren't doing anything worthwhile ... nothing of the sort.  I have consistently said they are doing many great things and I reap the benefits.  But their thinking on origins is highly questionable and the answer to this question has major implications on society.  And I agree that trying to cure cancer from a "design perspective" would be a very worthy goal.

Quote
I got interested in this whole affair (I used to not care, just do what I did and let other people believe whatever they wanted) when a YEC (in similar shoes to yours?) sent me a scary fire-and-brimstone e-mail because may name appeared on a university website for teaching a course in evolution.  
I know that some people who wear the YEC label do irresponsible things like this ... I am sorry for that, but I cannot stop them.  I can only do what I do and I for one do not say that you are 'evil' or that you should even quit teaching your views on evolution.  Go ahead and teach them.  Just don't shut out other views.  Honesty would dictate that your view is just that--a view.  The origin of life is not a thing you can 'prove.'  So just admit that and let others express their views as well.  That's all.

Quote
Faid has already responded to this and where the misunderstanding lies.  And even if he hadn't, I am sorry that I assumed you were asking a question that had some actual over-arching relevance to the discussion.  I assumed you had learned enough by now to realize that "the missing C" was not the deletion we have been talking about (not even close). But yes, I assumed to much, with the proverbial consequences -- you just wanted to go down yet another rabit hole leading to a meaningless detail and pedagogical semantics.
I was not intentionally leading you down a rabbit hole.  I was trying to summarize your collective position, then point out my view that it is inconclusive to me.

Quote
And I think you (of all people), might be a little offended by being accused of being in league with the devil and on a fast-track to ####.
Again, please don't get mad at me for the actions of others, and I will treat you with the same respect.

Quote
I don't care what they "believe", either.  Affirmation and consensus with the norm is not a high priority for me.  Did I not mention I'm in science?  We THRIVE on DISagreement, Dave.
OK.  Then you should be thriving.

Quote
"The convergence for this deletion may not be unlikely, but primates share dozen mutations. And these mistakes in the broken GULO produce the same phylogeny built with other working genes. This cannot have happened by chance. Would you drop this argument?"
Why would I drop the argument if you agree with me that the deletion is not unlikely?

Honestly, do you even read, Dave?  This reply, with the actual quote right above it, proves beyond a shadow of a doubt that you are illiterate, dumb as a brick, and/or disingenuous.
She says the convergence may not be unlikely.  She says that primates share dozen mutations.  And these mistakes in the broken GULO produce the same phylogeny built with other working genes. This cannot have happened by chance.  

I don't understand the second sentence, but why is it so unusual to share "dozen mutations"?  Guinea pigs and humans share a lot of mutations too, right?

Date: 2006/05/19 04:40:08, Link
Author: afdave
Rilke--

Here's my statement again ...  
Quote
AF Dave says that Spanish and Portuguese were essentially the same language until 1143 AD when Portugal broke away from Spanish control under a French nobleman by the name of Henry of Burgundy.  From this point on, the languages diverged into the modern situation.  The primary influence on the linguistic divergence was the French language.


In short, Portuguese is a mixture of Spanish and French, which is what I said at first.

Are you going to challenge me or not?

Date: 2006/05/19 04:49:23, Link
Author: afdave
Quote
you claim that the "hair and blood allow us to suppose that a murder has occured" IS THE EVIDENCE.
Rilke, Rilke ... you put that in quotes as if that's what I said.  Go read it again.  You are confused and yet you say I'm confused.

Combine this blunder with your nonsense about me not knowing the origin of the Portuguese language on the Evolution thread and I'm going to rank you right up there with Aftershave and BWE.

You don't want that do you?  Retract it all and I will still respect you.

Date: 2006/05/19 05:14:15, Link
Author: afdave
Quote
You do know that you are desicively swaying those of us on the fence away from your brand of creationism?
You are on the fence?  Excellent!  There's hope!

Date: 2006/05/19 08:44:36, Link
Author: afdave
Quote
Portugal traces its national origin to 24 June 1128 with the Battle of São Mamede. Afonso proclaimed himself first Prince of Portugal and in 1139 the first King of Portugal. By 1143, with the assistance of a representant of the Holy See at the conference of Zamora, Portugal was formally recognized as independent, with the prince recognized as Dux Portucalensis. In 1179, Afonso I was declared, by the Pope, as king. After the Battle of São Mamede, the first capital of Portugal was Guimarães, from which the first king ruled. Later, when Portugal was already officially independent, he ruled from Coimbra.


Rilke--  Check to see who Afonso's father was.  You'll find in was Henry of Burgundy, a French nobleman who helped fight the Muslims.

Now, since everybody is whining on your behalf, I'll lower the wager.  You tell me what you are willing to risk to prove you superiority and my idiocy.

I wouldn't hold your feet to the fire, Rilke, but you were pretty rash and blatant and bold.  I'll give you a hint ... Sometimes you get what you pay for on Wikipedia.

If you want to keep being a jerk, I'm going to shine a bigger and bigger spotlight on you ... otherwise, I'll drop it and we'll move on.

Date: 2006/05/19 08:59:20, Link
Author: afdave
Rilke-- You are foaming at the mouth because you are afraid of my wager which you know you will lose on the "Evolution" thread ... go check an encyclopedia that you have to pay for (instead of Wikipedia).

Rilke went into a tirade and called me an idiot on the "Evolution" thread because I said Portuguese was a mixture of Spanish and French.  I challenged her to a wager that I'm right and now she realizes she's in a hole.

Maybe someone would loan her the money?

Date: 2006/05/20 12:32:00, Link
Author: afdave
Well, well, well ... It was good I went to the lake yesterday and didn't get to do any posting yet because I see a lot more people climbed onto Rilke's branch that I'm about to saw off ...

And I see Rilke is not willing to back up her outrageous claims of intellectual superiority with any money at all.

I do see that Steve has come up with his own little wager of $1000.

Let me deal with Steve's little deal first.  I won't bet you on that because you are correct that Henry was dead long before 1143.  I composed my sentence ambiguously ... it should have read "Spanish and Portuguese were essentially the same language until 1143 AD when Portugal broke away from Spanish control.  The break away was begun by a French nobleman by the name of Henry of Burgundy" --  little more specific.

Again, what we are doing here, though is answering a claim by Rilke that I am an idiot for thinking Portuguese is a mix of Spanish and French.  There will be several lessons learned here.  One will be that I have met many people like Rilke on these threads who are very arrogant about their supposed intellectual superiority and at the same time are quite vehement about attacking the supposed lack of intelligence they see in YECs like me.

OK ... brace yourselves ... the branch is coming down ... everybody got your body padding on?

This from Rilke's source of choice (Wikipedia) ... I guess she just didn't read far enough ...

 
Quote
Although the vocabularies of Spanish and Portuguese are quite similar, phonetically Portuguese is somewhat closer to Catalan or to French. It is often claimed that the complex phonology of Portuguese compared to Spanish explains why it is generally not intelligible to Spanish speakers despite the strong lexical similarity between the two languages.Portuguese and French


Of course if you get a good Medieval History Encyclopedia, you can get all kinds of details about this period in history when Portuguese and Spanish diverged.  What you will see is massive Burgundian influence beginning with the influx of thousands of Burgundian knights in response to Alfonso VI who had a Burgundian wife, then the Burgundian Henry, grandson of Robert I of Burgundy then to Afonso Henriques, son of Henry.  [Oh ... by the way ... I guess I'd better fill you in that Burgundy is in France ... small detail].  Anyway, Afonso Henriques captures Lisbon and sets up his capital.  Then if you do some further reading, you find out that standard Portuguese is based on the dialect of Lisbon, according to Rilke's other favorite source, Encyclopedia Brittanica.  Can you guess that Lisbon probably had greater French influence than anywhere else in Portugal?  I hope I'm not moving too fast for anyone.

Hmmm ... let's think now ... a whole bunch of French knights come into western Spain to help out the king who has a French wife.  Another French guy comes into Spain and marries a Spanish wife.  They take over Lisbon and set up the Kingdom of Portugal.  Do you see what's happening?  This is not rocket science folks.   This is kind of like 1+2=3.  See?  Spanish + French = Portuguese.

Now if you have all three of these languages in your own family (my mother speaks fluent Portuguese and Spanish and my cousin speaks fluent French), you tend to have a little better overview of these languages than the average Joe (or Rilke).  I can tell you that if you have heard all three languages like I have, the mix is quite obvious.

And if you think and are honest (I'm finding this to be a slightly scarce combo here), instead of just shoot your mouth off about how all YECs are stupid idiots, you can see how Wikipedia would make a statement like ...

phonetically Portuguese is somewhat closer to Catalan or to French. (by the way, Catalan the language of Andorra -- just below France on the map)

RRRRRRR ... CREEEEK ... (noise of branch breaking) ... (whistling sound as branch accelerates toward ground) ... (screams of terror) ... WUMP! (branch loaded with arrogant evolutionists hits ground)

OK.  So now you have a choice.  You can get up, brush yourself off, wipe the egg off your face and go back to trying to make reasonable arguments in favor of evolution, which is what I would recommend if you want to help the "Evolution Cause"

OR ...

You can somehow try to weasel out of the fact that you've been had.  

Either choice you make, I'm going to take this thread back to it's intended content and expand it a bit.  I will pretty much abandon the Ape Thread now as it has served its purpose.  I have successfully shown that there is nothing more than flimsy evidence which could be construed as positive support for Common Descent of Apes and Humans, although there is excellent evidence for common ancestry within the Apes as well as within all the other originally created kinds.

(And while you are all at church tomorrow, you can confess all your arrogance and unkind words)

(Oh ... don't forget to thank Rilke for leading you into this mess!;)

(Rilke--you probably knew about this little detail in Wikipedia, but just withheld it, right?  Very honest of you)

(Oh ... BTW ... Faid-- you and some others have put words into my mouth about the 7 day week thing and I see you think I'm mistaken about that too ... would you like to pursue this further?  Maybe take a softer approach so that you don't fall so hard?)

Have a nice evening!

Date: 2006/05/20 13:02:41, Link
Author: afdave
Rilke ---

(and everyone else who followed her)

You might want to go check the "AF Dave Wants You to Prove Evolution" thread ...

You just crashed and burned about your Portuguese thing.

It was nice knowing you :-)

Date: 2006/05/20 13:13:09, Link
Author: afdave
I have not had time to analyze Incorygible's latest response, but I will and then get back to you.

In the mean time, there is a good lesson on my "Prove Evolution to AF Dave" thread on the Bible's admonition that "Pride goeth before a fall."

It was nice knowing you Rilke ...

Date: 2006/05/20 13:49:33, Link
Author: afdave
Quote
So when you said the guy was living in 1143, and it turns out he'd been dead 31 years, you were being 'ambiguous'? Lemme help you with some definitions


That's not what I said, Steve.  Lemme help you with some reading comprehension ...

I made an ambiguous statement, the detail of which that you are highliting doesn't matter a whit for my argument, and you know it.  But go ahead and dodge the bullet if you want to.  I've come to expect this kind of thing ...

Let's how creative other people can be in dodging the bullet.  Toejam's weighed in ... others?

Date: 2006/05/20 14:23:33, Link
Author: afdave
Quote
... and you think it's "arrogant" to think otherwise?
I didn't say it's arrogant to think otherwise.

I said it's arrogant to call people idiots when you don't know what you are talking about, which is what Rilke did.

You might want to review her litany ...

Date: 2006/05/20 15:43:58, Link
Author: afdave
Quote
But you have a nice time in church tomorrow regaling your fellow fundies with tales of how you showed those infidels!

I don't think you or anyone else is an 'infidel.'

I'm sure you're all good people.

I just disagree with you over Origins ... that's all.

Date: 2006/05/20 16:12:09, Link
Author: afdave
Steve Story said ...
Quote
Not ambiguous. Wrong.


**gasp**  can't let this Creo have a victory  **sigh**

**oooohh my head** gotta find somethin' he screwed up

( @#$%&*@%$#  I think I broke my leg when he cut off that branch $%#&^*%$# )

** ooooh *** lemme see if I can split some hairs and nail him on something .... anything!!!!!!  ****eeeeoooh***

(Somebody help me!!!;)

Hey BWE ... thanks for offering to pay up when you lost a bet ...  no need to really pay up though

Oh ... and you can call me an idiot anytime you want to because at least you're funny while you do it ...

Hey Toejam ... I remember something about you promising to become a Creo if you saw me win an argument on an unrelated topic ...

Come on, baby ... pay up!

Date: 2006/05/20 16:19:16, Link
Author: afdave
Quote
What color is the sky on your planet?

Norm, my friend ... it's no use ... don't make it worse for your team than it already is ...

Just go call 911 and get an ambulance and they'll come and fix you and Rilke and everybody else ...

Then you will be all nice and recovered for battle on Monday morning.

Date: 2006/05/20 16:28:35, Link
Author: afdave
Quote
Please tell us you were lying about having kids?
Got 5 already ... planning on 5 more ... I'm telling you ... we're taking over the Planet ...







(just kidding about the 5 more)

Date: 2006/05/21 00:14:12, Link
Author: afdave
Eric ... don't make yourself look ridiculous like Rilke did ... you're one of the guys here whose intellect I respect ...

shake it off, my friend ...

It's not that bad ... you just lost a stupid little side argument that doesn't even matter in the big scheme of things ...

Date: 2006/05/21 00:40:32, Link
Author: afdave
Alright, I have some questions on Evolution ...

(since this is supposed to be an "Evolution" thread)

You guys say there is no such thing as "upward evolution," right?  And I think I've heard someone say that the bacteria are winning.

So presumably, a million years from now, there might be only bacteria ... no mammals, right?

My question is ... why didn't the bacteria win before mammals appeared?  Weren't they evolving just as rapidly early in earth history as they are now?

Date: 2006/05/21 01:27:46, Link
Author: afdave
Eric said ...  
Quote
Dave, I really think you need to read, and understand (that means read it slowly and carefully and make sure you understand each paragraph before you go onto the next one) Douglas Theobald's superb article at Talk Origins setting forth the mountain of evidence supporting common descent with modification. If you honestly read and understand that one article, you will understand that common descent with modification is not an hypothesis in need of evidence; it's a fact in need of explanation.

Eric ... you seem to misunderstand the Creationist position (it's OK, sometimes I misunderstand your position as well) ... I actually have no problem at all with "Common Descent with Modification" and I have said so here several times.  You are correct that there are mountains of evidence that there was just one original "Ape kind" and one original "Dog kind" and one original "Cat kind" and one original "Human kind" and so on.  And it is quite true that all the hundreds of variations within these kinds we see today are the result of Common Descent with Modification--modification meaning random mutation and controlled random mixing during reproduction.  No argument there at all.  I understand Natural Selection quite well (and artificial selection too) and agree that it is a proven fact.  It is also a Creationist prediction.  Where we differ is in the evolutionist idea that everything shares one common ancestor, with my most interest in this regard being on the Ape/Human question.  We also disagree that random mutation and natural selection can produce anything like an eye where there was no eye before, or a flagellum, or what have you.  No one has been successful in showing how new features like this could have evolved by random mutation.  In almost all cases, random mutation makes things worse or neutral.  And in the few cases that they make things "better", it's not because a flagellum was added or an eye was added.  The changes are extremely minor changes.  This is because the information content required to make something as complex as a flagellum is so large (greater than 500 bits), that chance is ruled out.  And nothing simpler can be formed as a precursor, because it only would get selected for if it is complete and working.

AFD said ...  
Quote
She says the convergence may not be unlikely.  She says that primates share dozen mutations.  And these mistakes in the broken GULO produce the same phylogeny built with other working genes. This cannot have happened by chance.  

I don't understand the second sentence, but why is it so unusual to share "dozen mutations"?  Guinea pigs and humans share a lot of mutations too, right?

Oops ... sorry, Incorygyble (or Jeannot) ... I meant to say THIRD sentence, not second.  

What is Jeannot referring to when she says "And these mistakes in the broken GULO produce the same phylogeny built with other working genes. This cannot have happened by chance." ??  Is she switching back to apes and humans, or is she still talking about humans vs. guinea pigs?

Date: 2006/05/21 01:59:21, Link
Author: afdave
Arden said ...
Quote
Another point: the only way Portuguese could be a mixture of Spanish and French would be if French had the opportunity to influence Portuguese in a big way.


Uh ... er ... a big influence, huh ... like maybe thousands of French knights coming over to help Alfonso VI, maybe?  Did you even read my post?  Here's the part you might have missed ...
Quote
Of course if you get a good Medieval History Encyclopedia, you can get all kinds of details about this period in history when Portuguese and Spanish diverged.  What you will see is massive Burgundian influence beginning with the influx of thousands of Burgundian knights in response to Alfonso VI who had a Burgundian wife, then the Burgundian Henry, grandson of Robert I of Burgundy then to Afonso Henriques, son of Henry.  [Oh ... by the way ... I guess I'd better fill you in that Burgundy is in France ... small detail].  Anyway, Afonso Henriques captures Lisbon and sets up his capital.  Then if you do some further reading, you find out that standard Portuguese is based on the dialect of Lisbon, according to Rilke's other favorite source, Encyclopedia Brittanica.  Can you guess that Lisbon probably had greater French influence than anywhere else in Portugal?  I hope I'm not moving too fast for anyone.

Hmmm ... let's think now ... a whole bunch of French knights come into western Spain to help out the king who has a French wife.  Another French guy comes into Spain and marries a Spanish wife.  They take over Lisbon and set up the Kingdom of Portugal.  Do you see what's happening?  This is not rocket science folks.   This is kind of like 1+2=3.  See?  Spanish + French = Portuguese.

Now if you have all three of these languages in your own family (my mother speaks fluent Portuguese and Spanish and my cousin speaks fluent French), you tend to have a little better overview of these languages than the average Joe (or Rilke).  I can tell you that if you have heard all three languages like I have, the mix is quite obvious.


It doesn't take a PhD in linguistics to see this, Arden.  

If you want to argue something new, go start a new thread on Martin Luther, or the Catholic church, or Hitler or something else fun.

Date: 2006/05/21 02:09:52, Link
Author: afdave
Well, I see that not everyone agrees with C.S. Lewis ... what a surprise!  I'm not going to spend any time trying to defend Lewis.  He goes into a lot of the objections raised here in the book, so go buy it and read it if you are interested.  I found his argument to be a compelling piece of evidence supporting the Creator God idea.

I see that many people still don't get it that the evidence I have presented so far is, in fact good evidence.  I would simply note that if a person does not want to believe something, the best thing to do is to call your ideological opponent an idiot, say his evidence is NOT evidence, etc.  Oh well ... it's not like I expected anyone to agree with me anyway.

*****************************************

New question (we'll be brief on this one):  Does everyone remember my argument which explains Evil in the World?  You know the analogy between parents and kids.  I would be interested in your comments on that ... do you think my argument is sound?  If not, why not ...

If necessary, I'll restate the argument when I have more time ...

Date: 2006/05/21 03:35:19, Link
Author: afdave
I'll go ahead and post this small piece again to remind everyone of the "Evil in the World" argument ...

The creation of mankind with a choice necessarily requires the possibility to evil, which by definition is "opposition to the will of the Creator."  What other definition makes sense?  What fun would it be for parents to have "robot children"?  It's a lot more fulfilling for parents to have kids that have a free will.  There is risk, to be sure.  Think about Jeffrey Dahmer's mom, but every day parents all over the world deem it worth the risk.  Why?  Because of the greater good which may result.  Their child maygrow up to be the next Louis Pasteur or Mother Teresa.  Why is this any different to visualize with God?  To me, it makes perfect sense that God would feel exactly the same way.  Does he want an earth full of zombie robots?  Of course not.  He wants people that have the ability to hate His guts, but make the conscious decision to love Him ... just like human parents do also.  And you can't escape this argument by saying "Well, it's different with God because supposedly He's all-powerful and all-knowing.  Why doesn't He intervene and just stop all this rot?  Well, He does sometimes--like with the Flood--and He will again at the End of Time.  This also is just like human parents.  They intervene sometimes in the lives of their children and they choose NOT to intervene sometimes because they want the child to learn some lesson.  What is so strange about this when it comes to thinking about God?

Everyone agree with this logic?  

Can we move on to Eric's age of the earth and Flood questions now?

(What links, Faid?)

Date: 2006/05/22 00:42:29, Link
Author: afdave
Quote
Doesn't it puzzle you in the slightest that everybody here keeps asking you to provide evidence for your position, when I'm sure it seems obvious to you that you already have?


Uh ... no, it doesn't puzzle me.  I did enough reading about the mindset of evolutionists before coming here that I was well prepared for what I would encounter.

Quote
We also disagree that random mutation and natural selection can produce anything like an eye where there was no eye before, or a flagellum, or what have you.  No one has been successful in showing how new features like this could have evolved by random mutation.

Dave, it's been shown dozens of times. In many cases we know exactly which mutations in exactly which locations resulted in exactly which changes.

Yes, of course ... you're talking about those wonderful 'Alice in Wonderland' descriptions of how the immune system evolved and such.  Have you ever read those?  If you did, you would see they are complete and total speculation of the highest order.

Quote
The changes are extremely minor changes.  This is because the information content required to make something as complex as a flagellum is so large (greater than 500 bits), that chance is ruled out.  And nothing simpler can be formed as a precursor, because it only would get selected for if it is complete and working.

Dave, if you'd even the most cursory reading anywhere other than at AiG, you'd see that this argument (irreducible complexity) has been completely blown out of the water.
Yes, I've read all those articles that 'blow the arguments out of the water' at T.O.  They are quite lame.  

The most credible sounding one I've read yet is Dr. Max's article which is being discussed on this thread, but as it turns out, after much debating all around the mulberry bush, we are finally back to the following statement by Jeannot which proves my point and destroys Dr. Max's argument completely.  I'm going to put this in lights so that no one will miss it.

******************************************************************

Jeannot said ...
Quote
For the last time, you can't consider the loss of function alone as a valid evidence for common descent, because hundreds of mutations can break a gene.
</b>

******************************************************************

One more time for emphasis ...

[b]For the last time, you can't consider the loss of function alone as a valid evidence for common descent, because hundreds of mutations can break a gene.


Remember, this whole thing started because Renier said ... "I used to be a YEC, but the broken Vitamin C gene in primates caused me to abandon the YEC position."

OK.  What did Dr. Max say?  He said that an error in the GULO gene was copied from  the common ancestor of apes and humans to both humans and apes.  He compared this to a copyright case and said that this basically proves common descent of apes and humans.

Now Jeannot just said that "you can't consider the loss of function alone as a valid evidence for common descent, because hundreds of mutations can break a gene," telling me that neither Dr. Max nor anyone else knows which mutation broke the gene in humans or which mutation broke the gene in apes.  Dr. Max was saying that his argument was that the 'error was identical,' but his argument was really just that 'apes and humans both have broken GULO.'  OK.  So they both have broken GULO.  Big deal.  It could have broken independently, just as it did in guinea pigs.  What does this have to do with Dr. Max's copyright case?  Absolutely nothing.  And you cannot consider the loss of function alone as a valid evidence for common descent anyway, according to Jeannot.

So we see that whereas Faid complains all the time about AIG lying, the truth of the matter is that it is Talk Origins that is lying.  You guys have been taken in by many slick arguments ...

I have a cure for you ... www.dissentfromdarwin.org ... hundreds of good scientists are jumping ship ... you can too!

Date: 2006/05/22 01:34:55, Link
Author: afdave
Quote
Step by step, in good argument format, please support this statement of yours. [that T.O. is lying]
I will be quite happy to do so the moment that Faid and others give me their step by step argument that AIG is lying, because they made their assertion first.  On the other hand, if they feel this is too much trouble, if they will retract their statement, I will also retract mine.

In any case, I have a feeling that you will continue to use T.O. despite what I say about it, and I feel sure I will keep using AIG despite what you say ... so what does it really matter?

Quote
Man, how many times have we explained this?
You've explained the 'apes and humans are similar' argument many times, and I have also many times argued that 'apes and humans are similar' argues just as easily for Common Design as it does for Common Descent.  'Apes and Humans are similar' is all well and good, but it is not deterministic between the two views.

Renier, if you stick with me long enough, I will be systematically dismantling all the basic underpinnings of evolution and establishing the credibility of the YEC position.  

I have dismantled Dr. Max's argument, and I will continue to dismantle many more.

Young Earth Creationism is the only view which not only is consistent with all the evidence from many disciplines, but also the only view which answers mankind's biggest questions in life.

My hope for you and for all the good people here is that you will come to a knowledge of the truth ... and that it will transform your life as it has mine.

Date: 2006/05/22 03:32:41, Link
Author: afdave
Shirley Knott said ...  
Quote
What logic?  A string of ruminations does not constitute logic, nor a logical argument.
Evil is not generally defined as "opposition to the will of the Creator".
Amongst other problems, and they are legion, you are assuming your conclusion.  Were this logic that would disqualify your 'argument' right there.
You have yet to show that the notion of 'Creator' as you use it is meaningful and possible.
You have yet to reconcile omniscience and omnipotence.
Similarly you have yet to reconcile omnipotence and omnibenevolence in the face of evil [in the normal sense of the term] which has nothing to do with human action or will.
You misreprsent the standard objection to your claims -- it is not the case that the argument from evil is "why doens't an all powerful and all knowing beingf stop this?", it is "how can a being described as all-knowing and all-powerful permit this in the first place".

I do understand the claim ... I know it is that "how can a being described as all-knowing and all-powerful permit this in the first place"?  And the answer is "the same way parents can permit their children to experience evil."  Obviously parents are not all-powerful, but the analogy works because parents do indeed have the power to keep their children from evil.  How?  By not having them, or by going to Radio Shack and buying robot "children" instead of having natural children with CHOICE.  God also had the power to keep us from experiencing evil, but chose not to because of the greater good that would result in the big scheme of things.  He could have either not created us, or created us like little robots.  That would be no fun though, just as it would be no fun for human parents.  Omniscience and omnipotence are separate issues.  We obviously cannot comprehend this type of thing because we have never experienced it.  Why is this a proof that it is a wrong idea?  To say it is wrong as you do would be equivalent to a jungle native who had never seen an airplane fly saying that "airplanes are impossible."  Both are denials based upon ignorance.  Truly open minded people say, "there are things I do not understand, but let me try to understand as much as I can, and I will not rule out any possibilities until I have solid evidence to do so."  The notion of an Intelligent Designer is the only plausible explanation for the phenomena we find in the universe.  I (with Paley) have given intuitive arguments.  Bill Dembski is all about giving those intuitive arguments rigorous mathematical proofs, based on our recently acquired knowledge that life is essentially INFORMATION which assembles raw materials.  While neo-Darwinism has been excellent in explaining the variation we see within specified boundaries, it is bankrupt in explaining where the information came from in the first place, and how the information was added to organisms  to add new gross morphological features.  The answer is Intelligent Design and this in turn supports Theism quite nicely.  And Theism has no difficulties explaining the 'omnipotence and omnibenevolence problem' as I have shown.


Norm said ...  
Quote
So, if God's will is that the worshippers of the golden calf must be killed by melting down their calf and making them drink it, that's not evil because it's God's will?  If God's will is that Muslim hijackers crash planes into our skyscrapers, that's not evil because it's God's will?  So, if you get  ebola and die a  horrible death, that's obviously God's will since no man decided you should get that disease? The problem with assuming you have to do God's will is figuring out what God's will is.
You are correct that figuring out God's will is a very big deal and should not be taken lightly.  We also have the question of "Why is it OK for states to execute a convicted murderer?" and the like.  And the answer to all these questions really boils down to an authority question.  And this in turn boils down to the question of "Is there a Creator?  Or is there not?"  Which is precisely why I am so interested in these questions.  Here's the deal.  IF there is a Creator, then it follows that HE gets to make the rules, not us.  IF He says "Go destroy all the Amalekites" and He was the one that created the Amalekites, then how can we say, "No, that's wrong?"  Now of course, you do have the problem of determining if it was really the Creator who created the Amalekites who is now saying go destroy them.  Maybe the Jewish prophet is just a religious scheister and he's just pretending to speak for the Creator.  And this should not be determined lightly.  And it was not.  God went to great lengths to make checks and balances with the Jewish people to make certain that the prophets were validated before they were trusted to give guidance on weighty matters such as destroying entire people groups.  Contrast this with the modern claims of Jihadists.  They have no authority from anywhere that has been rigorously validated by anyone.  

Now regarding the obvious question of "How can God ordering the killing of people groups be considered good" the fact is that IF there is a Creator God, then there are things that we do not know or understand, and how can we say that God is not good if he orders the killing of certain people groups.  In the big scheme of things, maybe He knows that He is doing the world a favor by killing them off.  Killing people is a good thing under certain conditions and if done with the proper authority -- i.e. with government sanction in today's world (God has given life and death authority to governments--see Romans 13).  Did it not do the Americans good to kill off those British soldiers?  Look at all the good that has come to America as a result of killing those Brits and founding an independent nation.  Ditto for Hitler and the Nazis (yes, I know ... Godwin ... OK fine).  As for getting ebola and dying a horrible death, this too can be good if you are looking at it from God's perspective.  Remember, this life is only a small portion of our total life.  Humans will live forever somewhere and this short life within a physical body is nothing in the big scheme of things.

 
Quote
How about a more humanist definition of "good" and "evil"? What is good is what promotes human happiness and co-operation. What is evil is that which disrupts human happiness and co-operation.
What do you mean by that?  How would you apply that if you were Roosevelt and Churchill in WW2?  I would really be interested to hear how your definition would play out in the hard decisions.

 
Quote
So, God must feel the same way about things that you do? Could it  be that you have made God in your own image?
It's logically possible, yes, but you cannot escape the empirical evidence for a real Creator God, so no, when all things are considered it makes more sense to believe that WE were created in His image, rather than vice versa.

 
Quote
So, AFDave's 'evidence' that god intervenes on earth is (a) an event that didn't happen and (b) a mythical event that he thinks will happen in the future.
There is more evidence for the Global Flood of Noah than there is that George Washington lived.  As for the future event which I cannot verify, I believe in this after I have established the authority of the Bible as a whole from a rigorous examination of the claims I can verify.

 
Quote
He then drew parallels between parenting, and god's handling of mankind. Does it follow, by extention, that parents should then subject those children who defy their will to unending, inescapable pain and torment? Where is the line drawn in this "in his image" concept? I found his explanation of "Evil in the World" to be kind of creepy.
 Actually parents in a way do subject their kids to inescapable pain and torment by not always intervening.  Parents all the time choose not to intervene in the lives of kids who make bad life decisions.  These kids end up in pain and torment all their lives because of their own decisions, not because the parents consigned them to this pain.  Why should God be any different?  He offers eternal life to anyone, but He does not force himself on anyone.  If people want to choose to reject Him, it is they who are choosing their destiny, not Him.

 
Quote
yes, what a surprise that everyone here doesn't see the author of fictional children's novels as authoritative in the world of science.
Do you all not realize that the children's novels are allegories of Lewis' Christian faith?  He is primarily a Christian philosopher.  His brilliance is shown in his children's novels because he not only writes exciting kid stuff, but also weaves in essentials of the Christian faith in a hidden sort of way.

Date: 2006/05/22 04:28:49, Link
Author: afdave
Rilke--  You crashed and burned, and even your friends cannot defend you on this one.  What better expert do you need than your friend, Arden Chatfield who has a PhD in linguistics?  Here is what he said ...
Quote
Another point: the only way Portuguese could be a mixture of Spanish and French would be if French had the opportunity to influence Portuguese in a big way.


And I responded with ...
Quote

Uh ... er ... a big influence, huh ... like maybe thousands of French knights coming over to help Alfonso VI, maybe?  Did you even read my post?  Here's the part you might have missed ...

Of course if you get a good Medieval History Encyclopedia, you can get all kinds of details about this period in history when Portuguese and Spanish diverged.  What you will see is massive Burgundian influence beginning with the influx of thousands of Burgundian knights in response to Alfonso VI who had a Burgundian wife, then the Burgundian Henry, grandson of Robert I of Burgundy then to Afonso Henriques, son of Henry.  [Oh ... by the way ... I guess I'd better fill you in that Burgundy is in France ... small detail].  Anyway, Afonso Henriques captures Lisbon and sets up his capital.  Then if you do some further reading, you find out that standard Portuguese is based on the dialect of Lisbon, according to Rilke's other favorite source, Encyclopedia Brittanica.  Can you guess that Lisbon probably had greater French influence than anywhere else in Portugal?  I hope I'm not moving too fast for anyone.

Hmmm ... let's think now ... a whole bunch of French knights come into western Spain to help out the king who has a French wife.  Another French guy comes into Spain and marries a Spanish wife.  They take over Lisbon and set up the Kingdom of Portugal.  Do you see what's happening?  This is not rocket science folks.   This is kind of like 1+2=3.  See?  Spanish + French = Portuguese.

Now if you have all three of these languages in your own family (my mother speaks fluent Portuguese and Spanish and my cousin speaks fluent French), you tend to have a little better overview of these languages than the average Joe (or Rilke).  I can tell you that if you have heard all three languages like I have, the mix is quite obvious.


It doesn't take a PhD in linguistics to see this, Arden.  

If you want to argue something new, go start a new thread on Martin Luther, or the Catholic church, or Hitler or something else fun.


So Rilke ... Arden (the Linguistics PhD) says "Another point: the only way Portuguese could be a mixture of Spanish and French would be if French had the opportunity to influence Portuguese in a big way.

And the "opportunity to influence Portuguese in a big way" is so obvious from history that only a liar would miss it.

Face it, Rilke, you called me an idiot for a statement I made and now you look so ridiculous that even your friends are changing the subject.

But keep on flailing if you want to.  I'm going back to more productive arguments.

It's OK.  It's not like I disproved the ToE or something.  This was only a stupid little side issue anyway.

Date: 2006/05/22 04:55:48, Link
Author: afdave
Quote
Gee, Dave, you ignored MY response to you, and now you're somehow claiming MY words proved YOUR argument?


Your response was irrelevant.  And yes, YOUR words showed the validity of my argument.

Thanks for the help!

(Oh, and if you think Christians are not tough in their speech sometimes, go read the New Testament and see how tough Jesus spoke to the Pharisees. This is a common misconception that Christians are somehow supposed to be Casper Milktoast or something.  Or how about the founders of this country? ... you want talk about some tough talking Christians!;)

Date: 2006/05/22 05:24:20, Link
Author: afdave
Quote
And, I predict, for the (n+1)th time, he will not get around to giving us that "easy" explanation.

OK, Russell, for the (n+1)th time ... 95% similarity between apes and humans supports common design in the same way as it does in house building or car building, for example.  A Ford Aerostar is 95% (?) similiar to a Ford Fiesta (do they still make those?) and this is because they have a common designer.  You see?  Again, this is not rocket science and does not require a PhD (or even a biology degree).

Quote
Serious question Dave,
Did you actually retire from the Air Force or did you resign your commission sooner than that?
Went on reserve status when I got out in 1996, then resigned my commission this year.

Quote
"This is a revolution dammit, we're going to have to offend somebody!"-John Adams

A great example of a great Christian "tough guy" !!

*****************************************

You guys just can't get used to the fact that you lost the Portuguese thing, can you ...

Quote
I haven't read Dr Max's argument but if you think you have refuted the claim that the GULO gene does not support common descent you are sadly mistaken.
You haven't even read the article and yet you disagree with me when I say I have refuted it?

Whoa!   ... well, I was warned about this kind of stuff ...

Quote
why it's not which mutation broke the gene, but the remarkable simillarities in the accumulated mutations in the broken part between humans and primates that matter-
You guys cannot get your story straight.  You say it's the similarities in the broken part, Jeannot says "you can't consider the loss of function alone as a valid evidence for common descent, because hundreds of mutations can break a gene."

Come on guys. Face it.  Apes and humans have some striking similarities, I agree.  Apes and humans both have what appears to be a broken GULO gene.  So what?  This does not prove Common Descent.

Quote
I'll give you this: I'll say that this guy is either a liar, or a total ignoramus in genetics and, at the same time, an arrogant jerk who thinks he can argue about something he knows absolutely nothing about by simply pulling "arguments" out of his ####. Take your pick.
 Great.  And I'll back off my "liar" claim for the T.O folks.  I will content myself to think they are just ignorant.

Date: 2006/05/22 06:04:02, Link
Author: afdave
Quote
I think it's gotten to the point where Dave now thinks that if he admits a mistake on ANYTHING that his Christian arguments are all threatened.
Oh really?  How do you explain my very forthright and honest concession that I was wrong about the AIG-chimp-chromosome thing?

Arden, precisely the REVERSE of what you say is true.  

YOU are the one that will never admit defeat no matter how looney you look.

Date: 2006/05/22 06:20:03, Link
Author: afdave
Quote
All by itself, a broken GULO gene does not prove much of anything -- but it is one line of evidence.


Thank you, Norm.  Would you please explain this to your friends and to Dr. Max?  They don't seem to get this simple point.

As for kinds, we will be getting into them shortly.

Quote
Ah, I missed that. Sorry. And I'm glad you admitted it.

So, now, in an attempt to prove to us that you're not 'looney', are you now willing to admit you were wrong on your linguistic statements, the founding fathers all being Christians, a Young Earth, Noah's flood, and scientists all 'jumping ship' on evolution? 'Cause none of those things are true, either...


No.  I won the Portuguese thing thanks to Rilke's Wikipedia article, my Medieval Encyclopedia and your own admission.  You can go argue that one against me with Rilke until you are blue in the face if you want.  But you'll be talking to the wind.

As for the rest, you'll have to earn victory, point by point.  If you win a point, I will concede.  I hope you will be so honorable as well.

Date: 2006/05/22 08:35:56, Link
Author: afdave
Quote
DDDDDDDDDAAAAAAAAAAAVVVVVVVEEEEEEEEE!!!!!!!!

AAAAAAARRRRRRREEEEEE
YYYYYOOOOOUUUU
TTTTTTAAAAAAKIKKKIIIINNNNGG
MMMMMYYYYYYY
BBBBEEEEEEETTTTTT
???

When do we start?
NNNNNNNNNNNNOOOOOOOOOOO!  I won already ... now be a gentleman and go help Rilke crawl out from under that big branch I sawed off.  I think she hit her head when she fell because she's hallucinating now.

Quote
Surely, davy, surely after pages and pages of discussion on this, you're not going to pretend that Max's only evidence is "a broken GULO gene".
I'm sure he has many more reasons why he thinks he is related to chimps, but the item of discussion on this thread most recently is THIS piece of evidence.  And let me say again ... I agree, it's a piece of evidence.  But it argues equally well for both Common Descent and Common Design.  Remember the Aerostar and the Fiesta?

Quote
But just for the record, it's not just one or two "holdouts" - so far as I can tell no one here other than you thinks you "won" that little dust-up.
most of them probably do agree with me, but they wouldn't dare admit it and betray "the team."

Quote
For you to be correct I would have had to have said "I haven't read Dr Max's argument but if you think you have refuted his argument/article you are sadly mistaken." whereas I actually said "I haven't read Dr Max's argument but if you think you have refuted the claim that the GULO gene does not support common descent you are sadly mistaken." Do you see the subtle but important difference.
Now that you point it out, yes.  I'll concede there was a subtle (very subtle) difference in the two statements.

Tom Ames ...  
Quote
The GULO pseudogene is evidence for the common ancestry and recent divergence of humans and the other great apes. It is not "proof of" same, and not considered as such by careful scientists.

You're engaging in an intellectually dishonest rhetorical tactic that Phil Johnson likes to use. He specializes in nibbling at the margins of specific pieces of evidence (never looking at the totality) and then pretending that he's "disproven" something. Or when it turns out that the evidence is correct, he diminishes its importance by pointing out that it's only one piece of evidence.

Pointing out that the GULO story does not by itself "prove" the ancestry of humans is a red herring: no-one claims that it is sufficient evidence. And you can get any biologist to "concede" this. But so what? It strongly supports a particular hypothesis. And thousands of other observations do too.


Thank you Tom, for agreeing with me in your first paragraph.  As for your second paragraph, if you will read this whole thread, I have looked at the totality of the Ape/Human ancestor question on two separate occasions.  To review briefly, the problems are (1) Lack of 'Hominid Civilizations' existing today, (2) Completely unconvincing fossil record, and (3) Major non-physical differences between apes and humans.  I am not engaging in intellectual dishonesty.  I focused heavily on the GULO issue because several people kept throwing it in my face in several different threads.  I simply took the challenge ...

And won!

Now let's see how intellectually honest all of you are ...

Date: 2006/05/22 09:58:22, Link
Author: afdave
Quote
Dave, I totally annihilated that claim of yours. There were other tool using primates, and our first human ancestors didn't live much differently than they did.


Did you ever read those posts?[/quote] Of course I read your post.  I always read your posts.  You, Chris, Jeannot, Tom, Incorygible and several others say very coherent things and you don't get into the goofy name calling which just makes people look vacuous.  I can tell also that you are very sincere in what you believe.  I respect what you have to say even though I disagree with your conclusions.

I know you responded to my claim of 'no hominid civilizations' but I don't agree that some bones and cave writing is evidence for this.  My contention is that if apes and humans have a common ancestor, there should be lots of 'beetle brow civilizations' all over the earth with half ape-men who grunt a lot and have a simple language and are at some stage between chimps and humans.  These 'people' should be living today if evolution were true.

(Rilke-- I'm glad to see you believe in Jesus now ... maybe you could tell BWE about Him)

Date: 2006/05/22 10:29:28, Link
Author: afdave
Quote
... and we like when people help us when we're ignorant about something.
Yes. So you should be very happy right now since I've helped you so much :-)

Date: 2006/05/23 03:02:00, Link
Author: afdave
Quote
Dave, are errors in broken genes part of a design?
No.  According to YEC theory, organisms were designed perfectly in the beginning.  The Creator then put a curse on all of nature to remind humans of sin and the need for a Saviour, and to remind us that this world is not our true home.  God will at a future time RE-create the heavens and the earth and they will once again be perfect.  Humans who choose to believe God will be with Him eternally in the newly created heavens and earth.  Those who do not will be eternally separated from Him.  Mutations are assumed by creationists to be a part of this "curse."

Drew Headley ...  
Quote
I will come out and say you have not convinced me at all. In fact, all the books I have read on the topic say that the only significant French influence on Portuguese came much later than the years you gave.
Drew, my friend, World Book and Brittanica and Wiki are not going to have enough detail to show you the enormous French influence on a tiny country such as Portugal during the 12th century.  Go to your local public library and look up Portugal in a Medieval Encyclopedia.  There you will find the "thousands of French knights" coming in, the intermarriage with French nobility, the conquest of Lisbon, and the subsequent adoption of the dialect of Lisbon as Standard Portuguese.  Now, if all that is unconvincing to you, then I can't help you.  I've accomplished my goal of refuting Rilke and that's good enough for me.  Maybe you and Arden and Rilke and Faid can start a whole thread to in effect prove me wrong when I say the sky is blue. I hope it's an enjoyable enterprise for you.

Quote
Why should evolution lead to there being multiple hominid societies today? If they were out-competed by homo sapiens early on why do they need to be here today? This seems to have been what happened to the neanderthals.
Not only should there be multiple hominid 'societies' in existence today, there should be many, many living 'transitional' species.  The fact that there is not throws all of 'macro-evolutionary theory' (as Theobald calls it) into huge doubt.

BWE ...  
Quote
-In the Portuguese/French thing: I could have let it go. I understand why you said what you said and I could coherently argue your case to some extent.
Thanks.  Would you tell this to Drew Headley?

Russell ...  
Quote
Ah, the old "the lurkers support me in e-mail" gambit. Pretty sad. Heck. Why not just be done with it, and claim that Max privately agrees with you?
Careful reading, Russell.  You got two things wrong.  I din't say lurkers and I wasn't talking about Dr. Max.  I was talking about the participants on these threads and I was talking about the Portuguese thing.  If you go look at that discussion, you see an embarrassing "changing of the subject" by many participants.  Even Steve Story didn't have the guts to challenge my statement after I shot Rilke down.  He chose rather to jump on a silly little side statement I made which had nothing to do with the main discussion.  It's funny how you guys admonish me to admit when I am wrong, which I do, but you guys never do, even though this one was so obvious its hilarious.

There was a good lesson in the little Portuguese dialog.  Namely, that some people are so committed to being right that they will dismiss mountains of evidence that is literally hitting them in the face.  I wonder what other areas there might be where people here are doing this same thing?  The whole origins question, maybe?  Michael Denton calls it "The Priority of the Paradigm."  Hmmmm .....

Jstockwell ...  
Quote
Now, as a solitary exercise, this isn't rock solid.  As explained, you make an assumption of parsimony, and the vagaries of chance could always throw that off.

But the key is that you then compare the phylogeny generated from analysing this stretch of DNA, to a completely independent stretch elsewhere.  And what we've found is that they are almost identical.  The vitamin C gene is just one example, and the sequence I posted above is another.  It's pretty hard to argue against that.

Common design does not explain nested hierarchical relationships, unless you hypothesize that the designer did his design work by making modifications to a prototype, keeping that, using it as the next prototype, making successive modifications, etc.

At that point your hypothesis is indistinguishable from common descent, except for the intervention of the designer at every step.  Is that your hypothesis?

And lastly, I've been following the linguistic argument, and I've noticed that you haven't given any linguistic evidence for your position.  Your 2 pieces of evidence are historical and anecdotal.  Those aren't very compelling.
I agree with you that they are very close, probably somewhere around 95% close.  But remember ... Dr. Max was arguing in his article that the broken GULO is sort of the "case maker" which favors common descent over common design.  He says ...  
Quote
Can "errors" in modern species be used as evidence of "copying" from ancient ancestors? In fact, the answer to this question appears to be "yes," since recent molecular genetics investigations have uncovered some examples of the same "errors" present in the genetic material of humans and apes.
He then goes into the GULO 'error' and other pseudogenes.  Apparently, people at this forum place heaviest weight on the GULO pseudogene judging from the numerous admonitions I received to investigate this particular one.

Where we are now is that you all are admitting that the GULO pseudogene is NOT in fact a "case maker" for common descent.  This is quite different than the impression I was given about this issue when we started.  You all are simply saying that it is one of many "pieces of evidence" which I agree with, but I would simply say "this gene is similar" and "all the genetic material is similar."

But the silly thing is that I already knew this before we started this exercise.  We did not need to go slogging through all the intricacies of the GULO gene to prove to me that Humans are genetically similar to Apes. I agree and this is perfectly consistent with Design Theory.  As I have said many time, the similarities between a Ford Aerostar and a Ford Fiesta point to common design, not common descent.

As for nested hierarchical relationships, my view is that Common Design explains them better that Common Descent.  As Denton has pointed out, the really striking fact about nested hierarchies is the separateness and non-sequential relationships of living things.  I'm sure you are already aware of Colin Patterson's statements such as  
Quote
In a way, I think we are merely rediscovering pre-evolutionary systematics: or if not rediscovering it, fleshing it out.
and  
Quote
that much of today's explanation of nature, in terms of neo-Darwinism, or the synthetic theory, may be empty rhetoric.
because you have all read Denton, right?

You also need to read Ashby Camp's response to Theobald regarding the 29+ Evidences for Macroevolution.  <a href=""http://www.trueorigin.org/theobald1b.asp" target="_blank">Link to article</a> He says  
Quote
It is not a corollary of the hypothesis of common descent that organisms will have features by which they can be classified as groups within groups.  Common descent can explain or accommodate nested hierarchy (though not without difficulty in the specific case of Neo-Darwinism), but it does not predict it.  There are mechanisms of descent from a common ancestor that would yield a different pattern.  If common descent can yield either nested hierarchy or something else, then the presence of nested hierarchy does not count as evidence of common descent.
and points out what Biophysicist Cornelius G. Hunter had to say ...  
Quote
It has been known since Aristotle that species tend to cluster in a hierarchical pattern, and in the eighteenth century Linnaeus saw it as a reflection of the Creator’s divine plan.  Obviously this pattern does not force one to embrace evolution.  Also, Darwin’s law of natural selection does not predict this pattern.  He had to devise a special explanation—his principle of divergence—to fit this striking pattern into his overall theory.  To be sure, evolution can accommodate this hierarchical pattern, but the pattern is not necessarily implied by evolution.  (Hunter, 108.)


My position is the same as Camp's when he says ...
Quote
It may be that the nested hierarchy of living things simply is a reflection of divine orderliness.  It also may be, as Walter ReMine suggests, that nested hierarchy is an integral part of a message woven by the Creator into the patterns of biology.  (See, e.g., ReMine, 367-368, 465-467.)  The point is that the hierarchical nature of life can be accommodated by creation theory as readily as by evolution.  Accordingly, “[i]t is not evidence for or against either theory.” (Brand, 155.)


Once again, it is clear to me that Apes are Apes and Humans are Humans, and as far as anyone really knows, that's the way it's always been.

Common Design explains nested hierarchies better than Common Descent and this is not to mention the innumerable difficulties that Common Descent theory encounters everywhere one looks.

I will now be abandoning this thread since I have established my point.  Please bring any further discussion of this issue over to the "Creator God Hypothesis" thread.

Thanks,

AFD

Date: 2006/05/23 05:55:05, Link
Author: afdave
Hello Everyone--

Today we will begin focusing exclusively on this thread.  This has been my intent all along, but there were some interesting side issues that needed separate treatment.

I would like to say thanks to all of you for your input on my "Creator God Hypothesis" so far.  I have updated it and re-posted it on my own personal blog site.  It may undergo some more revisions as we move along here, so check over there periodically for the latest version.  My blog is <a href="airdave.blogspot.com" target="_blank">here</a>.

Many of you have given me some interesting dialog.  What has been the most interesting experience to me so far is the solidity of the case for a theistic worldview.  I truly expected to hear some rock solid arguments against theism, but what I found were mostly vacuous arguments, such as "your evidence is not evidence" and "it looks designed but it isn't" and "well, we may have cosmic fine tuning for this universe, but what about other possible ones?" etc. etc.  Also, I have found that many evolutionary biologists really don't have much to say about theism at all--I guess they have never given it much thought--and so they often just resort to name calling and goofy remarks.

I did get some pretty good dialog on the Ape/Human questions and we did turn up an error that AIG had made.  This dialog was also valuable to me because it confirmed for me the huge differences that exist between apes and humans and showed me that while there are some obvious similarities, there is no solid case for common ancestry.

We will now continue presenting the points of the Creator God Hypothesis and  showing the fallacies of macroevolutionary theory along the way.  Referring to my outline on my blog site, we are beginning Step 2 and Point B.  

Again, Step 1 and 2 are as follows ...
Quote
(1) Observe nature and draw inferences: In particular, we observe Biological Machines, Cosmic Fine Tuning, the Laws of Relativity and the Universal Moral Code. This only gets us so far, i.e. we conclude that there is a Super-Intelligent Engineer, who possibly lives outside of space and time, and who might be the originator of this stange, universal "moral code" which we observe. So we hold these thoughts and move through the rest of the process.

(2) If we accept (1), then we can make some predictions, one of which would be: "This Intelligent Designer probably can communicate to humans." How? We don't know, but there certainly are a lot of competing claims out there -- many "prophets" and "holy books" claiming to be speaking for God or Allah or whoever. Could any one of them stand up to scrutiny? So we compare some "holy books" and investigate the claims. We focus in particular on the Christian Bible. Why would we waste our time on this? Well ... several good reasons. We have reason to believe that the Christian Bible is unique among "religious books" for some pretty big reasons. Former agnostic Josh McDowell gets into this in "Evidence that Demands a Verdict."


And Points A and B of my Hypothesis are ...
Quote
A. There is a God -- My hypothesis proposes that there is a Super Intelligent, Incredibly Powerful Being -- I choose to call him God -- who has knowledge of scientific laws far more advanced than anything ever discovered by 21st Century humans. These scientific laws are so powerful that this Being can literally "speak" material things into existence and destroy things with a simple command. This Being lives "outside of time" and can view what we call "the future" and "the past" with equal ease.

B. This God created the Cosmos as a specially designed whole, with life and mankind as its fundamental goal and purpose. This God created mankind with a choice of either doing his will or not doing his will, in a similar way as parents "create" babies knowing full well that their child will either do their will or not do their will. Christian Theologians commonly call the choice of NOT doing God's will "sin."


We will not get into the details of the comparison of 'religious books' discussed in Step 2 above in this particular study.  There are numerous books on this topic and I trust that you all can get those and read them for yourselves.  It should be obvious that the Christian Bible is unique among books--I have found that most of you are quite familiar with it--and we are justified in spending the time to consider some of its claims, which I think you all are wanting me to do anyway, judging from the numerous questions about the Flood, the Age of the Earth, Cain's wife, etc.

We do need to cover off Point B of my Hypothesis so our next topic will be "The Anthropic Principle" in which we will look at some objections to Michael Denton's claims in his book, "Nature's Destiny."   We have already covered the issue of Choice and how this necessitates the concept of 'Evil.'  This will complete our discussion of Point B in my Hypothesis.

Following this, we will begin looking at specific claims of the Bible, with the first being the Age of the Earth.  We will follow this with a lengthy discussion of evidence for the Global Flood of Noah, followed by other Biblical claims such as the Changing of the Languages, and a discussion of Biblical 'kinds.'  We will also examine the Documentary Hypothesis and discuss the 'Tablet Theory' of Genesis authorship and discuss the origin of the 7 day week (Yes, Faid, I know you think you answered this already, but you don't know my arguments yet).  Our goal is to provide solid evidence for the truth of Genesis 1-11.  

I may have more time to dive into this later today, but if not, see you in the morning!  Again ... hop on over to my blog site and review my outline so you are well prepared to refute me!

(If anyone wants to try to 'prove' Evolution to me or talk more about Apes and Humans, please do so here as I will be focusing on this thread only now)

Date: 2006/05/23 07:08:38, Link
Author: afdave
Rilke-- I'm past Portuguese now ... got anything to defend Evolution?  Maybe some new great discovery that will finally make the lightbulb come on for me?

Date: 2006/05/23 08:40:30, Link
Author: afdave
THE ANTHROPIC PRINCIPLE
I predict that Michael Denton will probably go down in history as one of the most influential scientists of the 20th Century.  Henry Morris may actually claim the leading title for his leadership of the modern Creationist revival, but there is no doubt that men like Michael Denton, Michael Behe and William Dembski will be names long remembered once the rotting corpse of Darwin's General Theory of Evolution is buried and forgotten.

And so we take one more look at one of my favorite books, "Nature's Destiny" by Michael Denton and discuss briefly, the Anthropic Principle.  From the fly-leaf of the book ...

Quote
In Nature's Destiny, Michael Denton marshals a stunning range of biological, chemical, and physical evidence to answer systematically a simple question:  Could life elsewhere in the universe be significantly different from life on earth?  Must it rely on carbon, water, DNA, amino acids, and proteins?  COuld there be an alternative to DNA, or could DNA be constructed out of different components?  Could cells be designed differently?  From these building blocks he dares to ask the boldest questions:  Is it possible there are life forms radically different from those realized during the course of evolution on Earth?  And even:  Is a Homo sapiens--like creature the only possible highly intelligent species, given the laws of biology that exist throughout the universe?

The stunning answer to this last question is yes.  Life is highly constrained by the laws of nature.  If, for example, the ratio between strong and weak chemical bonds had not been what it is, if the thermal properties of water were not precisely what they are, if the atmosphere of the Earth had not had just the right properties to filter out harmful radiation, then a flourishing biosphere such as exists on Earth would be impossible.  For like to develop beyond the most primitive stage hinted at by the famous Mars fossils requires an earthlike planet, with earthlike atmosphere and oceans.

Over the past twenty years, such physicists as Freeman Dyson, Fred Hoyle, Martin Rees and Paul Davies have argued that the universe is fine-tuned for carbon-based life.  Now, Michael Denton extends their argument all the way from the carbon atom to advanced and complex life forms closely resembling ourselves, showing that our biosphere is central to nature's destiny.  Though we may have six-fingered cousins elsewhere, the laws of nature are tuned to reach an endpoint in mankind.


Denton goes on to make an excellent case for his claims and concludes with this ...

Quote
All the evidence available in the biological sciences supports the core proposition of traditional natural theology--that the cosmos is a specially designed whole with life and mankind as its fundamental goal and purpose, a whole in which all facets of reality, from the size of galaxies to the thermal capacity of water, have their meaning and explanation in this central fact ... As I hope the evidence presented in this book has shown, science, which has been for centuries the great ally of atheism and skepticism, has become at last, in these final days of the second millenium, what Newton and many of its early advocates had so fervently wished--the "defender of the anthropocentric faith.


Now for some objections from our good friends at Talk Origins ...

Quote

The claim assumes life in its present form is a given; it applies not to life but to life only as we know it. The same outcome results if life is fine-tuned to the cosmos.
Yes.  Life in its present form IS a given.  (This author is bright!;)  No.  You cannot fine tune life, then build a cosmos.  Sorry, doesn't work that way.  You know ... gotta do site prep then build the foundation before you build the house.  See? (Wow, these are convincing rebuttals, guys.  I can see why you got taken in!;)

Quote
We do not know what fundamental conditions would rule out any possibility of any life. For all we know, there might be intelligent beings in another universe arguing that if fundamental constants were only slightly different, then the absence of free quarks and the extreme weakness of gravity would make life impossible.
Oh yeah, sure.  The old "alternate universe" theory.  I know of an alternate universe in Alice and Wonderland.

Quote
Indeed, many examples of fine-tuning are evidence that life is fine-tuned to the cosmos, not vice versa. This is exactly what evolution proposes.
This author couldn't think of a new rebuttal, so he re-used the second half of the first one.


Quote
If the universe is fine-tuned for life, why is life such an extremely rare part of it?
 Good question.  Worth investigating.  But that doesn't argue against the fact that it is indeed fine tuned for life.  Try reading the Bible for clues to WHY it is here and no place else.


Quote
Many fine-tuning claims are based on numbers being the "same order of magnitude," but this phrase gets stretched beyond its original meaning to buttress design arguments; sometimes numbers more than one-thousandfold different are called the same order of magnitude (Klee 2002).
Gimme a break.  Elsewhere on the Talk Origins site, the authors had ample opportunity to refute Cosmic Fine Tuning and they did not.  Why not?  Because they could not.  You can see this Here.

Quote
How fine is "fine" anyway? That question can only be answered by a human judgment call, which reduces or removes objective value from the anthropic principle argument.
 No, it is very objective.  Sorry.  It's very well defined.  Read Dyson, Hoyle, Rees, Davies and Denton.


Quote
The fine-tuning claim is weakened by the fact that some physical constants are dependent on others, so the anthropic principle may rest on only a very few initial conditions that are really fundamental (Kane et al. 2000). It is further weakened by the fact that different initial conditions sometimes lead to essentially the same outcomes, as with the initial mass of stars and their formation of heavy metals (Nakamura et al. 1997), or that the tuning may not be very fine, as with the resonance window for helium fusion within the sun (Livio et al. 1989). For all we know, a universe substantially different from ours may be improbable or even impossible.
 Maybe so, but are you telling me that this weakening is a big deal when you are talking about some 70 different parameters that have to be right for life to exist?  Come on.


Quote
If part of the universe were not suitable for life, we would not be here to think about it. There is nothing to rule out the possibility of multiple universes, most of which would be unsuitable for life. We happen to find ourselves in one where life is conveniently possible because we cannot very well be anywhere else.
Oh boy.  The brain damage is bad.  Call the neuro-surgeon!  Wow.  That is a brilliant statement: "If part of the universe were not suitable for life, we would not be here to think about it."  I think there's an echo.  Isn't that what we've been saying?  I thought I just got through saying  this very thing ... "If part of the universe were not suitable for life, we would not be here to think about it."  How exactly is this a rebuttal of my argument?  Oh, and of course the multiple universe thing again, which Faid told me had been dropped, but here it is again.

Quote
Intelligent design is not a logical conclusion of fine tuning. Fine tuning says nothing about motives or methods, which is how design is defined. (The scarcity of life and multi-billion-year delay in it appearing argue against life being a motive.) Fine-tuning, if it exists, may result from other causes, as yet unknown, or for no reason at all (Drange 2000).
Well, it is a logical conclusion in OUR universe.  But I understand ... you guys are in a different one.  Sure, there could be other causes. Like chance for example, with a probability of 1 in 50 gazillion googolplex.


Quote
In fact, the anthropic principle is an argument against an omnipotent creator. If God can do anything, he could create life in a universe whose conditions do not allow for it.
OK. So the anthropic principle might argue against an omnipotent creator if you are in one of those alternate universes, but again, in this universe, it argues FOR one.  Fine.  Postulate a God anyway you like.  But the fact is humans are here and the universe is fine tuned for them.  The fun question is WHY?  Again, enter the Bible.

OK.  Fire away if you can!  I'll cut and paste some of your "Ape Objections" onto this thread so you don't think I abandoned you.  As for Portuguese ... you guys can go argue that one among yourselves.  You don't like what I have to say anyway, so why would you want me involved?  To me it sounds like "The sky is blue. No it's not ... you're an idiot.  Yes it is, see, look at it.  It's not EXACTLY blue, see, it's really Royal Blue. And here we have all these sources that don't say anything about it being blue to prove that it's Royal Blue.  Come argue with us, please, Davy.  We really want to show you how smart we are and how dumb you are.  OK?  Please?"


Until manana! Or manhao! (for you Portuguese fans) (I don't know how to do the tildes)

Date: 2006/05/23 11:43:37, Link
Author: afdave
Faid--  The sky is Royal Blue.  

There.  Is that better?  You won!

I'm glad you are leaving my thread.  I would rather have people respond to me who care about representing ToE well (that is honestly).  I've had several.  I'll probably have a few more.

Date: 2006/05/24 00:43:28, Link
Author: afdave
OK.  I said I was going to let this thread die, but I got to thinking that I really don't want to clutter up my "God Hypothesis" thread with Anti-Evolution arguments.  And I learned something new this morning which dispels a persistent myth that I have heard.  It's amazing how many good scientists are jumping the Darwinist ship and writing good new articles which support Creationist Theory.

RESISTANT BACTERIA:  NO PROOF OF EVOLUTION
I have always thought that most mutations are harmful, but that there are a few that are beneficial.  Bacterial mutations which confer resistance to anti-biotics have been cited most often to me as an example of beneficial mutations.

So, I thought I would investigate.  Here's a recent article which appears to dismantle the idea of resistant bacteria supporting the ToE.  What do you think?

 
Quote

Is Bacterial Resistance
to Antibiotics an Appropriate Example of Evolutionary Change?

Kevin Anderson, Ph.D.
© 2005 by Creation Research Society. All rights reserved. Used by permission.
This article first appeared in Vol. 41, No. 4 of the Creation Research Society Quarterly, a peer-reviewed journal published by the Creation Research Society.

Abstract
Evolutionists frequently point to the development of antibiotic resistance by bacteria as a demonstration of evolutionary change.  However, molecular analysis of the genetic events that lead to antibiotic resistance do not support this common assumption.  Many bacteria become resistant by acquiring genes from plasmids or transposons via horizontal gene transfer.  Horizontal transfer, though, does not account for the origin of resistance genes, only their spread among bacteria.  Mutations, on the other hand, can potentially account for the origin of antibiotic resistance within the bacterial world, but involve mutational processes that are contrary to the predictions of evolution.  Instead, such mutations consistently reduce or eliminate the function of transport proteins or porins, protein binding affinities, enzyme activities, the proton motive force, or regulatory control systems.  While such mutations can be regarded as “beneficial,” in that they increase the survival rate of bacteria in the presence of the antibiotic, they involve mutational processes that do not provide a genetic mechanism for common “descent with modification.”  Also, some “relative fitness” cost is often associated with such mutations, although reversion mutations may eventually recover most, if not all, of this cost for some bacteria.  A true biological cost does occur, however, in the loss of pre-existing cellular systems or functions.  Such loss of cellular activity cannot legitimately be offered as a genetic means of demonstrating evolution.


Now here is an excerpt from the discussion of what is required to support the idea of Common Descent With Modification ...
Quote
Thus, common “descent with modification” provides a more appropriate and functional definition of the theory of evolution, and this article will refer to evolution in this context.  This definition also entails several “predictions” regarding the types of genetic change necessary for common evolutionary descent (predictions that are in sharp contrast to the “predictions” of a creation model).  Such changes must provide more than mere changes in phenotype; they must provide a genetic mechanism that accounts for the origin of cellular functions and activities (i.e., regulatory systems, transport systems, enzyme specificity, protein binding affinity, etc.).

Genetic changes that reduce or eliminate any of these cellular systems provide no genetic mechanism for common “descent with modification.”  Rather, such changes are actually the antithesis of this descent, reducing or eliminating a pre-existing system of biological complexity (a reversal of “descent with modification”).  Therefore, these genetic changes offer no example of a genetic mechanism for the “evolutionary” acquisition of flight by non-flying organisms, cognition by non-cognitive organisms, photosynthesis by non-photosynthesizing organisms, etc.  Yet the theory of evolution requires such events to have occurred, and requires mutations capable of such genetic changes.  Hence, the predictions of evolution require specific types of changes, not just so-called “beneficial” mutations.  Therefore, despite the great claims that have been made, it is imperative to question whether acquisition of antibiotic resistance is a valid example of evolutionary change that supports the predictions of the evolutionary theory (i.e., the theory of common “descent with modification”).


Here is a particularly telling table showing LOSS of function, not gain.  

 
Quote

In the presence of a particular antibiotic (or other antimicrobial), any mutation that protects the bacterium from the lethality of that compound clearly has a “beneficial” phenotype.  Natural selection will strongly and somewhat precisely select for those resistant mutants, which fits within the framework of an adaptive response.  But, molecular analysis of such mutations reveals a large inconsistency between the true nature of the mutation and the requirements for the theory of evolution (Table I).

Table I. Mutation Phenotypes Leading to Resistances of Specific Antibiotics. Antibiotic  Phenotype Providing Resistance  
Actinonin  Loss of enzyme activity  
Ampicillin  SOS response halting cell division  
Azithromycin  Loss of a regulatory protein  
Chloramphenicol  Reduced formation of a porin or a regulatory protein  
Ciprofloxacin  Loss of a porin or loss of a regulatory protein  
Erythromycin  Reduced affinity to 23S rRNA or loss of a regulatory protein  
Fluoroquinolones  Loss of affinity to gyrase  
Imioenem  Reduced formation of a porin  
Kanamycin  Reduced formation of a transport protein  
Nalidixic Acid  Loss or inactivation of a regulatory protein  
Rifampin  Loss of affinity to RNA polymerase  
Streptomycin  Reduced affinity to 16S rRNA or reduction of transport activity  
Tetracycline  Reduced formation of a porin or a regulatory protein  
Zittermicin A  Loss of proton motive force  

Bacterial resistance to the antibiotic, rifampin, can result from a commonly occurring spontaneous mutation.  Rifampin inhibits bacterial transcription by interfering with normal RNA polymerase activity (Gale et al., 1981; Levin and Hatfull, 1993).  Bacteria can acquire resistance by a point mutation of the ß-subunit of RNA polymerase, which is encoded by the rpoB gene (Enright et al., 1998; Taniguchi et al., 1996; Wang et al., 2001; Williams et al., 1998).  This mutation sufficiently alters the structure of the ß-subunit so that it loses specificity for the rifampin molecule.  As a result, the RNA polymerase no longer has an affinity for rifampin, and is no longer affected by the inhibitory effect of the antibiotic.

In fact, the level of rifampin resistance that a bacterium can spontaneously acquire can be extremely high.  In my laboratory, we routinely obtain mutant strains with a resistance level that is orders of magnitude greater than that of the wild-type strain.  When rifampin is present, this mutation provides a decided advantage for survival compared with those cells lacking these specific mutations.  But, each of these mutations eliminates binding affinity of RNA polymerase for the rifampin.  As such, these mutations do not provide a mechanism accounting for the origin of that binding affinity, only its loss.


Dr. Anderson summarizes thusly ...

 
Quote
Summary
Resistance to antibiotics and other antimicrobials is often claimed to be a clear demonstration of “evolution in a Petri dish.”  However, analysis of the genetic events causing this resistance reveals that they are not consistent with the genetic events necessary for evolution (defined as common “descent with modification”).  Rather, resistance resulting from horizontal gene transfer merely provides a mechanism for transferring pre-existing resistance genes.  Horizontal transfer does not provide a mechanism for the origin of those genes.  Spontaneous mutation does provide a potential genetic mechanism for the origin of these genes, but such an origin has never been demonstrated.  Instead, all known examples of antibiotic resistance via mutation are inconsistent with the genetic requirements of evolution.  These mutations result in the loss of pre-existing cellular systems/activities, such as porins and other transport systems, regulatory systems, enzyme activity, and protein binding.  Antibiotic resistance may also impart some decrease of “relative fitness” (severe in a few cases), although for many mutants this is compensated by reversion.  The real biological cost, though, is loss of pre-existing systems and activities.  Such losses are never compensated, unless resistance is lost, and cannot validly be offered as examples of true evolutionary change.


Now you can read the rest of the article if you like  HERE.

OK.  Shoot me down if you can!

AFD

Date: 2006/05/24 04:28:59, Link
Author: afdave
Questions from the "Ape/Human" and "God Hypothesis" threads ...
Renier ... [quote]Afdave, I don't get this "Common Design" thing. Back to the broken Vitamin C gene. Was it broken BEFORE the fall of man, or did it break AFTERWARDS?

If before, then humans were not made perfect, right? If after, then why the he11 did it break in much the same way as that of chimps, and then trace it back futher to other apes. BS laddy.

Let's say it broke afterwards (after the apple). Why so similar, and why in such a way as to look like common descent? You saw the nice little graphics that the people showed you about how the mutations are related. [/quote]
Well, Renier, I cannot say for sure since I was not there (as Ken Ham likes to say), but there are some pretty simple possible answers if you open your mind up a little.  My theory is that it broke AFTERWARDS.  The reason the GULO gene is so similar is because ... drum roll ... Apes and Humans are so similar!!  Now, that wasn't too difficult, was it?  For those of you that still don't get it, just think of the old Ford analogy.  Remember I said that Aerostars and Fiestas are 95% similar, like Chimps and Humans?  (Well, I don't know if it's 95, but probably close enough for the analogy).  OK.  Now all Fords have alternators, right?  And probably the Aerostar alternator is going to be a little bigger than than the Fiesta alternator, maybe even a few design differences.  So the alternator is like the functional GULO gene, OK.  Is everyone with me?  Now ... what happens after about 5 years of driving these cars?  The alternators might break.  Pretty believeable, right?  Do they break in the same way?  Maybe, maybe not.  Now, where did these two vehicles come from?  A COMMON DESIGNER.  Imagine that!  Now why is this so hard for you to picture with Apes and Humans?

Chris Hyland ...  
Quote
No, it is the fact that the mutations are the same, which is evidence that we share a common ancestor. It isnt just based on sequence identity. It is the mutations that have occured that are the important part, but you seem to be ignoring this point.
How am ignoring this?  Here is what Jeannot said ...
 
Quote
you can't consider the loss of function alone as a valid evidence for common descent, because hundreds of mutations can break a gene.
Your statement and Jeannot's seem to contradict.

 
Quote
No, but everyone who has claimed to base their arguments on Denton has ended up spouting nonsense. Read the old Shi thread for an example.
I don't doubt that you have encountered some non-sensical YECs here.  So just because some other guy quotes Denton and spouts nonsense means all quotes of Denton are nonsense?  Why not try refuting what Denton specifically says?

 
Quote
By the way, could you give the specific reference to this "medieval encyclopedia" you rely on? I'm curious to learn how little Burgundy was able to spare thousands of knights for such a distant enterprise, and what language those knights were speaking.
Dictionary of the Middle Ages, vol. 10, 1988, American Council of Learned Societies, p. 39 and following.  Did I say "thousands"?  Well, even Creos make misquotes once in a while.  I should have said "several contingents", which is the exact wording of this article.  I read "thousands" somewhere else, but failed to get the reference.  Do you really think it was not thousands?  Also, someone asked about word comparisons.  Here you go.  I hope the table comes out OK.

Spanish haber hombre cuerpo noche hijo hecho bueno y
Portug haver homem corpo noite filho feito bom e
French avoir homme corps nuit fils fait bon et

http://www.antimoon.com/forum/t2275-0.htm

Now everyone who speaks both Spanish and Portuguese (as I do) knows the similarities b/t those two.  But this table shows something which is not as commonly known - the similarities of Portuguese to French.  This is why I don't need to spend hours and hours researching documents with Arden.  This is so obvious, folks.  Anyone with their eyes open can see the commonality with the French language.  Also, I have noticed that many of you lose focus on the goal of a discussion.  Again, let me remind you that my goal on the Portuguese thing was not to make a rigorous research project out of it.  My goal was simply to show Rilke that she does not help the cause of evolutionists by ranting and raving about how idiotic Creos are, which is what she did.  While it may turn out after Arden spends hours and hours of rigorous research that my "Portuguese is Spanish mixed with French" statement is overly simplistic, it certainly is not idiotic to say this, and it doesn't help evolutionists look bright to just blindly blather that "Creos are idiots".  But again, I have no desire to spend hours and hours on this.  I proved my point.  There are 3 lines of strong evidence that support that my statement was not idiotic, even though it may prove simplistic.  If Rilke wants to disagree with me in the future, I might suggest using the "Jstockwell" approach which makes evolutionists sound a lot more sane.  I do have to ask ... why would you want to spend hours and hours proving the Portuguese thing?  It does seem to me like you are trying to prove that "the sky is royal blue" instead of just "blue."

But Arden and Rilke and Faid-- If you insist on doing a major research project on Portuguese, please do me a favor and start a new thread for it.  THX.

Eric Murphy ...  
Quote
The "fine tuning" argument simply isn't that compelling, Dave. As half a dozen people have pointed out, what would truly be persuasive is if we found life in a universe that wasn't tuned for it. That's the weak anthropic principle. After all, an omnipotent god certainly could sustain life in a universe manifestly unsuited for it.

But given that God presumably had infinite freedom in how he designed the universe, and assuming that he actually likes life (an assumption that may not be warranted), he could have done a lot better job of it and made the universe vastly, astronomically more congenial to life if that had been his aim. So your argument as to why the universe is not infinitely better suited to life comes down to the usual "God works in mysterious ways" apologetic.
There seems to be a common misunderstanding among evolutionists that Creationists think we invoke "GODDIDIT" at every turn, thus killing scientific inquiry.  This is the opposite of what we do (well, can't speak for everyone ... when I say we, I mean at least ICR, AIG and CRS).  Creationists understand natural laws very well and look for them in everything they investigate.  But Creationists have an expanded concept of Natural Law, namely that THERE ARE NATURAL LAWS WHICH WE DON'T KNOW ABOUT YET, and THERE COULD BE AN INTELLIGENCE OUT THERE SOMEWHERE WHO DOES KNOW ABOUT THESE OTHER NATURAL LAWS AND WHO USES THEM.  Now ... why is it so unreasonable to think this?  To me, Creationists are much more open minded in the sense that they are forward thinking and willing to investigate ALL possibilities, not just 'naturalistic' ones.  Keep in mind that I have never said, "Cosmic Fine Tuning proves there is a God."  I say "Cosmic Fine Tuning" is remarkable and seems to defy staggering odds with what we know presently.  Yes, we could discover multiple universes and then we might see that the odds are not so staggering after all.  But we haven't yet.  So the best explanation that we know of today is that Someone set the parameters, because the odds against them being set as they are are so large.  Note that these parameters are both complex (there are a lot of them) and they are specified (if you change any of them, everything dies).  I don't necessarily agree with everything Bill Dembski is doing, but here is where he shines, in my opinion.  Specified complexity does not arise by chance.  It requires intelligence.  Why would scientists like yourselves be closed minded to this possibility?  It seems to me that YOUR mindset, not ours is less progressive.  The same logic applies to Biological Machines.  The best explanation we know of today is that "Someone designed them."  This is because evolution does not provide the necessary mechanisms to create the machines, and we observe intelligence every day making cool machines, i.e. human intelligence.  We are very familiar with a quite reasonable explanation already.  Why would we not even propose the idea and test it.  Of course, something may come along to make us discard Intelligent Design.  But nothing has yet.  As I said, true macroevolution has not been demonstrated yet, and in my opinion never will.

Eric Murphy ...  
Quote
I'm really glad you're abandoning your anti-evolution argument, Dave, beacuse it's become incredibly tedious.
I decided to keep it alive.  Go check out my questions on bacterial anti-biotic resistance.

Arden ...  
Quote
I sorta don't see the point of responding to AFD anymore, tho some of the linguistic discussions are still interesting. The less they have to do with AFD, the more interesting they are.
Good.  Stay away then.  That way I will be able to dismantle evolutionary arguments and establish Creationist arguments unopposed.

Aftershave ...  
Quote
Missionary AFDave sobs ... BTW Dave, I was right about you washing out of T-38 training, wasn't I?
Uh ... where did you come up with that?  Why don't you start a new thread to investigate me?  If you do you'll find that I graduated with honors in my EE degree, then got selected for the creme-de-la-creme Euro Nato Joint Jet Pilot Training (ENJJPT) at Sheppard AFB in Texas.  This was UPT for fighter pilots and served all of NATO.  Everyone who graduated got assigned to fighter or instructor duty.  I graduated 4th out of a class of 40 and got instructor duty in T-38's which was an absolute blast.  I got married and then lost interest in fighters because of all the deployments and also my "afterburner urges" were fulfilled already.  So go ahead and blather on about my career if you want to, but you are just making yourself look stupider and stupider with every new post.  On the other hand, if you want me to think you are intelligent, try studying "Jstockwell."  He's the most intelligent sounding person I have yet encountered here.  

I guess if you can't come up with anything intelligent on your own to say about Evolution, maybe you could start a thread on Rocket Science.  Didn't you tell me you are some kind of rocket scientist?

Rilke ...  
Quote
Dave posted some words in a thread,
That showed that his knowledge was read
From pages of men
Who were smarter than him
Since nothing is found in his head.

I like your poetry, but do you have to repost my ENTIRE post?  Sure takes up alot of space.  What's the point of that??

Oh, by the way, I also like to write poetry.  You will see mine in the form of a soon-to-be-released new Dynamation called "The Watchmaker" at www.kids4truth.com.  See, we want to get to these kids with the truth at a young age, so that they will not go wrong in science like you did when they grow up.

Drew Headley ...  
Quote
AFDave's anthropic argument is like saying if somebody wins the lottery it must have been rigged because the chances are so slim.
This betrays your ignorance of the comparison.  With the lottery, someone always wins everytime you draw a number.  In other words, there is no "specificity."  With the anthropic principle there is an extremely high degree of specificity.  

Drew again ...  
Quote
Hey guys, I just poured a glass of water and the water took the exact shape of the glass. I am not kidding, there is an amazingly small probability that the water will arrange itself into the exact shape of the glass, but it does. Must be divine intervention!
Stop Drew, before I conclude you are not a scientist.  Right now I think you are simply a scientist who has said some goofy things.

Chris Hyland ...  
Quote
You seem to be using arguments about the probabilities of universal constants taking certain values, how do you calculate these? Thanks.
I didn't calculate them which is why I just used the general 1 to 50 gazillion googolplex to illustrate the enormity of the odds against a finely tuned universe.

Faid ...  
Quote
Note that my thesis does not require more than one universe to exist, although some cosmological theories propose this. Even if ours is the only universe, and that universe happened by chance, we have no basis to conclude that a universe without some form of life was so unlikely as to have required a miracle.
 See my discussions with others on alternate universes.

BWE ...  
Quote
If you can prove that the Earth is less than, say, a few billion years old, then you will have disproved evolution and all its trappings anyway.  I would ask that you begin by accepting that you are generally delusional but I suppose that is too much to ask.
I would like to know how many of you would sign on to BWE's promise.  Because I am going to do just that.  Will you all become Creationists if I do?

I would like to admonish all the professional "insulters" here to take notes from BWE.  In spite of the fact that he hurls insults regularly, I actually get a big laugh out of each one, and ironically, I have come to like the guy.  There's just no way a guy could get mad at BWE when he insults you so creatively.  I won't embarrass those of you who aren't very good insulters, but you probably know who you are.  Here's a hint:  just read it before you post it ... if it makes you laugh, then it's probably funny and worth posting for entertainment value.

Mr Christopher ...  
Quote
Behe's own univeristy has a public disclaimer on their web site distancing themselves from Behe's nonsense ... Dembski has more degrees than I have ex-wives and so far he has amounted to nothing ... For a corpse to rot it must first die yet ToE rages on in modern science and education.    No sign of ToE even catching a cold.  Looks healthier than ever.
Weren't Galileo and Copernicus "science outcasts" as well?  Now they look pretty smart, though, don't they?  Goofy argument, Mr Christopher.


Jstockwell ...  
Quote
afdave,

Did you even read my post on why fine tuning does not distinguish between a designer and natural origins of the universe?

Put simply, given that life exists in this universe, both hypotheses predict the same thing: the universe will be able to support life.   How do you not see this?

Now, you could say: 'ah, but fine tuning seems so unlikely, it points to a designer!'  However, in order to make this claim, which is a probabilistic one, you MUST have data on other universes, and have a detailed model on how the parameters of universes are generated.  Do you have these?  If you do, you really should publish them.
 No.  I do not have to have data on other universes.  Science takes what it knows NOW, and forms hypotheses.  Then if we turn up some new info on some other alternate universe, we will modify the hypothesis if we are forced to.  This happened with Newton when Einstein came along, but it did not negate Newton's work.  The best hypothesis that we have right now considering data from all scientific disciplines is the "God Hypothesis" (or Super-ET or Intelligent Designer Hypothesis or whatever label you want to give it).  No one has a clue about abiogenesis, macroevolution in organisms has no empirical proof (in fact the opposite of what is predicted actually happens), etc. etc., so the best explanation that we have today is the God Hypothesis.  Not to say there won't be a better explanation not requiring a 'God' at some point, but there's not one now.

Steve Story ...  
Quote
I don't know, I don't read very long posts. For example, that Panda's Thumb commenter, what's his name? Glenn Davidson? That guy thinks he's writing features for the NYT magazine.
Hey now, you be nice to Glen Davidson.  I like him.  He hasn't called me a "cretin" in a long time!

Fractatious ...  
Quote
Why do Intelligent Designers (and/or those who support Intelligent Design) proselytize their ideology for fiercely in the face of science? This is something I have tossed around for awhile.
Because the evolutionary science establishment cannot see the forest for the trees.  They are so blinded by their beloved theory that they are overlooking the most obvious evidence for Intelligent Design that it is quite ludicrous.  The only choice then for YECers and IDers is to "go public."  Since scientists are not educating the public responsibly in the area of origins, someone must.  So we do.  We are basically doing a political "end run" around obstinate, head-in-the-sand scientists.  Note that we only oppose a small portion of what scientists do.  There is much good work that scientists are doing in spite of their "evolution glasses."  We do not oppose this.

Fractatious ...  
Quote
A question I have been asking for years, which has not been answered (and actually blatantly avoided and ignored) is:

Hypothetically, say science is wrong. Hypothetically, evolution is incorrect. Then give the Intelligent Design model using scientific methodology. Evolution would fail under scientific methodology, then show how Intelligent Design will excel above it, using scientific methodology.
I'm not up as much on the ID research program ... maybe it is non-existent as of yet.  But I can tell you that the Creation research program is doing very well with excellent organizations such as ICR, CRS and AIG.  And no government funding!

Fractatious ...  
Quote
Simplistically, would I go ask a Janitor with no higher education to give me an analysis of Mendel's Genetics? Would I seek out C.S Lewis to give me an analysis on Psychology?
 Surely you cannot really believe that C.S. Lewis is like a janitor?  Do you know nothing of his credentials?  Look, I don't agree with Dan Brown either, but I recognize that the man is brilliant and talented.  If you are going to discredit Lewis, one of the most influential Christian philosophers of the 20th century, you need something better than what you have given.

Date: 2006/05/24 06:31:04, Link
Author: afdave
Quote
Firstly, what did you think people meant when they talked about mutations conferring antibiotic resistance?
Just what they sound like they mean. That this somehow provides evidence that macroevolution has in fact occurred.  

I am amazed that you would not realize that this argument is commonly used as 'proof' of macroevolution.  I'm quite sure that it has been used by people at this forum ... was it Norm?  I cannot remember who.  Probably several people, though.

 
Quote
How does this not fall under the definition of evolution?
It falls quite nicely under what I call microevolution, but as I said, this argument is routinely offered up as evidence for macroevolution or what I call 'upward evolution.'

The big revelation to me, again, is that this 'proof' for macroevolution is utterly bankrupt.  

Not that I expect anyone here to repent and run to Jesus now.

But as I have said many times, this whole exercise here at Panda's Thumb is helping me educate the public, which I have become convinced is the only way to solve this problem, since scientists heads are in the sand on origins.

 
Quote
Changes in form are generally caused by the rearrangement of regulatory mechanisms already present.
 Ding. Ding. Ding. You are correct.  And the changes in form are very minor - beak gets a little bigger, hair gets longer or shorter, color changes, etc.  No one has ever shown an eye evolving where there was no eye before, or other major changes like this.  

 
Quote
Lets take for example Streptomycin, resistance to which is caused by a mutation in the 16s rRNA that removes the antibiotics ability to inhibit protein synthesis. Whether or not this mutation affects the function of the ribosome is irrelevant if it causes resistance, as long as it does not inhibit function all together. It is evolution by any definition.
OK. Call it evolution if you want to.  I will call it microevolution which I agree with and is no affront to truth, to distinguish it from macroevolution, which is impossible and untrue, and which is what I'm fighting.  And remember, the reason I am fighting it is because on the social and government scene it is critical to correctly define human beings as what they truthfully are:  Creations of the Creator God, made in the image of God, and placed in a position of dominion over all of nature.

 
Quote
Has anyone ever claimed that reistance to rifampin did provide a mechanism for explaining the origin of binding affinity?
I doubt anyone says it quite like that, but here is how the fairy tale is typically told ...

World Book, 1993 edition, "Evolution" entry ...  
Quote
Evolutionary theory holds that all species probably evolved from a single form of life which lived about 3-1/2 billion years ago ... The theory of evolution is supported by a vast amount of evidence from many scientific fields.  When a theory is supported by so much evidence, it becomes accepted as a scientific fact.  Almost all scientists consider the theory of evolution to be a scientific fact

Keep in mind, the kid reading this is assuming ToE=All life from single celled ancestor=Proven Fact.  The article then sprinkles in a fair amount of truth regarding speciation, etc. and then under "Evidence of Evolution" under the heading "Direct observation of evolution", we read ...  
Quote
Other examples of rapid, observable evolutionary change have occurred among certain insects and disease-eating bacteria ... Some disease-causing bacteria have become resistant to antibiotics in a similar way.


So what does the kid take away from this?  ToE=All life came from a Single Cell ancestor=Scientific fact, and by the way, disease resistant bacteria proves it.

This is ABSOLUTE AND UTTER BALONEY and now you know why I am fighting you.

This causes nothing but confusion in the minds of kids (and scientists, I might add) and it is totally irresponsible behaviour on the part of science authors.  Then people on this forum (not you) have the audacity to say I'm irresponsible for pointing out this fraud.


 
Quote
No one has ever claimed horizontal transfer does provide a mechanism for the origin of novel genes.
Again, maybe they don't say this exactly - evolutionists are slippery fish.  But they do say things like the World Book article a lot, and they are totally irresponsible in doing so.

 
Quote
Like most creationists the author of the article attacks his own definition of what evolution is. Much of evolution has resulted from loss, ussually loss of interaction between components. This of course follows duplication and allows the creation of biological novelty. In any case what definition of evolution do you use where mutations causing antibiotic resistance do not count?
He had to come up with his own definition of Evolution because nailing evolutionists down on their definition is like nailing jello to the wall.  You guys slip and slide and conform your theory to findings in such a ridiculous manner it is hilarious.

 
Quote
If a mutation causes a  kitten to be born without hair, which "function" was lost exactly?

If a mutation causes a human baby to be born covered with hair, which "function" was lost exactly?

Or is it that nothing was exactly "lost" in either case, but rather, something was modified?
Faid, I actually thought that you guys might have something with the bacteria thing, but since I have read this article by Dr. Anderson, I cannot think of a single thing left where you could possibly say that an organism gains a new function.  I bet if I really scrutinized Norm's nylon-eating bacteria, I would also find LOSS of function, not gain, whaddya want to bet?  Don't worry, I'm not going to research it personally ... I'll leave it to CRS.

I can speak for a lot of creationists -- I know that many, many of them do not yet know about this article.  It only came out last year.  When lots of creationists get ahold of this article, you are going to see evolutionists scurrying like cockroaches to change all the textbooks and encyclopedias to get rid of statements like I quoted from World Book.  You watch and see.  Maybe they have already done so recently because the smart evolutionists will catch on pretty quickly how ridiculous this makes them look.

 
Quote
The situation with insects and pesticides is similar to that of bacteria and antibiotics. Pesticides are widely used to kill insects. In turn the insects quickly evolve in ways to become immune to the pesticides.

Loss of function, Renier.  No proof for macroevolution, my friend.  Your boat has another hole.  Start bailing faster!

 
Quote
For the hard of reading, what actually happens, is that ccontrary to Dr(?) andersons assertion, bacteria that have mutated to have anti-biotic resistance, although they are sometimes less fit in a normal environment than normal, unmutated bacteria, then proceed to mutate back up to the same level of fitness that they were before the original mutation.
Yes.  Just go ahead and make a wild assertion to try to plug the new hole in HMS Darwin.  It's no use.  You're going down.

**************************************

Hey, Rilke ... what's with reposting my entire post?  I mean, I guess that's fine ... why not post the truth TWICE?  But what exactly is your goal in doing it?   Just curious.

**************************************

Date: 2006/05/24 07:38:02, Link
Author: afdave
Quote
No, the fact that the genes are broken is not evidence for common descent, but the fact that all the breaks are the same is. It is not just the sequence similarity, it is the fact that all the mutations that occured after the break are the same. This is about the fifth time I have said this.
I seem to recall that at least two other people said they were NOT claiming that all the breaks are the same.  I think what may be going on here is that you guys are saying that (1) both are broken and (2) they are 95% similar.  From this you conclude that the gene was broken in a supposed common ancestor, then transmitted along two separate lines of evolution.

Now what I am saying is this:  If both are broken and they are 95% similar ... big deal.  Fiestas are 95% similar to Aerostars and their alternators are also 95% similar, and guess what ... they are both susceptible to breaking ... maybe even in the same way!  But they share a Common Designer!  Ditto for Apes and Humans!

Quote
I am not taking my past experiences as proof of having refuted Denton. Perhaps you could summarise for me?
I think I did already.  Please refute Denton point by point if you can.

Quote
Could you please explain to us how to investigate non-natural possibilities?
I have been demonstrating how on this thread.  I know it's not comfortable and is a different way of thinking than what you are used to, but it is the only way to really determine truth.  Science today must be expanded to include the possibility of non-natural events or it becomes artificially myopic.  Remember, the definition of non-natural is simply natural laws which WE DON'T KNOW ABOUT.  Are we so proud to think we know all the natural laws which COULD ever exist?  I'm not.

Quote
You still haven't explained this [biological machines] in any depth.
One can only explain something in as much detail as one knows TODAY.  Tomorrow we may know more and we may be able to explain in further detail.  I fully expect Dembski and Co. to come up with rigorous mathematical ways to investigate irreducible complexity. Intuition is all we have at the moment.  But my intuition explains the data better than your obvious Fairy Tale (no offense ... I know it's not YOUR fairy tale, necessarily).

Quote
Only if you have a very narrow idea of what evolution is.
The only definition that makes scientific sense is one which can be demonstrated in the lab.  This would be what I call microevolution and I agree with this.  I just don't agree with macroevolution because no one has demo'ed it.

Quote
If the ape (Ford) kind was originally created, and then "evolved" (okay, degenerated since the Fall) into Fiesta (chimps), Aerostar (gorillas) and Taurus (orangutans), then what the ****ing he!! is that Toyota Echo (humans) doing in there, sharing MORE similarities to the freakin' Fiesta (chimps) than any other Ford vehicle (ape), not only in how it is designed (lots and lots of functional genetic sequences), but in exactly how its alternator, cupholders and silly little handles above the doors have fallen apart since it was designed (lots and lots of non-functional sequences, such as pseudogenes like GULO)?  What kind of industrial espionage and manufacturing piracy is your Creator involved in here?

I know you will now argue for the similar purpose/market of the Ford Fiesta and Toyota Echo, but that doesn't help you one bit with the "kind" problem: doesn't your "theory" positively demand that the original created kinds be more similar to each other than to another kind?  Else what is the purpose or meaning of this whole "kinds" thing anyway?  If the human kind shares MORE common "design" with a certain member of the ape kind than either shares with the other ape kinds, what does this mean to you?
No one has EVER told me that Humans and Chimps share more genetic similarity than say Chimps and Gorillas.  Is this true?

Quote
Scary, Dave.  Just plain scary.  Never come near my kids, and I'll return the favour, m'kay?  By the way, I thought you were most interested in discovering the "truth" (as we are)?  Indoctrination first, eh?
It's indoctrination if it's lies you are teaching, such as macroevolutionary theory.  If it is the truth you are teaching, then it's not generally thought of as indocrination, but simply 'teaching.'  You and I just have different views.

Quote
Erm...Dave...if you give a number as an answer, there #### well better be a calculation involved, no matter what the margin of error in the result.  Back of the envelope is fine (so long as it is represented as such), but we better be able to look at the freaking envelope.  Welcome to science, big guy.  You're not allowed to pull numbers out of your a$$.
50 gazillion googolplex is not a number last time I checked.  Is it a number to you?

Quote
Oh, he11 yeah.  Dave, if you can provide me with rigorous positive evidence that the earth is less than one billion years old (i.e., evidence that matches the standard set by the many independent methods of estimation establishing the current accepted age) , I will join the church of your chosing and pray/observe accordingly.  If you get anywhere near the 6,000 years you believe in, I will even do so sincerely.  I'll be watching, but I won't be practicing any hymns yet.
Cool.  You can start warming up on Amazing Grace ... (you know, the part about "a WRETCH like you")  (just kidding, just kidding ... don't get offended)

Quote
You know what really gets my goat? It's that "argument" that Ken Ham uses. "Were the scientists there in the beginning? NO! God was there, He knows what happened."

This argument is pure BS. Here's why. Let's just go ahead and hand it to Ham, and say that he's right, that God was there in the beginning, and of course, he knows better than modern scientists how the universe, and the earth, and mankind were "created" because He witnessed it. This would be some excellent information to get our hands on, indeed. The only problem is with the fucking priests who say they know what God knows. Bull. I don't buy it for a second. For each of the 6 billion people on the planet there is a different opinion of what God is. And there is no credible evidence of Him ever communicating with anyone.

If Ken Ham could persuade God Himself to debate the scientists in any forum, I might think that He had a chance of beating the scientists. But, it's not God that scientists are arguing with, it's assclown priests like Ham.
You make a good point, but you misunderstand Ken Ham.  It would be irresponsible to quote the Bible if we (and Ken) had not done our homework and determined that the Bible is truly a Supernatural book and that it is in fact the message of God to mankind.  Only after this hard work is done is it appropriate to say "God was there and He can tell us."  The good news is that this hard work has been done.  I'm planning on walking you through a little of it.

Drew Headley ...
Quote
You are wrong, somebody does not always win the lottery. That is how jackpots can get so high periodically, because nobody wins for a while.
Oops.  You're right.  I was moving a little too fast.  The comparison is still not valid though because the lottery is not "specified complexity." The cosmic parameters are.  All of them have to be a SPECIFIC value for life to work.

Quote
If the constants are constrained by laws we do not know about yet, then the probability of the universe being able to sustain life could be quiet high.
It could be quite high IF we learn about the new laws, agreed.  But we do not know about any new laws now.  Science is about observing what we can TODAY, then making  reasonable hypotheses.  Then if we learn something new tomorrow, we modify our hypothesis.

Quote
No, Dave. It's not that Creationists are more "open-minded" than scientists. It's that they're lazier.

Scientists are well aware that there is natural law out there that is poorly understood (that's the understatement of the century). The difference is that Creationists seem content to assume that "someone" out there understands them, and therefore everything's okay.

Scientists, on the other hand, work for a manifestly downscale wage, most of the them, in a concerted effort to understand those natural laws. They do actual, you know, research. They spend their lives trying to figure stuff out. It should be clear to you by now, based on your reading of Creationist writers, that Creationists don't actually do research. They spend all their time attempting to critique other peoples' research.
How can you say they are lazier when most of the scientists who founded modern science were creationists?  Creationists have PLENTY of research going on.  Check with ICR and CRS.  Even AIG has a Technical journal now that catalogues real, scientific research.  Now I cannot speak for DI.  You may be correct when you say they do not do research.  But give them time.

Quote
But the problem is, that's where you stop, Dave. You don't go out there and see if you can figure out why the physical parameters are the way they are. People like Lee Smolin, and Lisa Randall, and Murray Gell-Mann, and Stephen Hawking, and Edward Witten are out there every single day trying to figure this out. Meanwhile, the creationists are out there doing what amounts to saying "Goddidit," even if that's not the literal word they're using.
Why stop there?  No one else does.  You don't.  Congress sure doesn't.  Congress writes laws which are INTRICATELY TIED to their understanding of what a human being really is.  Mao Tse Tung had an idea a what humans are and I like our Congress' idea better.  But that's just me.  That's why I don't stop.  I do all I can and Creation scientist ARE doing lots of their own original research, but you are correct ... it only takes us so far.  Then we have to make the hard decisions about government and war and taxes and so on, based on the best information we can get from the scientists on what a human being really is.

Quote
Dave, it's not that scientists are closed to the possibility of supernatural explanations. It's that time and again, appeal to supernatural explanations hasn't gotten science anywhere. Do you think if Einstein had said to himself, well, lightspeed must be a constant in Maxwell's equations because god planned it that way, he would have gotten anywhere in his investigations?
I want to do a research project to show you that a Design Hypothesis makes for MORE PRODUCTIVE scientists than ToE does.  I have not researched this, but I have an idea it is true.  And I would start by saying look at all the time that is wasted by people who try to come up with "how the immune system might have evolved" and so on.  So much time is wasted speculating and writing "Alice in Wonderland" stories, that at the very least, we could put those good minds to work doing something more productive than that!

Date: 2006/05/24 07:46:58, Link
Author: afdave
Quote
Look at the source for your quote, Dave. Doesn't that make you the least bit suspicious? How many times have we told you that if you really want to find out what evolution is all about, if you're actually open-minded about the subject, you'll read actual books on evolution from people who actually know what they're talking about. Your insistence on citing things like AiG and the Creation Research Institute just make us laugh. Those guys are clowns, and we know it. You really should know it by now too.
I thought I was doing what you always are asking me to do ... quote a REAL SCIENTIST who REALLY WEARS A LAB COAT and you know ... does REAL WORK!  Am I mistaken?

ARDEN ... THIS IS GOD SPEAKING ... IF YOU WANT TO ARGUE PORTUGUESE, PLEASE START A NEW THREAD ... THIS THREAD IS ABOUT "THE CREATOR GOD HYPOTHESIS" ... HENCE THE CREATIVE TITLE.

Date: 2006/05/24 08:11:57, Link
Author: afdave
Quote
There's the admission folks, in his own words.  Not a single word of this was about science.  There is nothing you can prove to him, nothing that will change his mind.  

He's here ... because on the social and government scene it is critical to correctly define human beings as what they truthfully are:  Creations of the Creator God, made in the image of God, and placed in a position of dominion over all of nature.
Admission?  Do you think I was trying to HIDE this? Not at all.  I've said this several times.  You must be a newcomer.

Quote
This is consistent for AFD, tho -- and for all other Creationists. Their whole agenda depends on convincing people that the more you know about a subject, the LESS qualified you are to speak about it. Thus the often-seen notion that biologists are the LAST people who should be talking about 'origins' -- much better to have mathematicians, engineers, pastors, or retired Air Force pilots. The less education they've had, the more 'objective' they are.
No.  You'll notice that we have no agenda to attack the linguists (other than the silly little Portuguese fun we had), we don't attack the cancer researchers or doctors or geologists searching for oil, and many, many other good people.  We are just attacking the General Theory of Evolution for the reasons stated above.  Soon the lightbulb will come on for a majority of scientists regarding Intelligent Design and us 'amateur scientists' will go back to our churches and be quiet.  This kind of thing has happened over and over again through the centuries and it will happen here as well.

<