AE BB DB Explorer


Action:
Author:
Search Terms (separate with commas, no spaces):


form_srcid: BWE

form_srcid: BWE

form_cmd: view_author

Your IP address is 54.196.57.4

View Author detected.

view author posts with search matches:

Retrieve source record and display it.

form_author:

form_srcid: BWE

q: SELECT AUTHOR, MEMBER_NAME, IP_ADDR, POST_DATE, TOPIC_ID, t1.FORUM_ID, POST, POST_ID, FORUM_VIEW_THREADS from ib_forum_posts AS t1 LEFT JOIN (ib_member_profiles AS t2, ib_forum_info AS t3) ON (t1.forum_id = t3.forum_id AND t1.author = t2.member_id) WHERE MEMBER_NAME like 'BWE%' and forum_view_threads LIKE '*' ORDER BY POST_DATE ASC

DB_err:

DB_result: Resource id #4

Date: 2006/01/04 12:48:03, Link
Author: BWE
Ok I'll bite.
Flint,
Quote
I can only disagree that economics is a form of morality. We might make economic decisions for moral reasons, but economics doesn’t care, anymore than mathematics cares if we decide three is a magic number.

We have seen economies (or at least attempted economies) where taxes are 100%, and *everyone* lives by subsidy. We saw terrible productivity, terrible environmental practices, entirely shoddy workmanship (when anyone bothered to work), empty shelves “full” of “free” goods, etc.

You may not *like* the idea that income determines the quality of our lives in many ways, but not for nothing is the free market described as the worst possible arrangement, except for everything else that’s been tried.


Economics doesn't care is true, but economics doesn't exist w/out economic activity. And that, dear flint, is a bunch of moral decisions. I agree about the free market thing you mentioned but it does have drawbacks that I think Keynes and Adam Smith make clear. http://books.google.com/books?i....ev=http

Date: 2006/01/05 05:44:22, Link
Author: BWE
Quote
But I would posit that economic desisions that we need to make as a people are largely moral decisions. i.e. How far do you let members of your community fall? How do we justify witholding preventative health care based on income? Are we equating income with quality of being? etc.


Flint,

I guess my point is that economics as an academic tool of analysis is certainly not moral and is also far more complicated than a few weeks worth of study could do any justice for. But the original point was that evolution is too complicated for the layman (which I happen to sort of disagree with but that is a very long thought so I will save it for another time) and that economics is too. My point was and is that they are fundementally different things. Economic activity and policy decisions are inherently decisions that a layman can and should be a part of precicely because they are moral decisions. A community has to decide if they want to allow a walmart for example. That is a moral decision to a large extent. A small community is not allowed to decide that all business with x number of employees pay for health insurance  or a living wage or etc. Those sorts of powers would most certainly be used to limit competition and encourage cronyism. (Hobbs) But the community includes all its members and the community at large needs to decide whether to employ economic policies that marginalize those on the left side of the bell curve even more. Either that is OK or it is not. THat is a value judgement.

Tax policies make that judgement whether they can be related to their consequences or not. My stock and investment choices have been very succsessful for me. But I do not own stock in walmart or haliburton. Both of those stocks have done quite well over the past several years but my moral decision, however hypocritical it may be, was to not own those stocks. I always vote yes on school and library bonds for the same reason. In my moral world schools would have lots of money. Enough to send the x grade class on a trip to DC every year. Enough to have full time art and music instructors. Enough to buy curriculum from the best places. Enough to bring inspirational people in to talk to the school at assemblies. Enough to have plenty of sports equipment. I think that's enough to illustrate my point.

Evolution is a descriptive word that describes a process that is observable and verifiable. Unfortunately for the fundies, it has been verified. Economics as a discipline is useful to describe behavior but the behavior is largly moral.

Date: 2006/01/05 06:06:58, Link
Author: BWE
Quote
I'm always amused at the anger toward WalMart. They are moral victims of their own success - they have provided what their customers want so excessively successfully that they are now being vilified for doing so. People aren't willing to give up their low prices, but they demand better wages, more benefits, more competition, better community dynamics etc. IN ADDITION.


No. They used a business model which takes advantage of communities offering food stamps and health care. They made what I think of as an immoral business model which cuts costs by letting welfare pay their workers. Sure the people who don't work there like the low prices at first but it is difficult to see the real cost of those low prices. I will argue all day over this one: Walmarts business model is equivalent to me finding a way to tack my automatic mortgage deduction onto my neigbor's and make it look like property tax. I get to live in a nice house and my neigbor is trying to figure out how to make enough money to pay for his kids textbooks. He is bitching about all the money he pays for his property tax and starts voting for people who promise to cut taxes.

Date: 2006/01/05 06:49:22, Link
Author: BWE
Quote
Now, you seem to be saying that the rules should be changed, because they permit organizations like WalMart to cut their costs by shifting costs where you'd prefer they not be permitted to do so. But following the rules is not immoral, and WalMart follows the rules (and are punished when they do not). So what you are saying is that the RULES are immoral. And the community can certainly change the rules if they desire to do so.


Ok. We are saying the same thing I think. Economic policy is making rules and that is the morality I was talking about. Walmart broke no rules but the rules didn't anticipate walmart either. Yes, my morality would say that we should change the rules. I wouldn't need to pay as much more tax if I wasn't already paying for food, rent and health care for walmart employees.

Earlier you said something about politics of envy. Ok, If I am getting by then why should I care if you are making millions.
Answer: I don't. I do care if you are releasing pcb's into the waterways near where I live, making a million and leaving the pcb's. I do care if you are shifting the costs of your business onto me through my tax burden. I don't shop at walmart and it irritates me that I have to spend money there through taxes. I do care that our tax burden is becoming less fair with the tax policies that Bush has pushed. I do care that the lottery and cigarette taxes are taxes on the poor. That is my personal morality. As a citizen, I have an obligation to at least learn enough about what I am voting for to vote my conscience. Thus, the layman doesn't need to understand game theory to make informed economic decisions because economic decisions are largely moral. In zen, half of your training is figuring out that the rules aren't the game.

Date: 2006/01/05 09:08:25, Link
Author: BWE
Right. Sorry.

I get that I don't always make sense. I'll try this again.

My point is that self-interest is a largely moral issue. And that you don't need a thorough understanding of economics to have a valid opinion about economics. Individual policy and economic decisions do have a moral element. I am not talking about economics as a field of study. I am talking about economic policy and activity as a series of decisions. Economics as a field of study is simply descriptive and to some extent prescriptive in a very amoral sense. The actual decisions we make are not the rules and the rules are not the decisions. We fall because of gravity but we choose whether to jump off a cliff.

Either we allow pcb emmitters to dump thim into the waterways or we don't or we find some kind of a middle ground. I don't need to know much about rational self-interest to know that my personal morality dictates that I do not lend my vote to allow pollution to continue.

Walmart is shifting their costs to me through taxes by hiring people for less than a living wage and setting up systems to help those employees take advantage of  food stamps, rent assistance and publicly funded health care. Those are things that my taxes pay for. My sense of rational self-interest says that I should lend my ballot to the policies which force walmart to assume those costs. But I don't need to know about rational self-interest to know that I feel that way.

Being as economic choices are largely moral, I get to define whether I think Bush's tax policies are fair and I don't think they are so regardless of whether my fair and your fair are similar, my morality dictates my position. I just paid a sonofabitch in capital gains taxes when I sold a building we owned. In the end it amounted to a little over 7%. If that was my income tax that wouldn't seem so bad but writing one check made it hurt. However, my morality justifies my writing the check because the society around me alowed me to make the transaction. So for me it's a good tradeoff. But once again, it's my morality that dictates my position.

I chose cigarette and lottery very carefully because my point is that my individual sense of morality dictates that taking advantage of peoples' ignorance is morally wrong. Me personally. In order to follow my own personal morality I should vote or involve myself in such a way as to make these things less rather than more.

But I don't think you need to know much economics to make these kinds of decisions. I think unintended consequenses are not very common in the kinds of policy decisions I have used as examples. Cutting taxes on the super wealthy takes that tax money out of the public coffers. Period. If you start reducing spending eventually you hit schools and libraries. Maybe you get a boom in services catering to the super rich but I haven't seen any data showing an increase in infrastructure investment.

Date: 2006/01/05 13:46:50, Link
Author: BWE
Quote
And exactly HERE is why ignorance of economics is hurting you. Presumably, these polluters are producing some product. They are selling it successfully, or they wouldn't be in business. Pollution reduces their costs. This reduction in costs means more money for something else. Let's say they use their savings to lower their prices. You purchase (in all ignorance) the least expensive, highest quality products you can. Theirs is one of them, BECAUSE they pollute. By purchasing their product, you are "lending your vote" in favor of their practices. Equally important, by NOT buying the more expensive product from the non-polluter, you are punishing him for absorbing the cost of being clean.
Which is why my morality ought to dictate more stringent regulation. A double edged sword to be sure. I don't see how this is ignorance of economics.

Quote
Now, lets shuffle the cost structure around a little bit. Let's reduce your taxes by the amount of the food stamps and other subsidies. You now have more money to spend. Let's raise WalMart's prices enough so that WalMart is now paying their employees enough so they don't NEED food stamps. Are you happy now? Yes, morally you are overjoyed.

And what has happened? Effectively, nothing at all. YOUR money is still being spent (but now through high prices rather than taxes) making WalMart's employees better off. You can spend it through taxes, or you can spend it through higher prices, or you can spend it through a higher risk of theft (burglary) by desperately poor people, etc. But now matter how you cut it, the same economic value as ever is coming out of your pocket. The ONLY thing you have gained is smug moral gratitude. You smote the wicked, you did!

No, what has happenned is that the other companies who feel responsible for their employees can compete against walmart on a level playing field. The walmart employees have health benefits so they can be more productive members of my community all at no cost to me. I would pay for this but I get it free. What a bargain!

Quote
Of course, I didn't tell you MY definition of fair, I asked you to specify yours. I notice you haven't done so. You have CALLED your preferences "fair" but carefully not said what that means.


First, I didn't call them "fair" by any standard other than my personal preference and that is why I didn't elaborate: It doesn't matter what I think fair is, it only matters that I form my opinions and base my actions on what I think is "fair". Personally, what I think is "fair" is that all economic activity is taxed equally at enough to assure the solvency of exceptional public education and recreation (National parks and wildernesses). That could be interpreted as a sort of a steve forbes flat tax I guess but remember, I am a biologist, not an economist. I don't mind if people get fabulously rich but I do mind if people get fabulously poor. I could work out a complicated policy position that would temper these ideals with practical solutions but I don't need to in order to stil behave according to my morals.

I am not sure about smokers average income. I am under the impression that smoking is more prevalent in lower income groups but I do know that lottery purchasing is far more prevalent in low income families. I sat in on our city club meetings about expanding video poker in portland and we were shown some grisly statistics. I'm sure you can imagine.

Is there something wrong with the "fairly normal human need to assign values to everything"?


Quote
You need to ask, if this money were not taken from the super wealthy in income tax, where would it go? Into the stock market? But then it would suffer capital gains tax. Into consumption? But then it would suffer sales and excise taxes. Into building a factory? But then the employees would be paying the taxes. So the money WILL end up in the public coffers one way or another.

-website-
Let me say this about that: There may be economists who say that deficits don't matter but If I don't pay my visa bill off completely every month I get charged interest. That is less efficient. If I borrow money at one rate and invest it at a higher rate I am making money, the gov't doesn't do this.

And, my moral stance again, I don't feel much regret if people who use inherited money to make more money have to pay more tax. I do care if they are taxed to pay for the war. I do care if they are taxed to pay for some other things too. But my morality is what I use to determine what I think is a worthwhile thing to spend public money on and my morality dictates that we all pony up until "my" priorities are met. If I have to pay more taxes that's ok as long as every one else does too. Also, speaking of my morality and introducing rational self interest again, doesn't increased spending on education help the economy? What about increasing the funding for the SBA? That surely would  help the economy.

But in the end, being a biologist and not an economist, I am most concerned with sustainability rather than how big we can grow the economy. Maybe that's easy to say from my comfortable position but, there you have it, it's a good thing one side doesn't control all the government isn't it.

Date: 2006/01/06 10:05:59, Link
Author: BWE
You are assuming a world where consequenses are irrelevant, a purely "economics" academic world where the tradeoffs are simply to be measured and categorized. It seems to me that you are saying that it is fine what walmart does as long as it's within the rules. So when I said that shifting the costs back to walmart would be good because I would get something for free and that that would be a more level playing field, I was making a value judgement that I prefer a world where business cant use my taxes as profit. Especially when it does so much damage to the communities.

If you are saying that walmart doesn't do damage to communities and that walmart is perfectly ok because it is logical then say that. Saying that what we now know about walmart's tactics isn't important because them's the rules is pretty callous and if that's who you want to be then that's ok, but there are benefits to community that you might someday want to take advantage of.

I wonder if you think that prejudice plays no role in opportunity.

Date: 2006/01/09 06:08:45, Link
Author: BWE
Ok, I'm back  :)

Oh good, we've gotten into health care. First, one quick regression back to walmart:
Flint, I am trying to educate myself on this issue. Please correct me where I am wrong, -You are saying that there are trade offs with walmart's model and that the consumers who pay a lower price are recieving one end of that tradeoff and the communities that subsidize walmart through healthcare food stamps rent subsidies and the like (not to mention the employees themselves) are on the other end of that tradeoff. Is this an accurate analysis?

Then you are saying that the benefit/cost balances and it is up to us to change policy if we so choose, right?

In the course of determining the health of some local fisheries, we take small scoops off the ocean floor at different depths. Above 40 fathoms near harbors we are seeing vast ecosystems being over run by non-native species who are following the rules. I wouldn't want to haphzard a moral stance on this phenomena. It does have the capacity to effect our fisheries in a negative way but perhaps that is unimportant since we are doing a very nice job of destroying them without these invaders' help.  Hmmm. I'm not sure how that relates but I somehow feel like it does.

My point would be in the walmart example that the cost is born unequally by the community over the benefits of the lower prices. In fact, I would go on to say that, despite the fact that it is all, er, mostly, perfectly legal and in step with the rules, the simple act of conducting business by walmart is detrimental to many communities and therefore the tradeoff is not equal. If you follow that line of reasoning, then you would say that the rules should be changed? No? So, How much education do I need to arrive at that conclusion?
Now, how much education do I need to arrive at the opposite conclusion? The conclusion that despite using chinese manufacturing to avoid environmental regulations (ANd I am avoiding the issue of cheap labor, let's assume that markets seek out cheap labor and this this is a neutral issue) , despite shifting the costs of paying their employees onto the local communities, despite the loss of local business that does contribute to the communities' wellbeing by providing a living wage and healthcare, that walmart is playing by the rules, is succeeding, and is making stockholders money so it is in fact a good thing?

If education is the element that changes these factors then our education system is in the business of creating values and moral opinions I think. That, by the way, is an aside and not a discussion point.

Date: 2006/01/09 10:53:30, Link
Author: BWE
Tragedy of the commons. Of course people shop there. You know, Game theory study, can't find it but I'll post it when I do: American kids almost always tended toward defection while European kids chose cooperation more of the time. I know this is opening my flank but my point is simply that economics is of course amoral but a moral choice, one that would choose cooperation in the prisoners' dilemma (note how I define moral choice) would choose to change the rules somehow, anyhow, to force walmart to change business practices even at the cost of raising prices. Their model is defection. We'll take it where we can even though we both could lose in the long run. (It's also kind of an imperial policy - the economy is based on sucking the smaller communities then moving on when they are no longer sources of wealth)

Date: 2006/01/10 14:32:29, Link
Author: BWE
And that is why we don't need a degree in economics to make judgements in economic arenas, because economic choices are largely moral choices and, though you can abstract them into an academic field and paint those moral choices as amoral and descriptive versions of those moral choices, in the end our economic activity boils down to moral choices. Walmart is an absolutely beautiful illustration of that fact for the reasons listed above.

Date: 2006/01/11 06:00:32, Link
Author: BWE
Quote
[QUOTE]And that is why we don't need a degree in economics to make judgements in economic arenas


But nobody said we did. What you would learn in economics is how to do things like set product price and quality so as to maximize profits. And to analyze costs and benefits so that you are not taken by surprise.[/QUOTE]

Quote
What’s annoying is that in some fields (like economics, politics, psychology, etc.) we have the public perception that “opinions are like assholes” and no amount of education or experience can lead to a better understanding of these topics than can be assimilated in kindergarten.

So I’m amused at the irony here. Tara Smith has friends who are intelligent, educated (but not in evolution), and still “know better” than to “believe in evolution.” And here we have a response from someone intelligent, educated (but not in economics) who still “knows better” than to “believe in” trickle-down economics. Without knowing even what it is. Sound familiar?


http://www.pandasthumb.org/archive....t-67491

Quote
So does this mean economics remains beyond human comprehension? Is this why economists are said to be paid twice, once to tell you what will happen and again to tell you why it didn’t? But nonetheless, you tell me that “a layman can grasp the impact of some basic economic policies.” Too bad economists can’t model it, despite decades of tweaking. Maybe they should go out and poll some laymen?


http://www.pandasthumb.org/archive....t-67514

The reason I didn't tell you my particular morality before was that it wasn't important. Yours is equally valid. I thought you were saying that making polital economic decisions requires an academic understanding of economics. I work for that big bad gov't and I can tell you first hand that enough money can get a report that took me two years of research to create buried. Fisheries are an economic area where there is a lot of money to be made. I am an expert in that area and I can tell you we done raped the sea. Most of the fisheries we have left are heading toward the precipice. But have no fear! Farm raised salmon are here! Leaving behind a 12 mile swath of dead seafloor, breeding with native stock and weakening the genetic capacity to withstand certain obsticles to reproduction and many more lovely things that would take too long to explain. But economists are writing reports about how economic theory shows that our research doesn't matter. We are making political decisions at the request of 4 or 5 people with large financial risks at stake. The list goes on and on and on and on but those people are making moral decisions based on their morality. That is why they are buying the politicians. That seems right for them. Unfortunately for me (and this is where I leave my original point) one of them is worth a few million of me because I can't buy influence. I have to organize a group of people and petition and show our elected officials that I can get them elected through my unfunded PR efforts. That is an aside though. Of course there are tradeoffs. Of course economics is legitimate. But you don't need to know a whole lot about economics to make reasonable economic choices.

Date: 2006/01/27 21:05:13, Link
Author: BWE
Ok, raging bee told me that I'm offensive and I guess she had a right to feel that way because I did say some things about adherents to religion and she informed me that she took offense because she is a druid.

So, of course I appologized but that got me to thinking, There are some dividing lines that I use in my head but I don't really define them. I don't mind offending some folks at all but some folks I do wish I didn't offend. I realize that this is all too politically correct for my screen personality but it's more academic I guess than emotional.  

Assuming that I am entertaining myself with this childish behavior so I don't want to totally stop, where are the lines? I think that believing in "Magic" is somewhere in there maybe. I guess, another way to put this is where does the continuum of religion become "fundy" at which point I get to let loose?

Date: 2006/01/29 10:27:10, Link
Author: BWE
Hmmm. I guess I am thinking of a more nuanced issue.  Obviously personal attacks are mean, but there is a gray area- e.g. dembski? Dave Scot? But sometimes the only way to cope with an idea that floats so far out in the ether that grasping it is anti-productive is to point out why it is funny, or tragic or whatever. It seems like a lot of us take ourselves pretty seriously here and also most of the creationists etc. do too. So what is the role of humor, which can and often does include ridicule, mockery, sarcasm and etc.? I grew up waaaaay out in the boonies and ridicule was pretty common but it wasn't really intended to make you shut up, it was more intended to get you to laugh at yourself. For me this is easy, for people of different dispositions it is relatively hard. So here are just a few quick examples I found:


http://www.pandasthumb.org/archive....t-75733
My point in linking to my other post ( http://brainwashedgod.blogspot.com/2005....in.html ) is that I and many others are simply mentally masturbating, following unwarranted assumptions to forgone conclusions and congratulating ourselves on our cleverness. (re: the link to the politics ignoring facts etc. article http://www.livescience.com/othernews/060124_political_decisions.html ) I am worse about this than many of the thoughtful people here but there is a general undertone.

In no way am I saying that the scientific method is biased to forgone conclusions but people, in defending their “side” apparrently are. I didn’t realize that I was actually getting off on it. I supose I subconsciously knew because I mostly comment to amuse myself but that particular comment was a doosie. Jeez that was like having Sarah Jessica Parker and Agelina Jolie together, y’know?



http://www.pandasthumb.org/archive....t-76222
Bury your head in your ass if you wish. Just do not expect people here to agree with you burying their children’s heads the same way; Especially at taxpayers expense.

http://www.pandasthumb.org/archive....t-75874
Great analysis. Had creationists any honor, they would be embarrassed to be part of such a movement.

http://www.pandasthumb.org/archive....t-75757
But, that aside, I’d really like to see/hear/otherwise be given the details of this little get-together. I suppose you should invite some creationists to an equally rigged “debate” similar to the ones they have, and then ridicule them when they won’t show, though.
You know, just to use language they understand. I’m not bitter or anything.

http://www.pandasthumb.org/archive....t-75820
Ha ha ha ha ha ha ha haaaaa…. Are you part of Larry’s crack legal team?
You can’t file suit until the policies are actually drawn up and codified. Duh.

http://www.pandasthumb.org/archive....t-75570
Yes, I think we will see more “naked” creationism. Whereas the KKK, errr, CCC over in Kansas invited B.Dembski to represent intelligent design, the CCC over here in Davis, CA, invited Reasons To Believe (www.reasons.org) to present their “testable creation model.” This model, however, was a list of metaphors and predictions (some of which were identical to those made by evolution) for “testing” the bible. They literally said that they can put gOD in a test tube!

Date: 2006/01/31 06:38:56, Link
Author: BWE
So, I think I have demonstrated that many regular PT contributors use ridicule in their responses to creationist, er, non-scientific approaches to science. My question then is "Is this a good strategy?" I think it is. I think that someone who uses ridicule exposes themselves far more than one who simply debates. After all, if I say, "How stupid is it to think the sun revolves around the earth. Sheesh, only an idiot would think that. And then I were shown how the sun revolves around the earth, I would be more likely to shut up and learn facts the next time. So, by exposing ourselves this way, we are really forcing creationists, er, those advocating positions exactly contrary to the evidence, to show us why we are wrong or to shut up because they really are idiots (for lack of a better term).

If we could get them to admit that there is no substantial difference between what they are preaching as history and what david copperfield is doing, it could go a long way toward helping our entire society. And, at heart I'm just a big ol softy. I sort of want society to be able to use scientific knowledge to help us avoid catastrophe. (I'm developing a pretty glum outlook on our ability to solve some pressing enviromental challenges with a fundy viewpoint at the helm. That does not mean I am admitting to a political bias though.)

Date: 2006/01/31 06:55:36, Link
Author: BWE
Quote
guthrie
I suppose its all part of the simple fact that science is now completely integrated into scoeity, and societies attention has moved on.  I'm not that old, but looking back at the 20's through to 60's, there was a certain importance and awareness of science that to some extent seems to be lacking nowadays.  Old people, feel free to correct me if you like.  ;)


Y'know, I was thinking something like that myself. At the University of Washington in the 70's and 80's science departments were undergoing radical shifts.
Problems in the late 70's were mostly things like trying to get the grad students to stop growing psylocobe mushrooms in their offices and the like and by the 80's the problems were more like how to keep the undergrads from sneaking in in the evening and raping the grad students.

The insular world of science used to make pronouncements, sort of like papal bulls I guess. People would say ooh and ahhh. Now these pronouncements rarely show up in the newspapers because, if they come from universities, they are largely too complex, if they come from gov't agencies they are largely censored, and if they come from business they are largely technologically oriented.

/rant

Date: 2006/01/31 07:11:32, Link
Author: BWE
Maybe a sort of a good cop/bad cop routine. One side ridicules them and the other side says "don't let them ridicule you, show 'em your science and shut those loudmouths up. Let's go get 'em!  That was my basic point at Uncommon descent until they banned me for it.

Maybe we create two distinct organizations, one to ridicule (maybe: Scientists Concerned About Theology) and one to defend the torch of creationism, er, maverick scientists, (maybe: Scientists To Understand Prehistoric Intelligent Design). The 1st one offers up some damning ridicule and the second one answers the challenge by baiting dembskiites into putting their name on ridiculous statements like all the ones they make. Get the papers to print them and the ridicule will have done its job.

Date: 2006/01/31 09:54:58, Link
Author: BWE
And in a free society, those with dumb ideas should be mocked, no matter what political or religious office they hold.

Date: 2006/01/31 13:18:07, Link
Author: BWE
You say, mocking Dave Scott :)  :(  :D  :p  ;)  :0  :angry:

Date: 2006/01/31 13:41:35, Link
Author: BWE
And DS is a perfect example, his ideas are seriously good material for all the biting satirists out there to work with and, by constantly spewing those ideas, the man himself becomes the target. It's like he's painting it there. For example, answer me this, Does he beleive he is right?
Now answer this: What does he believe?
Now answer this: Doesn't it get you off, just a little bit, to poke some fun at him?
Now answer this: What is more important than getting off on doing something?
Nope. Not that. :p :angry:  ???   :(  :0  ;)  :)  :p  :D

Date: 2006/01/31 21:13:25, Link
Author: BWE
Funny how faced with the adversity of religious schooling, some minds grow quite strong and with powerful bs detectors while others go all jellyfish.

(Please don't tell me how public schools do this, it's not the same)

Date: 2006/02/01 09:53:46, Link
Author: BWE
http://www.pandasthumb.org/archive....t-76819
Quote
From this point forward, there will be no new views of the universe. The ultimate answer from this point forward will be “We don’t understand, so it must be something that God intended.”

Sounds like something the Taliban would have loved.

Date: 2006/02/07 10:52:00, Link
Author: BWE
Darwin was wrong when he claimed (without proof) that jesus never lived and that god had no part to play in the creation of man. How bout that?

Date: 2006/02/09 05:48:59, Link
Author: BWE
#

The only beautiful liberal women are concentrated in Hollywood and they are mostly dumb as a box of rocks.

Comment by John Davison — February 9, 2006 @ 9:13 am

-I didn't know where to post this but he just insulted my wife! She lives in Oregon.

Date: 2006/02/09 18:08:47, Link
Author: BWE
I should think you'd enjoy artist's little ramblings. Somebody over there has already accused him of satire.   ;)

Date: 2006/02/09 18:18:14, Link
Author: BWE
Here is the thread that inspired artist to make his (or I thought of artist as a her) debut. Look at the replies she got.
http://www.uncommondescent.com/index.php/archives/747#comments

especially see 11, 26 and 30

http://www.uncommondescent.com/index.php/archives/798#comments
see comment 15

Date: 2006/02/09 19:56:26, Link
Author: BWE
He has to know. If Dave Scott knows, then Dembski knows. But it's sometimes fun to fight on the losing side. Especially if you make a couple hundred bucks an hour doing it. ???

Date: 2006/02/10 12:52:49, Link
Author: BWE
Sanctum you slander me! (Not in the way that actually offends me)

When have I ever attacked anyone for their belief in god? Is that your perception of me? Someone who indiscriminately hurls insults?

I have a deep spiritual sense and I totally understand AIT's position. I don't happen to feel the need for god to provide me with anything, let alone faith. Faith seems pretty removed from god for me. It's like having faith in red or something.

Regardless, faith is fine but ID is duplicitous and has the potential to seriously undermine science education and, for that matter, education in general. Religion as in the church is on pretty shaky ground with me because institutions dedicated to god, er, it's like intitutions dedicated to red. Or blue I suppose. The problem is when the institution becomes dedicated to Red, Blue and White that I begin to get worried. The trick is to abstract god away from those who claim to speak for him/her/it (I liked that touch). That's the trick for me anyway. But you do what you want. Just please don't tell people that science is ruining society because at this point, at however many billion people Earth now supports, it's all we've got.

Date: 2006/02/11 05:55:13, Link
Author: BWE
Hmmm. I remember one where raging bee was on one side raging and budda (sic) on the other side obstinating but I don't remember the religion comment that got it started.

Stevestory, I didn't exactly understand what artist was saying in the last post there but I did catch this part:
Quote
It's possible that you already have meaning or that you are happy with simply fulfilling your duty to our species' DNA. Good. That's not me.


So in defense, it's a little possible that you took offense where none was intended. However,

Artist, what was that about about Pascal's wager? You must understand that fundementalist religions are the ones behind the push to teach ID in schools.

I think you are saying that people shouldn't be so upset about intelligent design because what better explanation for god do they have? If that is all you are saying when you boil it down, then you should know that it isn't the idea of ID that upsets scientists, it is the attempt to inject bad and unworkable information into public school science curriculum. ID as a philosphical treatise is on pretty much the same footing as any other philosophy and as science it is on the same footing as any other science. THere is a little different burden on science. Hypotheses typically aren't what gets printed in science. You have to do some work first before you get to teach it to public school students. I am not a PhD or any heavy duty expert, but I have discovered that I have the capacity to point out the flaws in Every SIngle scientific argument the IDers come up with. That being the case, I have to conclude that it isn't very scientific.

I left a whole side of me exposed there, let's see how we deal with it. :)

Date: 2006/02/13 13:10:55, Link
Author: BWE
Quote
Maybe we create two distinct organizations, one to ridicule (maybe: Scientists Concerned About Theology) and one to defend the torch of creationism, er, maverick scientists, (maybe: Scientists To Understand Prehistoric Intelligent Design).

Did anybody get these acronyms? Darn, I thought I was off to a good start.

Date: 2006/02/14 05:14:46, Link
Author: BWE
Can you come up with a better one? Maybe SLAP or ONETWO or ENGUARDE or something?

Date: 2006/02/14 10:26:25, Link
Author: BWE
Quote
Somebody ought to tell the truth about the Bible. The preachers dare not, because they would be driven from their pulpits. Professors in colleges dare not, because they would lose their salaries. Politicians dare not. They would be defeated. Editors dare not. They would lose subscribers. Merchants dare not, because they might lose customers. Men of fashion dare not, fearing that they would lose caste. Even clerks dare not, because they might be discharged. And so I thought I would do it myself.

There are many millions of people who believe the Bible to be the inspired word of God -- millions who think that this book is staff and guide, counselor and consoler; that it fills the present with peace and the future with hope -- millions who believe that it is the fountain of law, Justice and mercy, and that to its wise and benign teachings the world is indebted for its liberty, wealth and civilization -- millions who imagine that this book is a revelation from the wisdom and love of God to the brain and heart of man -- millions who regard this book as a torch that conquers the darkness of death, and pours its radiance on another world -- a world without a tear.

They forget its ignorance and savagery, its hatred of liberty, its religious persecution; they remember heaven, but they forget the dungeon of eternal pain. They forget that it imprisons the brain and corrupts the heart. They forget that it is the enemy of intellectual freedom. Liberty is my religion. Liberty of hand and brain -- of thought and labor, liberty is a word hated by kings -- loathed by popes. It is a word that shatters thrones and altars -- that leaves the crowned without subjects, and the outstretched hand of superstition without alms. Liberty is the blossom and fruit of justice -- the perfume of mercy. Liberty is the seed and soil, the air and light, the dew and rain of progress, love and joy.

http://www.infidels.org/library....le.html

Wow, the rest is worth a read. Carol, if you read this post, you should follow this link.

My favorite rant on the stupidity of religious faithful and religion in general is Philip Wylie's "The Magic Animal".

Thanks for the tip on R.I.

Date: 2006/02/14 10:56:20, Link
Author: BWE
Mr. Christopher, I was inspired to add your comment above to  my blog.

Since I did it without your express permission I give my appologies and editing rights to you if you feel I have misrepresented you.

BWE :)

Date: 2006/02/14 14:31:15, Link
Author: BWE
And, good education helps too. That is why the YEC/ID/dumbfolks are after science. They can keep Letters From the Earth and Robert Ingersol out of most classes on religious grounds but science utterly shatters any possible hope you might find in salvaging biblical literalism and thus church (as an organization) power and relevancy and you can't take it out on religious grounds.  :0

Date: 2006/02/15 06:39:52, Link
Author: BWE
Quote
Stop and think it over
Try and put yourself in my unique position
If I get stoned and sing all night long
It's a family tradition!


Maybe that's a poor translation of old hebrew?
Can you hear the Kareoke machine warming up?

Date: 2006/02/15 07:00:17, Link
Author: BWE
Ok, ok ok ok ok ok. This has become strange. Just throwing my 2 shillings worth here but, does anybody care whether the hebrew creation myth is coincidentally, semi in agreement with our new understanding of the world garnered through observation and evidence? Religion has been shattered and the pieces are laying around writing about how they are still relevant as shattered pieces. I mean, I consider it an act of pity to allow people who desperately cling to the ideas of zeus, horus, jesus, yaweh, mohammed, krsna, tlketklotl, and the like to speak their minds about these utterly and totally defunct political/creation myths. Someday, I plan to put a Caananite bone up on my mantle as a religious relic. As soon as someone finds one.

Mind you I am not knocking religion here, it's just that well, you know, I am more interested in what Carol does with her new improved and ever so much more accurate translation of her historical artifact and curiosity.

Do you believe in the god of your particular regional deity?

Date: 2006/02/15 07:26:23, Link
Author: BWE
The big bang thread got me thinking bout all the fun I have reading books that comment on religion and books that comment on science although not usually in the same book, the exeption being "the god gene". I read a lot of super dry science stuff for work and I don't much like it but I very much liked "the tao of Physics" and bill bryson's "a short history of nearly everything", "God's Equation" about Einstein, The age of Scurvy, "Emergence" by steven johnson (i think) and etc.

I listed a bunch of religion books and essays on my blog where it is easier to make links.
http://brainwashedgod.blogspot.com

If you are interested in helping compile a reading list or offering opinions on books mentioned, feel free to comment here or there.

I will make a more comprehensive list soon. I am curious how many people have read the same books and how many people liked the same things.

I think this is relevant to the evo/creo debate because much of the controversy hinges on education and education levels of those involved. I think maybe any ID leaning lurkers might want to know what kinds of books we science leaning folks have been reading and vice versa if at all possible. If nothing else, I hope to get a few good titles to read.
In Mr Christopher's own words:
Quote


Posted: Feb. 14 2006,18:15  
Quote (BWE @ Feb. 14 2006,16:56)
Mr. Christopher, I was inspired to add your comment above to  my blog.

Since I did it without your express permission I give my appologies and editing rights to you if you feel I have misrepresented you.

BWE :)

BWE, I am flattered my comments made an impression on you.  Feel free to quote me anytime.

I think there is some irony here somewhere.  Is there anyone on earth who started doubting their faith only after they read some Darwin or Stevie Gould?  I doubt it.  I think the creationists give Darwin/evolution far too much credit.

Initially I rejected my former faith on pure moral and common sense grounds and it was years later that I would read up on evolution.  Evolution did not provide a foundation for my lack of faith nor did it (or does it) contribute to my current lack of faith.  I think this is probably true for most folks.

Contrary to what the creationists believe the seeds of doubt do not need to be nourished by some biological theory or fact (and anyone who pins their faith on IC and mouse trap analagies is a fool to be sure).  All it takes to lose ones faith is a little common sense and the desire to ask oneself uncomfortable questions.

Date: 2006/02/15 07:56:07, Link
Author: BWE
Is it a problem that Carol is trying to sell her book? I would like to see people read my blog after I publish here but I still try to say something relevant because I am also interested in what goes on with the particular issue of religious types trying to get their religions into public schools.

If Carol offers something to the debate like "Even though the Bible doesn't seem to make explicit statements regarding a young earth etc. it still shouldn't be taught in public schools as anything other than a regional oral history of a tribe of wandering people." or something like that on one side, or maybe "We should teach genesis with my translation because it accurately represents the state of the world as we now know it to be." on the other, then she too would be contributing. I think arguing over her translation is sort of secondary.

Maybe I'll make a post at my blog:
http://brainwashedgod.blogspot.com
what do you think?

Date: 2006/02/15 09:28:49, Link
Author: BWE
I wonder if the new toads are really, "New and Improved" in all their important freatures.

Date: 2006/02/15 09:47:38, Link
Author: BWE
Answer me truthfully, did you stop reading Hawking when he got to imaginary time? I consider myself reasonably intelligent but this is no layman's book. It was just too much work to keep reading and so I stopped.

I forgot to add
Botony of Desire Near the top of my all time favorite list.

Date: 2006/02/15 10:40:41, Link
Author: BWE
PZ Meyers just posted this over at pandas thumb. I wonder... Notice how you never see the two of us in the same place?

However,

Notice that these criteria are for books about science and god. I fixed the link to my blog above but what I want to find are Good Books. Ones you liked and that others may like  about 2 subjects that I enjoy, science and god. I got a science degree but, frankly, the real stuff is usually written by folks who are trying to teach. I like learning as a byproduct of reading but I like to be entertained even more.

So, Here are my god/spirituality books:

Robert ingersol (the author)
Full Text:
http://www.infidels.org/library/historical/robert_ingersoll/

Eric Hoffer's "The True Believer"
Amazon link:
http://www.amazon.com/gp....=283155

Dean Hamer's "The God Gene"
Amazon Link:
http://www.amazon.com/gp....ng=UTF8

Thoreau's "Walden"
Amazon link:
http://www.amazon.com/gp....=283155

William Blake's "The Marrage of Heaven and ####"
Full Text:
http://www.levity.com/alchemy/blake_ma.html

Mark Twain's "Letters From the Earth"
Full text:
http://www.sacred-texts.com/aor/twain/letearth.htm

Philip Wylie's "The Magic Animal"
Amazon Link:
http://www.amazon.com/gp....ng=UTF8

Ken Wilbur's "A Brief History of Everything"
Amazon Link:
http://www.amazon.com/gp....=283155

the 9 insights from
James Redfield's "The Celesine Prophesy"
(Notice I didn't say I enjoyed the book)
Text for the 9 insights:
http://homestar.org/bryannan/celistin.html

I thoroughly enjoyed all of the above.
And I already mentioned the sciency books above although there are at least a dozen more which I will post after I get home and look at my bookshelf.

Salut!

Date: 2006/02/16 06:52:55, Link
Author: BWE
Singularities aside, I forgot another one of my favorites:
Carl Sagan's  The Demon Haunted World: Science as a Candle in the Dark

I just picked up Brian Green at the library but I have to finish Kite Runner first. Hopefully I wont have to renew Green.

I forgot about fiction too. Precious few fiction works would make this list I think but

City of God By E.L. Doctorow would definitely make the list. OMG it's good. A little "Artsy" in the fashion of maybe Joyce or Hemmingway but truly incredible read.

Date: 2006/02/16 12:37:00, Link
Author: BWE
Quote
If I understand the Christian fundamentalist perspective at all, the presumption is that anything that fails to promote their religion, is actively engaged (by dint of that very failure) in disputing their religion. If you're not for us, you are against us.

No scientific theory ever has or ever can require anything supernatural. If something is observed, the mechanisms for which nobody has the slightest clue about, the best science can do is admit bone ignorance (and start investigating). If there ARE magical forces undetectable in principle, science must forever remain baffled.
And, don't you think that it would stand out? I mean, "yeah, there's this one thing. Over on Mt.Etna, the rocks roll uphill. We studied the heck out of it but nothing makes sense."


Quote
Most religions teach that a God built all of the stuff in the universe living and not living. Evolution teaches that a God did not build life on earth. If life on earth is taught as being the product of purposeless blind chance instead of emotion laden eternal purpose, then in essence evolution is implying that there is no afterlife.

And that, said john, is that (A.A. Milne)

Date: 2006/02/17 05:17:53, Link
Author: BWE
How is Confederacy of Dunces? I have it on my shelf but haven't picked it up. Got it as a present.

Date: 2006/02/17 05:56:25, Link
Author: BWE
Quote
It’s finally clear why ID isn’t welcome among evolutionary biologists: the study of narratives provides no clue to the engineering problems that biological systems pose.

http://www.uncommondescent.com/index.php/archives/829

Ok. Well now. Glad that's been cleared up. Next is the people vs Ralph nader. Bailiff?

Date: 2006/02/17 06:11:29, Link
Author: BWE
Quote
#

Forgive my denseness, but why does pointing a gun in my face constitute “terms that I’ll understand”?

Along these lines, I’m growing increasingly concerned about the stuff that gets posted here: this, referring to the ACLU as “terrorists,” or complaining about the rules employed by the Panda’s Thumb webmaster. If they fix the trackbacks to your satisfaction, is that going to advance the cause of ID? Is this the kind of stuff I need to know about if I’m to understand ID? -sb

Comment by SteveB — February 17, 2006 @ 8:41 am

http://www.uncommondescent.com/index.php/archives/829

Well done.

Date: 2006/02/17 06:29:42, Link
Author: BWE
Oh he knows all right:
Right Here

Date: 2006/02/17 06:38:55, Link
Author: BWE
I broke my ankle falling off a boat in Astoria Oregon last October. I decided to start a blog since I was laid up and out of work for a while.

http://brainwashedgod.blogspot.com

I found Pharyngula because PZ had put up pics of the giant squid!!! and it took me to PT. Since it was semi-relevant to my blog and since it is nominally related to my work (Fisheries) I lurked for a day or two. Since there seemed to be no punishment for posting, and since I can't really control my urge to speak, even when I have nothing to say, I posted something.

Now I'm back at work but I work about half the time from home so I have a lot of time to post and, until they (PT) make me stop, I will probably keep posting.

Date: 2006/02/17 11:43:12, Link
Author: BWE
Woudn'tcha think they woud've tried to feed one of the buggers to a real toad before they sent out the toads?

Date: 2006/02/22 10:56:48, Link
Author: BWE
Read "The $800million pill"

(Shiver)

It's a pretty jaded world out there. Lots of opportunity for someone young and ambitious :0

Date: 2006/02/22 15:41:35, Link
Author: BWE
Quote
#

What is the role of natural selection? Sexual selection? ANy kind of selection? Is speciation the result of “Natural” processes allowed through “front loading”? It seems to me that e=mc2 is front loading. If the designer (I prefer to say God although I know that many of you do not) simply wrote the equations and let it all fly, where does that leave this debate? Where is the controversy? I know that we have something separate and distinct called “spirit”. Are you making the case that spirit is the result of e=mc2, or that God created life distinctly?

I am quite confused by now. It would seem like teeth in a chicken is somewhat off the mark.

Comment by Artist in training — February 22, 2006 @ 7:34 pm
#

It appears that science and religion are indeed on separate playing fields. I may have to examine my specific understanding of the Bible in light of evidence provided by scientific research but I find myself utterly unable to figure out what you are trying to convey.

Comment by Artist in training — February 22, 2006 @ 7:41 pm
#

Is the point that the info pre-existed? Then you get different shuffles and some of that info, previously hidden, comes to the fore?

A loss of info or hidden info and not new information from random mutation?

Or am I missing the point?

Comment by geoffrobinson — February 22, 2006 @ 8:43 pm


Hoo boy. This is the chickens with teeth thread. Do you think DS will reply?

Date: 2006/02/23 07:31:51, Link
Author: BWE
Yep, those comments are gone from the chicken's tooth thread. DS just couldn't handle it I guess.

Date: 2006/02/23 07:41:25, Link
Author: BWE
Quote (BWE @ Feb. 22 2006,21:41)
Quote
#

What is the role of natural selection? Sexual selection? ANy kind of selection? Is speciation the result of “Natural” processes allowed through “front loading”? It seems to me that e=mc2 is front loading. If the designer (I prefer to say God although I know that many of you do not) simply wrote the equations and let it all fly, where does that leave this debate? Where is the controversy? I know that we have something separate and distinct called “spirit”. Are you making the case that spirit is the result of e=mc2, or that God created life distinctly?

I am quite confused by now. It would seem like teeth in a chicken is somewhat off the mark.

Comment by Artist in training — February 22, 2006 @ 7:34 pm
#

It appears that science and religion are indeed on separate playing fields. I may have to examine my specific understanding of the Bible in light of evidence provided by scientific research but I find myself utterly unable to figure out what you are trying to convey.

Comment by Artist in training — February 22, 2006 @ 7:41 pm
#

Is the point that the info pre-existed? Then you get different shuffles and some of that info, previously hidden, comes to the fore?

A loss of info or hidden info and not new information from random mutation?

Or am I missing the point?

Comment by geoffrobinson — February 22, 2006 @ 8:43 pm
these

Hoo boy. This is the chickens with teeth thread. Do you think DS will reply?

Date: 2006/02/23 07:44:33, Link
Author: BWE
And don't forget to read my blog

http://brainwashedgod.blogspot.com

:D  :p

Date: 2006/02/23 11:03:59, Link
Author: BWE
This does appear to be getting closer to the agenda. Culture War. FU( K him. I bet I could Kick his a$$. I sure would like to. Bastard.

Date: 2006/02/24 09:56:19, Link
Author: BWE
LOL :D

Date: 2006/02/24 13:57:19, Link
Author: BWE
Sheesh, I guess some people just have too much fun.
http://www.pandasthumb.org/archive....t-82087

Raging Bee, I love to discuss where the lines between us and them are. Cause them's the rat bastards and us'r the good guys. So let'r fly. Tell me how it is. I really like you so I can take it. I promise. ;)

Date: 2006/02/27 06:03:07, Link
Author: BWE
I caught that one this morning too and I posted it over at pandas thumb "I do not think that word means..." (My all time favorite movie. Shoulda looked here first I guess. My favorite quote:
Quote
It is yet another example of how the Times often seems incapable of fairly addressing both sides of a controversial issue. Some of the Times' articles have asserted that intelligent design is "not science" and have suggested that it is basically "creationism" under a different name. Both propositions are simply false. (See readings below.)


One side claimes that liquid will stratify according to density and one side claims that it won't. Both propositions are simply false. ;)

http://newsbusters.org/node/4200

I also liked this one from the same site

Date: 2006/02/27 11:18:11, Link
Author: BWE
Billy doesn't debate "your" topics. :D

Date: 2006/02/27 11:36:13, Link
Author: BWE
http://www.jeffgannon.com/

OMG is this for real? anyone know?

Date: 2006/03/02 05:48:12, Link
Author: BWE
I think it's the money for Dembski. He throws too many insults to be sincere.

Behe is a different story. He testified. I assume that the "ever more sophisticated rationalizations" theory is probably correct. I wonder at what point you reach the answer that Russell did where the answer is "there is no point."?

What is the final realization, the point of enlightenment where you realize that it's a bunch of crap fabricated from whole cloth? What individual piece of information pushes the highly sophisticated rationonalizer over the edge to the place where they can no longer rationalize?

Date: 2006/03/02 05:57:00, Link
Author: BWE
I believe the term is "barking mad". (as in screw loose)

Date: 2006/03/02 12:14:55, Link
Author: BWE
Nicholas Tesla comes to mind.

Date: 2006/03/06 09:04:06, Link
Author: BWE
Quote
Oh no, humanistic religion! That's the kind of vile filth that spawned the constitution and individual rights. Damned Erasmus.

Folly got us this far, no telling where she leads.

I made a post on my blog about christian exodus a while back. They aren't looking too busy these days. No tally how many have made it etc. One thing though, I've heard Christians are cannibals who routinely use human sacrifice to appease their god. That ought to limit the population if they all go to one place.
:0

Date: 2006/03/06 09:07:49, Link
Author: BWE
Quote
This is what we over here call "humour".


Hmmm. America. We took the "U" out of humor.

Of course, We also took the "U" out of labor.

Date: 2006/03/06 11:21:51, Link
Author: BWE
I bet those 700 are quite a bunch.

Date: 2006/03/06 13:04:43, Link
Author: BWE
Reading through the PT pages, you occasionally get a nutjob with his (Invariably his; why is that?) stupidfucking christian blog listed. Regular readers of PT learn to spot them right away. Today's post "Dan Ely’s colleagues take down his Kansas testimony" made me mad and I posted this:
Quote
Posted by BWE on March 6, 2006 04:20 PM (e)

Once again, we are brought round to the elephant. Religion makes people nuts. k.e. put it rather succinctly this time:

   Seriously don’t you think that over pandering to postmodernist “equal time for kooky ideas” is why this whole thing is such a big problem.

   It is almost as though everyone is treating each other as though they were over emotionally sensitive babies.

   There probably is a history behind the letter and there does seem to be a sense of frustration, but their professional reputations are at stake as well.

   Daddy what did you do in the culture wars ?

I’m sorry Raging Bee, but religion is nutty- and it’s OK to say that. It creates jobs out of lies, death out of truth and a wastland of peace. I don’t know anything better but goddamn, I’d be pissed too if I were the other faculty. I wouldn’t want to just brush him off, I’d want to cut him off at the knees.

I know that this is totally antithetical to our western society and that it is also sort of a catholic church to galileo kind of thing with that same potential but where does it stop? The Earth IS round. The Earth DOES go round the sun. The Earth IS ~4.5billion years old. Some #### force bends light around celestial bodies. God is not anything that anyone has ever said god is and religion is absolutely nothing more than human attemopts to explain things. No one has EVER “talked” to god. NEVER. And these nutjobs get up and try to tell us that we need to believe a pile of crap and we, for fear of being insensitive or politically incorrect, say, “Well, that is one way to look at it.” When in fact it is the way a brainwashed nutcase would look at it.
/rant


I thought to myself, whoo! How could I say such an inflamitory thing? But then, I realized that, no matter how sensitive I could make myself (like imagining saving a fundy's life for example) I just couldn't feel sorry for what I said.

Then, on another thread, How to disprove evolution This guy called "seeker" makes a boneheaded comment and I realized that I could guess an aweful lot about the guy by his comment. I looked at his blog and, sure enough, I could.
http://www.twoorthree.net/

Which brings me to this question: Is this just me or do you get the same thing?

Date: 2006/03/06 17:48:44, Link
Author: BWE
Oops. I pasted two different things into that.

The question is, can you guess the whole party line from one or two sentences with any regularity?

Pardon the other part. I had a heckuva day.  But what a rant it is with all of that together. I was stuck all day in a coffeeshop with wireless and this laptop with a broken-down stupid Government pickup in the beautiful cold, wet, windy town of seaside almost two hours from where I live wondering If I was going to need to get a hotel and not even having a partner to talk to. you're all lucky I didn't post a few chapters. I'm home now. I'm warm. I have cocoa. Sorry.

Date: 2006/03/10 07:14:34, Link
Author: BWE
OK, I understand. But really, Andy/whoever does perform a function sometimes. He spits out the party line and, when he's on topic, gives those who wish to a chance to point out how ignorant the party line is. Readers who don't comment who might be on the fence can see who the people are they might side with. I personally think that keeping a lighthearted attitude towards Andy/farflungdung/whoever helps the whole PT community by illustrating the whole us/them point. I know that us/them is the black and the white but seriously, how long can you stay in the area occupied by the slash?

Date: 2006/03/10 07:20:02, Link
Author: BWE
Used to be an ex-fundy? Double negative. But surely you haven't reverted to the fundy way of life have you?

Date: 2006/03/10 12:41:03, Link
Author: BWE
I had some good, on topic posts and they are neither here nor there. But, Arden, make it a game. See what you can get away with! THese musings on the subject are not limited to practicing research scientists. (Maybe you are one). They are reactions and thoughts on the subjects at hand as well as the global subject of the fundementalist attack on the "educated intelligent class of people". So if you want to get back at him, tease him, don't go away mad. Try to stay nominally on topic but look through the historical postings. If you took OT posts out many threads would have no posts at all. It is a broad topic and peevish behavior is to be expected from anyone from time to time.

Too many thoughts! Sorry that was so rambling but I hope you got my point. ???

Date: 2006/03/10 13:45:41, Link
Author: BWE
Thordaddy, I could kiss you.
Quote
Your rant shows a very ugly side of science.  A side that believes it is protecting some kind of dogma.  You can't protect science.  It is but a method that has evolved with time and will continue to evolve.  You can't stop it.  Don't be naive in believing that science is completely objective while scientists regularly toy with concepts like "observation," empirical evidence and the like.

First, his rant is not showing an ugly side of science. It is showing an angry side of Renier.
Second, It is but a method that has evolved over time??? Are you really that stupid? Look, you can have your kooky views of Jesus playing poker with his father and the Holy Ghost while Satan and Gabriel take bets on the winner. Keep them. I suspect you know that they are utterly ridiculous. If not, read This or This or, if you can bend your brain around analogy, this.
but how is it that you are saying anything in that statement?

Third: "Don't be naive in believing that science is completely objective while scientists regularly toy with concepts like "observation," empirical evidence and the like."- You mean like the voices in your head "toy" with you? :0

Date: 2006/03/10 18:36:27, Link
Author: BWE
Wesley,
Quote
There seem to be some conflicting ideas of what the comments on PT posts are there for. Most contributors think that the comments are for others to reflect upon the post and put in some substantive commentary, adding to what is there or bringing up serious considerations and critique of the content of the post.

There aren't a lot of posts that don't meet this criteria. You can't blame people for what they think is substance. Since it's OK to be Off-Topic here on the Bathroom Wall, I am going to ask you a question: what is the point of this blog? Is it an educational forum with serious entries or is there a sort of lighthearted side to it? I can think of a lot of posts that are just plain funny and have very little if any redeeming science or legal value. There is a lot of nuance to the global subject and the gray area is exceptionally hard to define. (Ask Raging Bee who makes very odd remarks here but publishes a pretty good blog of her own).

If people can't use laser-like accuracy in their comments it may be for several reasons, time constraints, knowledge level, elloquence at the moment etc. but they -we - really are discussing the topics, albeit sometimes in a roundabout way. This global subject has different meanings for different people and That's why we post comments.

I personally have a strange fascination with fundies ever since a bunch of them broke some equipment I was using. Weirdest thing but when confronted their lack of neurons was utterly astounding. They were doing gods work.

For whatever reason people comment they are contributing to the debate. You could always try to go to a slashdot kind of system but your impartiality is a pretty stark contrast to uncommon descent and people can see that. It is always better to be on the side of intellectual honesty and that is a major theme of this blog. Or am I missing the point entirely?

Would you prefer that I don't share my thoughts and opinions on PT? How about Arden? Lenny? k.e.? Or do we contribute in some way?

How about you Steve Reuland? What would you like to see?

I am not in a snit. I seriously wonder. I might have missed the mark when I first found this blog. It wouldn't be the first time. But I do have a serious interest in the topics and  I am a little irrepressable so I post comments.

Date: 2006/03/10 19:27:08, Link
Author: BWE
Wesley,
Well said. (deep bow)
Thank you.

(and I meant comments) :)

So, what about the "friends" post? And Andy/////whoever?
I'm just wondering what you think. You mentioned "troll like behavior" and I wonder what you think of their value. Are they the guy at the beginning of the tax hearing or is the tax hearing a bad analogy?

Date: 2006/03/10 20:02:52, Link
Author: BWE
I am a longstanding member of that church. I joined when I was just a wee child. Ah. Those were the days. THe church of irrelevance, snickering at everyone, barbecues... where we would pray to satan and cook up the local christians to eat. I didn't like the hindus much but I can tell you that the muslims were good with butter. But christians were the best. mmmm. I've heard that to find good muslim you really need to go to the middle east.

Date: 2006/03/22 08:04:22, Link
Author: BWE
AAAAAAAAHHHH!!
http://www.uncommondescent.com/index.php/archives/939

I'm not qualified to speak about anything but I pretend to be on the internet. :(

Quote
Of course, they say, I have no degree in meteorology and I am therefore not qualified to speak...

Genetic engineering, once it gets into the hands of housewives and children, will give us an explosion of diversity of new living creatures, rather than the monoculture crops that the big corporations prefer. Designing genomes will be a personal thing, a new art-form as creative as painting or sculpture. Few of the new creations will be masterpieces, but all will bring joy to their creators and variety to our fauna and flora...

I am telling you that misfortunes are on the way. Your precious Ph.D., or whichever degree you went through long years of hard work to acquire, may be worth less than you think. Your specialized training may become obsolete. You may find yourself over-qualified for the available jobs. You may be declared redundant. The country and the culture to which you belong may move far away from the mainstream. But these misfortunes are also opportunities. It is always open to you to join the heretics and find another way to make a living. With or without a Ph.D., there are big and important problems for you to solve.

:0  :0  :0

Hardly ever post here because it seems too easy of a target but with the "This is what we're up against" posts over at PT I have become incredulous again. Does wonders for your soul.

Date: 2006/03/23 05:59:50, Link
Author: BWE
over at Unbecoming Dick-scent I am made a minor celebrity.

Quote
#

I think people are just WAY too sensitive! The world will not come to an end as a result of showing a bunch of public elementary school kids a performance of Faust. Nor will it come to an end as a result of acknowledging to them the fact that Christmas is the holiday on which Christians celebrate the birth of Jesus Christ. What worries me are all the knee-jerk reactionary wackos out there who file lawsuits and get people fired from their jobs at the slightest whim!

Neither will the world come to an end by grade school music teacher getting fired for making inappropriate curriculum decisions. What good is the right to terminate hires that don’t live up to expectations if you never exercise it? -ds

Comment by crandaddy — March 21, 2006 @ 7:40 pm
#

I was just slumming through that thread and found this:

“Christians, can’t live with em, can’t feed em to the lions anymore.”

It’s comment #88206 by BWE. I should also say that I looked pretty hard to find where this person was somehow reprimanded for it but couldn’t see that it was even acknowledged. Over here, we have no tolerance for attacks like that directed toward any faith.

I can hardly believe you wrote this immediately following a comment about people being overly sensitive. Non sequitur. -ds

Comment by crandaddy — March 21, 2006 @ 8:03 pm


http://www.uncommondescent.com/index.php/archives/936

I really like the spotlight. Do these shoes make me look fat?

Date: 2006/03/26 11:12:23, Link
Author: BWE
I was raised without official religion. I remember as a child filling in the name of my church in school documents. (In those days that was important information for the school, like your credit score is now). My mom told me the name of the church we went to, but it was a lie. We’d never been to church. I take that back. According to my parents, I was taken to church once when I was two. I screamed the whole time in nursery school or wherever they take babies who might scream, and the nice lady who probably also ran the potlucks and other church functions asked my parents not to bring me back.  And because that was a church close to home, the name of the church I was supposed to fill out was far away. One that none of the other kids in the school probably went to.

That was my first impression of religion; something you needed to tell people you did because they expected it of you. Not because you really did it. Religion is about filling in boxes.

I knew two families with kids who were Christian. I just figured it was their flavor of insanity and didn’t think much of it. I guess I figured it was harmless. The only two times it ever entered my life were when my dad asked one of the neighbor kids if Jesus or Superman was stronger and when my other Christian friend and I read his Christian comic books up in his room.  In hindsight, those were both pretty funny experiences.  Riding home in the backseat of our Oldsmobile station wagon- the great big kind from the late sixties/ early seventies- and seven year old Billy was talking about Jesus.  My dad asked him who was stronger, Jesus or Superman. Billy immediately answered “Jesus”.  My dad responded, “but Superman can fly”.  That stumped Billy. I wonder if he ever thought about that question again.
The other time, I stayed the night at my other Christian friend’s house. We read his Christian comics while he told me about god. The comics had the evil Satanists imbued with supernatural powers fueled by their blood sacrifices and so on pitted against the weak and lowly Christians who only had one power and it seemed like a pretty pathetic power to me.  They could call on Jesus when they were captured by the powerful Satanists and the Satanists would die. The Satanist had super strength from their god.  The Christians had squat. When I suggested to my friend that the Satanists seemed like they had the better deal, he replied, “but the Christians can kill the Satanists!” So the lesson I took away from that was avoiding Christians if you happen to be a Satanist. They want to kill you.  

And although in reflection I realize that many of my neighbors might have believed in god or even really been Christians I only knew two neighbors who actively went to church. Granted I lived in the country and neighbors were far apart, but still the bulk of the people I knew, the other kids that is, did not go to church and were not familiar with the elements of the Bible.

I did read the Bible, mostly because I was a kid who liked to read, but I never thought of it as anything other than fiction; old stories told by people who didn’t have the benefit of the modern experience- the understanding of planetary motions, particle physics and evolution.  I guess I really thought of religion as anachronistic.  One consequence of this was that my spiritual life was wholly made up by me. I contemplated the nature of the universe and the nature of time and the nature of existence based on my own observations, my own reading and my own feelings.  

Imagine my surprise when I got to college pursuing a science degree.

Date: 2006/03/26 12:21:45, Link
Author: BWE
Sanctum. Errr. Ha Ha?

It isn't enough to say, science is science. It must be said that religion is NOT science. At which point the fundies beat their wives for not being able to stretch $85 into two and a half weeks worth of groceries for the 8 kids and burn abortion clinics.

Date: 2006/04/07 10:05:03, Link
Author: BWE
Mr. Elliot,
If it is making you tired, you are taking it too seriously.

My advise? Go play frisbee with a dog for a while. It always seems to help.

Date: 2006/04/10 07:28:14, Link
Author: BWE
3 words for evolutionists:
Party at Dave Scot's house tonight! There will be nude girls dancing on glass tables and everyone will be white! :D

Date: 2006/04/10 08:23:27, Link
Author: BWE
As a subtopic of the Uncommon Scent thread started by SteveStory and a little trend I've been noticing in opinion pieces on ID in various news sources.

Have you noticed that when IDiots mention Galileo in their commentaries, the commentary is typically more wingnutty than normal?

I think a compilation of good quotes is in order, along with some nice commentary pointing out the IDiocy of the point of the story. Or, if the comparison is accurate, then you could point out why.

I'll go first:

Quote
The revolution of the sun and planets around the Earth was not an assumption, declared the pope of the day, but a well-established fact, and these dangerous meddlers were popularizing their nonsensical views among students, teachers, parents, administrators and policymakers. Galileo was compelled to recant his dangerous claims, and a little later died in comfortable retirement. (He was never persecuted, tortured and otherwise physically coerced, however, as later mythology would claim.)

Fast forward now to the late 20th and early 21st centuries. For more than 100 years the priests of our day, meaning the scientists, have cherished as incontrovertible fact the thesis that all the species of nature, man included, came about by accident. By an astonishing coincidence, the single cell appeared; by millions of further accidents, the cell evolved over countless generations into ourselves and what we see around us....

A government spokeswoman begged, very tentatively, to differ. There are phenomena, she said, "that may not be easily explained by current theories of evolution." After all, the scientific understanding of life "is not static. There's an evolution in the theory of evolution."

You wonder if this notably intrepid woman will go down in history. Like Galileo.

http://worldnetdaily.com/news/article.asp?ARTICLE_ID=49655

You notice how he calls scientists the "Priests"? DEo you think that the real priests might take some offense to that?

Date: 2006/04/10 12:29:07, Link
Author: BWE
ThorDaddy,

If I have 2 dozen abortions, and kill a few tens of thousand Iraqi's many of them women and children, and privatise the water supply in Peru-leading to thousands of deaths by disease, and stand by and watch as Rwandans kill each other solely because they don't have enough land and resources to feed them all, and execute a few political dissidents in China and release tons of poisonous gas in India-killing tens of thousands of men, women and children, and shoot a few abortion doctors along the way, does that mean your daughter isn't the same? Don't like abortion? Don't have one. Personally, My vasectomy has collapsed the possibilities of my future children. Is this terrible?

Sorry that you are hung up on religion, I understand the impediment that it causes but I can;t offer any help from inside the cloistered walls. Go outside, love your family, learn a few things about the world if you are determined to try to save it. But get the science right. That would start with understanding ecosystems to some degree. The Biology, chemistry, geography, and physics of the ecosystems would be a good place to start. But ... hmmm... Where did you go? Right in the middle of my first sentence, you turned around and walked away. ???

Date: 2006/04/10 12:40:43, Link
Author: BWE
Wow. Dembski has a policy that is similar to armageddon. Woo eee. I can't wait to be left behind. All those stupid ### ###### will be gone.

Date: 2006/04/10 14:28:56, Link
Author: BWE
Link Here
Cornell University to offer ID class

Quote
Cornell University, Ithaca, NY, April 9 – The Intelligent Design Evolution Awareness (IDEA) Club at Cornell would like to applaud Allen MacNeil, the Ecology and Evolutionary Biology (EEB) Department, and Cornell University on this summer’s new course, BioEE 467: “Evolution and Design: Is There Purpose in Nature?”

Five and a half months after President Rawlings’ State of the University address condemning intelligent design, this course is Cornell’s first to focus on the theory from a historical and scientific perspective. Based on books such as Dembski and Ruse’s Debating Design and Behe’s peer-reviewed Darwin’s Black Box, the course purports “to sort out the various issues at play, and to come to clarity on how those issues can be integrated into the perspective of the natural sciences as a whole.”

This four credit seminar course, taught by the EEB Senior Lecturer Allen MacNeil, will also take a broader look at the historical disputes surrounding evolution.

Date: 2006/04/10 14:31:55, Link
Author: BWE
Quote
CREDIT & GRADES: The course will be offered for 4 hours of credit, regardless of which course listing students choose to register for. Unless otherwise noted, course credit in BioEE 467/B&Soc 447 can be used to fulfill biology/science distribution requirements and Hist 415/S&TS 447 can be used to fulfill humanities distribution requirements (check with your college registrar's office for more information). Letter grades for this course will be based on the quality of written work on original research papers written by students, plus participation in class discussion.

http://evolutionlist.blogspot.com/

This has course info

Date: 2006/04/10 16:43:59, Link
Author: BWE
It's like using a high powered rifle and night vision goggles to hunt cows.

I could throw a bare hook in with no weight.

I know it's easy but I can't help myself. Maybe I should take up knitting.

Date: 2006/04/10 17:51:04, Link
Author: BWE
It's OK, the smell is still in the water.

Date: 2006/04/10 18:23:32, Link
Author: BWE
This Prof is an interesting bunch of guys. Read some of his other posts. :D

Date: 2006/04/10 18:59:05, Link
Author: BWE
Done.

Date: 2006/04/11 10:24:56, Link
Author: BWE
You never know. Might be worth Digging into the past of the professor. You know, find out how impartial he really is.

Date: 2006/04/11 13:21:59, Link
Author: BWE
God I love that word: yearning.

I am yearning for you baby,
Ohhhh Yeeah.
As a zygote I was yearning for you baby,
Ohhh Yeeah.

Oh I know there is a schizm
between the good guys and relativism
And somebody out there knows the truth
All lonely and aloof
But no one will listen
because its all just relativism

I am yearning for you baby,
Ohhhh Yeeah.
As a zygote I was yearning for you baby,
Ohhh Yeeah.

Who wants credibility?

Date: 2006/04/11 13:45:02, Link
Author: BWE
Quote
What's so controversial about saying if you get pregnant you must accept the responsibility to bring your child into this world to raise it or give up for adoption?  What is controversial about that societal notion?


I don't understand how guys think they should have a say at all. Women certainly aren't up in arms over vasectomies. I wonder why?

She who carried the baby has the say. Period. If we only let women vote on the issue that would be better. But then, should the other half of the irresponsible party be able to absolve his financial responsibilities?

Date: 2006/04/11 19:10:00, Link
Author: BWE
Hmmm. Doug does appear to be one of the faithful.

Date: 2006/04/11 19:14:56, Link
Author: BWE
Quote
The latest challenge to the neo-darwinian theory of evolution has come from the "intelligent design movement," spearheaded by the Discovery Institute in Seattle, WA. In this course, we will read extensively from authors on both sides of this debate, including Francisco Ayala, Michael Behe, Richard Dawkins, William Dembski, Phillip Johnson, Ernst Mayr, and Michael Ruse. Our intent will be to sort out the various issues at play, and to come to clarity on how those issues can be integrated into the perspective of the natural sciences as a whole.


And thank you for doing the good work. Out here in Oregon, we have measure 37. Different discipline, same problem.

http://www.oregon.gov/LCD/measure37.shtml

Date: 2006/04/11 19:45:24, Link
Author: BWE
Opines

Wailing and moaning she opines
How can I read something between the lines?

Thordaddy's told me how I've got to choose
And now I'm singin' the celibate blues

Cause even though he's a patent twit
I see a man but I want a ....

Date: 2006/04/11 19:49:54, Link
Author: BWE
A zygote I once was
Because my mommy had a buzz

Thordaddy, you are inspiring me. Will you kiss me?


Then engage in homosexual love with me?

Date: 2006/04/11 20:02:55, Link
Author: BWE
I was cloned
To a T
You see my pal
Looked just like me

My mother was a bunson burner
In an LA laboratory
Soon there will be more!
And they'll all look and act like me.

Daamn. I'm on a roll. Thordaddy, I know you like it. Why not just go with it?

Date: 2006/04/11 20:19:25, Link
Author: BWE
DAD:
There are Jews in the world.
There are Buddhists.
There are Hindus and Mormons, and then
There are those that follow Mohammed, but
I've never been one of them.

I'm a Roman Catholic,
And have been since before I was born,
And the one thing they say about Catholics is:
They'll take you as soon as you're warm.

You don't have to be a six-footer.
You don't have to have a great brain.
You don't have to have any clothes on. You're
A Catholic the moment Dad came,

Because

Every sperm is sacred.
Every sperm is great.
If a sperm is wasted,
God gets quite irate.

CHILDREN:
Every sperm is sacred.
Every sperm is great.
If a sperm is wasted,
God gets quite irate.


GIRL:
Let the heathen spill theirs
On the dusty ground.
God shall make them pay for
Each sperm that can't be found.

CHILDREN:
Every sperm is wanted.
Every sperm is good.
Every sperm is needed
In your neighbourhood.

MUM:
Hindu, Taoist, Mormon,
Spill theirs just anywhere,
But God loves those who treat their
Semen with more care.

MEN:
Every sperm is sacred.
Every sperm is great.
WOMEN:
If a sperm is wasted,...
CHILDREN:
...God get quite irate.

PRIEST:
Every sperm is sacred.
BRIDE and GROOM:
Every sperm is good.
NANNIES:
Every sperm is needed...
CARDINALS:
...In your neighbourhood!

CHILDREN:
Every sperm is useful.
Every sperm is fine.
FUNERAL CORTEGE:
God needs everybody's.
MOURNER #1:
Mine!
MOURNER #2:
And mine!
CORPSE:
And mine!

NUN:
Let the Pagan spill theirs
O'er mountain, hill, and plain.
HOLY STATUES:
God shall strike them down for
Each sperm that's spilt in vain.

EVERYONE:
Every sperm is sacred.
Every sperm is good.
Every sperm is needed
In your neighbourhood.

Every sperm is sacred.
Every sperm is great.
If a sperm is wasted,
God gets quite iraaaaaate! :D

Date: 2006/04/11 20:48:31, Link
Author: BWE
No. Because eggs are worth more to science. They'll maybe give you ten bucks to yank in a cup but they'll give a dame a couple grand to simply lay 'em an egg. :0

Date: 2006/04/12 05:56:53, Link
Author: BWE
Sir T, -10? I need a metric that is more consistent.

Quote
I don’t see how full acceptance of evolution is any more compromising than the acceptance of common descent in regards to Adam and Eve. The acceptance of evolution doesn’t put God out of the picture, if it did, I would share your concerns. What I posit is that God created us through intervention that occurred 13 billion years ago....

Dawkins isn’t the sharpest knife in the dishwasher. He is baiting Christians with false dichotomies to discredit them. He’s trying to convince us that evolution = atheism, and we should challenge him on that point, rather than accepting it. You are wrong in saying either they are right or we are right. Intelligent Design and natural abiogenesis can very well co-exist.

Comment by Paul Brand — April 12, 2006 @ 9:22 am

Link Here

So, united they ain't. I hope you guys are caching this stuff. I saw one about biology on the fetid fingers thread I think. It appears to be gone.

Date: 2006/04/13 09:38:04, Link
Author: BWE
Is there a cache somewhere of comments that get deleted?

Date: 2006/04/14 06:12:24, Link
Author: BWE
Maybe we should jump ahead to the end of this discussion?

Belch,
Fart,
It's called a Wife Beater,
I am a patriotic American!
Dude, calm down.
You are a sad case of humanity.
Your morality comes from a pack of Jackals.
Overpopulation, overshmopulation.
Belch,
Fart.
<end discussion>

Date: 2006/04/14 12:56:58, Link
Author: BWE
Thordaddy,

Does masturbation refute evolution? I think horny little buggers are horny little buggers. We didn't evolve in todays world. we evolved in little packs on the savannah. A gene that made you unable to provide for the tribe or unable to mate might have been an issue but we didn't know what made babies for a long time. I think we probably evolved to stick it in anything warm and wet we could find and it is modern discrimination (as in discriminating people choose crest toothpaste) that accounts for the distinction of homosexuality at all. The early jews were trying to make a civilization out of a barbaric world. They chose to create those distinctions to differentiate themselves. Circumcision isn't very obvious either y'know.

Dude. If you're afraid, that's ok. Lots of people fear homosexuals. We have been programmed to fear it. Not choosing it is different than hating it though. And let the poor bastards go to whatever heII they choose.

Date: 2006/04/17 06:22:02, Link
Author: BWE
Thordaddy,

You are simply ridiculous. Can't you see that your superior intellect is pulling a Plato? You are so smart that you believe that what you think must be true so you go and figure out ways to make reality fit.

Sometimes super-intelligence can be a hinderance.

I am yearning for you baby,
Ohhhh Yeeah.
As a zygote I was yearning for you baby,
Ohhh Yeeah.

Oh I know there is a schizm
between the good guys and relativism
And somebody out there knows the truth
All lonely and aloof
But no one will listen
because its all just relativism

I am yearning for you baby,
Ohhhh Yeeah.
As a zygote I was yearning for you baby,
Ohhh Yeeah.

Who wants credibility?

Date: 2006/04/17 13:15:35, Link
Author: BWE
Mmmmm. Bacon.

Date: 2006/04/18 16:34:09, Link
Author: BWE
http://im-from-missouri.blogspot.com/

As in "you'll have to show me."  Oh the Irony. :p

*edit*
http://cartagodelenda.blogspot.com/2006/04/great-debate.html
A few PT regulars mentioned by Larry in the last comment.

Date: 2006/04/19 17:49:58, Link
Author: BWE
:00-->
Quote (guthrie @ April 19 2006,07:00)
As a matter of interest, do you reckon it would be best to ignore it completely, so that it withers and dies, or rather, joins the back scratching set up that are the pro-Id blogs?

Or should scores of people join and put his no censorship proclamation to the test?

That is precicely what I had in mind. I'm sorry I have been busy over the last few days. I notice he thought that my post was simply a personal attack on him. It was in fact a far more general comment than he interpreted it as. Kevin, well done. Very civil. I think his blog would be a good place to post definitive answers to his objections. Then we could simply point people who use his arguments to his blog.

Date: 2006/04/19 18:26:16, Link
Author: BWE
I think links are appropriate so PT or AtBC posters can add their comments too. If it's particularly funny, or if the wind is blowing a certain way or if you feel like it I guess you should post your responses here. I think Larry is a sort of topic in and of himself anyway. This might be interesting if it catches on. A creationist websight where rational people can post. :D

Date: 2006/04/20 13:35:39, Link
Author: BWE
Oh come on. Reprehensible?

Any way I just left a couple of posts over there
here
and here at the end

Date: 2006/04/20 13:41:55, Link
Author: BWE
See DS's graphic in the 1st comment. I love that guy.
here

Date: 2006/04/21 04:37:46, Link
Author: BWE
Wesley,

The system by and large works. It is unfortunate to have to ban anyone who is interested in learning or sharing ideas but it's not like PT is known for dropkicking posters who challenge the party line. I would give kudos to PT for presenting current affairs in biology and the wingnut faction who hates in an open and honest fashion. Wingnuts certainly do have the chance to defend their positions. If they prove to be unable to do so, oh well.

What thread did jonboy muck up? Are his comments still available?

Date: 2006/04/21 06:37:59, Link
Author: BWE
God, I'm in portland and I'm pretty sure I know one of the producers who would have done that. I'll get back to this post with an update if anyone is interesting... er... interested. :0

Date: 2006/04/21 13:53:47, Link
Author: BWE
Well, It wasn't my friend who produced it. Seems like kind of a non-story there. I'm not sure I can get better info. She said she'd ask though. She certainly knew what I was talking about.

Date: 2006/04/21 14:25:38, Link
Author: BWE
I am enjoying posting on his blog at any rate.

Date: 2006/04/21 15:26:30, Link
Author: BWE
It leaves me shaking my head too :)

Date: 2006/04/22 08:00:36, Link
Author: BWE
It has certainly gone up in my book above Uncommon de-Scent. Although I will always enjoy reading the UD wingnuts' toolbox over there, I will enjoy commenting on Larry's Blog even more where Dave can't do the bye bye thing . What better person to host a good debate than Larry? Maybe Thordaddy, but he get's into bizarre gay/abortion/military stuff.

Date: 2006/04/22 13:58:21, Link
Author: BWE
Mission accomplished. Bring it on.  :D

Date: 2006/04/23 10:40:54, Link
Author: BWE
It's official. I'm having more fun reading Larry's blog than UD. Dave is simply too stupid to keep my attention for long. I'm on to bigger and better things. Heddle needs to respond there to reeally get things going. Also, Larry will need to get more posts but hopefully we can help him out with ideas.

Date: 2006/04/23 11:01:24, Link
Author: BWE
Yeah. You can post a nasty thing and then delete it, it's a dirty trick but, at least it's gone. One thing though is that you have to have a blogger ID to be able to do it so you know it's one of the posters.  It can be turned off. I leave it on on my blog because it doesn't seem to matter. I have only gotten two or 3 spams and all the comments I get are off the wall. Also, the comments get emailed to the admin (Larry) so he knows what they were. If you suspect that they were bad, ask Larry. He'll probably tell you.

Date: 2006/04/24 18:29:54, Link
Author: BWE
I posted directions on my blog for how to force only registered users. Does anyone think it's anyone other than Dumbsh!t Dave that's putting up the nutso stuff?

It is actually funny to read because it's so wacky. Poor Dave, I wonder how this has affected his bloggg.

What's cool is that you can tease the IDiot and he can't stop you but his readership gets to comment too. Busts him down to corporal, y'know?

Date: 2006/04/27 16:08:53, Link
Author: BWE
I'm still not totally convinced that JAD is serious. He draws inferences that boggle the mind. For example ... Oh jesus never mind. for example look at anything the real Mr. JDA has written.

Oh yeah, apparently he wants to be called Dr. He doesn't like being called Mr.

But I am having a problem calling him Dr. I keep forgetting and calling him Mr.

I think he is the real money shot over there. I mean Larry is fun but he isn't the brightest bulb in the shed. JAD on the other hand, He's certifiable. He is also the only one I've ever heard make arguments that sound sciency. (well, behe and dembski sort of sound sciency but they don't have the same curb appeal.

Date: 2006/04/27 16:17:12, Link
Author: BWE
Dude.. Way too long. Waaaaaaay too long. Kirk Cameron? I think my daughter was into him in like 1985?? Banana??? Five sides??  Maybe that's proof god want's us to masturbate.. You know, the penis fits the hand.

Christians say some of the stupidest things of anyone. Well, lets just say that that kind of faith lowers IQ by a few points anyway.

Date: 2006/04/27 16:20:14, Link
Author: BWE
Oops, I guess I was wrong. I should read my own Blog I guess. My Webpage

Date: 2006/04/27 16:26:46, Link
Author: BWE
Google Kirk Cameron Christ

Im sorry to report, he really is that stupid.

Date: 2006/04/27 21:05:38, Link
Author: BWE
I think this will be my standard answer to questions like these. (like lenny's questions):

Why oh why does anything about god matter in even the slightest bit to humans? Heaven and #### are meaningless words in the context of eternity. They are quite meaningful when applied to how we feel while living but not once we're dead. So why is gOd important?  ???

Date: 2006/04/28 08:18:27, Link
Author: BWE
Quote
The first step is admitting you have a problem.

The second step is caring that you have a problem?   :0

Date: 2006/04/28 08:28:39, Link
Author: BWE
Dude, you are asking about this god as super smart super powerful etc. but those are subjective and, for them to be meaningful to you, they need to be defined on you4r terms. Bottom line, god is irrelevant. You can't define, comprehend, interact etc.

Date: 2006/04/28 10:52:52, Link
Author: BWE
The only evidence that I have ever seen for a crumbling or crumbled society involves overutilization of critical natural resources: Trees, water, fisheries, topsoil, etc., loss of trading partners, or military conflict. Can you point to a society that collapsed because of homosexual relations? Has buttsex ever destroyed a nation? Do you think the bit about the pillar of salt has a "grain" of truth?

Other than Soddam yada yada has any society ever collapsed due to anything other than environmental degradation, loss of trading partners or military conflict?

** note** I have read Collapse by Jared Diamond and I am aware of the similarities with my previous statement. However, in context, this is not borrowing someone else's ideas.

Date: 2006/04/28 11:14:50, Link
Author: BWE
What thread?

Date: 2006/04/28 11:25:58, Link
Author: BWE
He's just getting warmed up. He'll get there.

Date: 2006/04/28 11:42:33, Link
Author: BWE
Weren't the early christians the shepherds?



Quote
I see this as evidence of a crumbling society.  This is not the same as a "crumbled" society or a collapsed society.

What does it signify to you... "progressiveness?"


Ah. Now I get it. You're an idiot. I'm sorry, I just didn't uderstand before.

In much the same way that "melting" ice cream is not the same as "melted" ice cream or "dried up melted ice cream".
What does this signify to you, "wasteful government spending?"

Date: 2006/04/28 11:45:54, Link
Author: BWE
Is that hitch hiker's guide or Monty python?

Date: 2006/04/28 12:14:01, Link
Author: BWE
Quote

I think that if a society has within it an influencing minority that are of the opinion that marriage between one man/one woman is no better or no worse, but in fact EQUAL to a marriage between a man and a sheep then I see this as evidence of a crumbling society.  This is not the same as a "crumbled" society or a collapsed society.


Hmm. Now if a society has an influencing minority within it that believe that torture is appropriate policy for it's military, then I could see your point for a crumbling society. This is not the same as a "crumbled" society or a collapsed society, just one that is overreaching and trying to solve resource issues that it doesn't have internal mechanisms to confront. :D -you know, on it's way down, so to speak.

Date: 2006/04/28 12:24:37, Link
Author: BWE
What if it's ok with the sheep? I mean, er, well, sheep don't complain, if you ask them if they've been good or bad, they always say baaad. And we all know what you get to do to a woman who's been bad.

Hmm. There are some problems. Sheep can't cook or clean.

Date: 2006/04/28 13:07:40, Link
Author: BWE
Thodaddy, what the he!! is your problem? What's traditional marriage got that interspecies sex hasn't got? Huh? Liberal? Dude, you don't have to hate yourself for your gay experimenting in college in order to keep from doing it again. Just chalk it up as a learning experience about your personal preferences.

Also, what happens to you if gays can marry?



Quote
I see this as evidence of a crumbling society.  This is not the same as a "crumbled" society or a collapsed society.


Also, do you see how utterly pointless and stupid this statement is? I mean, you are off the charts buddy.

Date: 2006/04/30 20:35:53, Link
Author: BWE
I sort of like the Idea of whatever hindu god being torn apart and getting back together.

Date: 2006/05/01 04:16:53, Link
Author: BWE
Quote
>>>>Larry, it ain't our problem if you ain't bright enough to understand why the reconciliation of faith and science doesn't mean that science is religion.<<<<
(Larry replies)
What is your problem is that you are not bright enough to understand the points that I made in my opening post.


This is why is it fun to bait, er, discuss ID and evolution with Larry.

Date: 2006/05/01 18:11:26, Link
Author: BWE
Quote
Why oh why does anything about god matter in even the slightest bit to humans? Heaven and #### are meaningless words in the context of eternity. They are quite meaningful when applied to how we feel while living but not once we're dead. So why is gOd important?  ???

Date: 2006/05/01 18:17:54, Link
Author: BWE
Or this gem:
Quote
>>>>And, in answer to your comment above, If my religion tells that 2+2=3, should they avoid math in school or say that, even though I certainly have a right to my religion.<<<< (that was my question he is quoting)

Well, why don't you start arguing "teach the controversy" in support of teaching your belief that 2+2=3 ?

That was his answer to my question :D

Date: 2006/05/01 18:27:01, Link
Author: BWE
Thordaddy, smoke a joint and forget about that time with the sheep, will you? Jeesuss F. Christ. WTF is the problem? Still stuck on the crumbling society bit? Resource overuse. That's what you need to watch for. Gay marriage means squat. The sheep too for that matter. Although, if the sheep doesn't like it, I hope you'd have the decency to stop.

Woo Hoo! I hear the unmistakable whine of a moron with high blood pressure, larry, er, thor, shut up. You'll start to feel better. Now that, said john, is ad hominemenem.

/opining

Date: 2006/05/01 18:31:21, Link
Author: BWE
Quote
Do you take this same bigoted and prejudicial LIBERAL position?


Do I take this same bigoted and prejudicial LIBERAL position? Or am I too far off your chart for a name? I like names. How bout daisy? Do you like daisy? I'll be Richard?

Date: 2006/05/01 18:37:41, Link
Author: BWE
Book is a page turner with some neat ideas. I read it two years ago and I still remember a lot of the plot if that says anything.

But most of the illuminati stuff is better in Focault's Pendulum by umberto eco. I'd recommend that one a little more. Also Eco writes a little better. Brown is at least as good as grisham.

Date: 2006/05/01 18:44:17, Link
Author: BWE
How is it that you are god when I am god? Maybe we are both god? Wow, look at all the pretty colors. OOhhh.

Date: 2006/05/01 18:52:41, Link
Author: BWE
Ok, Bartender? A round of Valium 5 mg and double scotches please. And make it snappy! Got a bunch of folks here who take 'emselves waaaayyy too serious. They gettin' all hot 'n bothered over gay marriage.

Eh?

Yeah, at least some of em look like they might snap out of it. This one though, mmmm... don't know. Maybe add another double.

Date: 2006/05/01 20:02:44, Link
Author: BWE
Had to revive this one. What's the deal with the fundies gettin' all riled up all a sudden? We got AF dave, who went out and defended our country in a darn airplane in spite of his obvious disabilities; Larry has his own blog where Dave scot and JAD are fighting, Thordaddy spins fasterr and faster as he approaches the drain; and Carol still somehow thinks anybody cares. The field is too ripe and the targets are too easy, cant... help.... myself....

HAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHA!!!!!!

Please Wesley, Ad Hominem, just this once?
IDiot, HAHAHAHA!!! Fundiiiiiiiiiiiiiiiiiiiieeeeeeeeee, HAHAHAHAHAH!!!


:D  :D  :D  :D  :D  :D  :D  :D

Date: 2006/05/01 20:46:08, Link
Author: BWE
I'm telling you: deforestation, salinization or loss of topsoil, desertification, water pollution or overuse, military conflict or loss of trading partners. Not Fags. THose first ones sneak up on you and spank you.

Date: 2006/05/01 21:08:21, Link
Author: BWE
Thormonkey, You are avoiding me. You are saying stupid things and then jumping up and down trying to take your thumb out of your a$s.

What on earth is the crumbling you are talking about?  What is the bad thing that will happen?

Aren't there waaaaaaaaayyyy more important things to think about?

I can run faster, jump higher and screw better than you but you don't see me running around saying that we ought to have a law against you do you?

Well, do you?

You don't have to like it to not care about it. Go join the army and fight in Iraq. That way you won't have to put up with bozo's like us.

Or just go with this subconscious urge you are having and go down to the Fox and Hound and see if george is lonely tonight.

Hello? What the heck is your problem with this issue? It's stupid and trivial and mean-spirited to boot. You my friend, I can call you my friend can't I?, need to lighten up. You are born, you live, you die. That's it. Why be angry, bitter and mean in the brief part between point a and point c? I don't believe it makes you feel good. :)

Date: 2006/05/01 21:28:47, Link
Author: BWE
Yes,
I am  arguing that if our society were to give state sanction to a man/sheep union then this would NOT be empirical evidence of a "crumbling" society.

I am arguing that if our society were to give state sanction to a man/sheep union then this would be empirical evidence of a society that gives state sanction to a man/sheep union.

I am also arguing that you are a moron.

And that deforestation, salinization or loss of topsoil, desertification, water pollution or overuse, military conflict or loss of trading partners are empirical evidence of a crumbling society. Can you find a single society that crumbled for a reason that I didn't just list? That would be a fun debate. I like debates. How bout it Daisy, you in?

Date: 2006/05/01 21:48:16, Link
Author: BWE
I may make wild assumptions and dismiss relevant information but my ability to lie to myself keeps me from recognizing it. So I would have to ask you, please, for the childrens' sake, show me my wildly relevant information and dismissive assumptions or whatever it was you said.

Someone needs to hold my feet to the fire. ANd who beter than a homophobic, dipweed who wouldn't know a Riftia pachyptila from a  Loxodonta africana, and who needs to ask his mommy if it's ok to vote this time to be the one to do it. Spank me sir Moronus Odinus.

Date: 2006/05/01 21:52:17, Link
Author: BWE
I bet that makes it hard to get girls eh?

And...

I am god.

Date: 2006/05/01 22:43:35, Link
Author: BWE
THorDog,

You suffer from a common delusion that all people must have an allegiance to either "us" or "them".

You say:
Quote
Your credibility as a scientist is severely tarnished by your allegiance to a political ideology.

You surmise that anyone that questions your liberal/"scientific" premise must be a fundamentalist.  This is an erroneous assumption and overlooks a plethora of views that exist outside your narrow paradigm.

1 )I have very few allegiances and of those I don't have, an ideology is toward the bottom of the list.
2 )I use the word Fundy interchangeably with many other derogetory statements meaning something like "he who's head is so far up his a$s that rational debate is pointless" so, to cheer myself up, I engage in irrational debate with fundies.

But the reality of your gay problem has been stated with the eloquence of Virgil at least in my related posts, mostly on the other thread I believe. And you have not succeeded in showing me that a single one of your assertions is true:
1Your credibility as a scientist is severely tarnished by your allegiance to a political ideology.

2 You surmise that anyone that questions your liberal/"scientific" premise must be a fundamentalist.  This is an erroneous assumption and overlooks a plethora of views that exist outside your narrow paradigm.

3 It is not a fundamentalist argument. (see my definition of fundy, above)

While I have rendered you impotent with my toss off remark about your fundiness from the other thread. In fact I left you so speachless that you had to answer here rather than there simply because you were too afraid to view into the abyss one more time. Very well, I will re post my reply here, It doesn't hurt me:
Quote
Yes,
I am  arguing that if our society were to give state sanction to a man/sheep union then this would NOT be empirical evidence of a "crumbling" society.

I am arguing that if our society were to give state sanction to a man/sheep union then this would be empirical evidence of a society that gives state sanction to a man/sheep union.

I am also arguing that you are a moron.

And that deforestation, salinization or loss of topsoil, desertification, water pollution or overuse, military conflict or loss of trading partners are empirical evidence of a crumbling society. Can you find a single society that crumbled for a reason that I didn't just list? That would be a fun debate. I like debates. How bout it Daisy, you in?

Date: 2006/05/01 23:23:52, Link
Author: BWE
Quote
What would someone with "very few allegiances" base his "rational" debate on?  Is thinking that someone advocates for traditional marriage because he hates gays, "rational?"  In my context, what is this "rational" argument comprised of other than the manipulating cynicism of a radically powerful victim group?

Ok, you had me going. Darn, you are good. This post just blew your cover though. It's a mark of true talent to be able to parody a fundy that well for so long though. Where are you going to college?

Date: 2006/05/01 23:52:33, Link
Author: BWE
Wow. Hmmm. Wow.
Quote
But according to you, the sanctioning of traditional marriage is empirical evidence of discrimination and intolerance.
I think that it is the other guy dressed as Santa Clause who said that. I could give A flying rip whether they sanction any kind of marriage. When Sheep Focking is outlawed only outlaws will fock sheep. If bigoted a$ses feel the need to exclude gays from social security and next of kin rights, I reserve the right to think they are bigoted as$es. I never said I expected the world to be fair. I am a married white male with an advanced college degree in America. Why should I ultimately care what butthumpers do or don't get? But I sure don't want the responsibility of keeping them in a lower class status.

Go hump a goddamn sheep if you want to. If I catch you, the first thing I will do is see if the sheep cares. If it doesn't then honestly I don't care either, and if you do, your priorities are pretty #### superficial. I promise not to call the cops unless the sheep looks distressed.

Sheep Focking has no net effect. It has been practiced by lots of cultures throughout the world most notably the tribes of Israel. They didn't all do so bad. I would propose that sheep focking has never contributed to the demise of a civilization. But I would propose that deforestation, salinization or loss of topsoil, loss of fisheries, desertification, water pollution or overuse, military conflict or loss of trading partners are empirical evidence of a crumbling society.

And the bulwark would have a lot more to do with sound environmental policy than sheep focking. Or brokeback mt. style buttlove.

But it does provide some entertainment along the way to watch people like you jump up and down trying to pull your finger out of your ass while you cry about the inevitable collapse of society.

I just finished assembling a pretty fat report for the state department on the updated state of the main fisheries off the Pacific Northwest. I can assure you that they were more concerned with Hippoglossus stenolepis than sheep focking. And you probably think that the fish will just keep on coming from the store where they have been coming from for as long as you can remember. Those who live around the sahara and gobi deserts care a lot more about trees than buttsex.

And those on the brunt end of a military effort care more about survival than about whether their father blows goats.

You are very nice though. I like you Daisy.

Maybe the guy who cut the last tree down on easter island was thinking about the weakening of his society's moral fabric due to the pig focking going on in the village below. But I doubt it.

Date: 2006/05/02 00:45:11, Link
Author: BWE
Quote
That's a lot of words to simply say you're an apathetic ideologue.

I used to have the "just don't care" attitude, but then realized I was being duped into intellectual laziness.

The kicker was the rabid fear-mongering about the epidemic of AIDS and its "non-discriminatory" nature during the late 80's to early 90's.  What a load of lies we've been fed with that one.

And here I thought I was being clear and concise. I do care. Just not about the things that you seem to care about. Intelectual laziness manifests itself in caring about trivial things like social norms is my theory. Look, I have stayed up all night finishing a report that could potentially disrupt the lives of a lot of people and you are sitting here whining about gay marriage. Jesus, you have time to care about gay marriage? And you think you were lied to about the non-discriminitory nature of aids? Why, did you read a report that it was discriminitory? You were reading a synthesis of the best info available at the time and it wasn't too far off the mark.

I'm sorry, the coffee is wearing off and I have to present some of this stuff in 5 hours. I guess that was a bit grouchy. You are only ridiculous. Nothing more, nothing less. Good night.

Date: 2006/05/02 18:36:26, Link
Author: BWE
Quote
But this is mere speculation and seemingly leaves only two alternatives.  Either such a sanction benefits our society or it has no net effect.  If you can argue for either one, I would love to hear it.
Seemingly.   ... If you're a moron.

I am arguing that if our society were to give state sanction to a man/sheep union then this would be empirical evidence of a society that gives state sanction to a man/sheep union.

Quote

But according to you, the sanctioning of traditional marriage is empirical evidence of discrimination and intolerance.  Wouldn't the sanctioning of a man/sheep union at least indicate evidence of non-discrimination and tolerance?  Isn't this tantamount to saying that a man/sheep union is a benefit to society?


Quote

I am also arguing that you are a moron.


Where's the argument?

My point exactly
Quote

And that deforestation, salinization or loss of topsoil, desertification, loss of fisheries, water pollution or overuse, military conflict or loss of trading partners are empirical evidence of a crumbling society. Can you find a single society that crumbled for a reason that I didn't just list? That would be a fun debate. I like debates. How bout it Daisy, you in?(t-diddy quoting me)


So you look at a crumbled society and divine the cause of its collapse?  But a society sanctioning a man/sheep union could only be considered a bulwark against such a collapse?  Is this the "rationale" behind your advocacy of gay "marriage?"

Dude, I have a bachelor's degree in Political science and a masters in marine biology. Also, I read. Yes, I am divining the causes of past societal collapse. However, I am doing it by understanding the evidence. Read, COLLAPSE by Jared Diamond.

You my moniker challenged hobgoblin, are an idiot.

Date: 2006/05/03 09:01:08, Link
Author: BWE
PuckSR

Quote
Umm...why am i an idiot?
Unless i misunderstand...you randomly lobed an insult at me after chastising Thordaddy?

You misunderstand. I lobbed rather than lobed and I was referring to Thordaddy, who's moniker is hobgoblinesque. Not quite divine etc...

So I will rephrase to be more clear:

Thordaddy,
you make false claims about others' points of view in order to make their statements fit your twisted sense of faggot lovers -not because you are trying to make them admit whatever wrong you are accusing them of but because you don't have a frame of reference that can accomodate their statements.

You consistently use the phrase homosexual propoganda. You spit out the word "Liberal" as if it had moral value at all, let alone the decidedly negative moral value you assign it. You ignore everything that has already been said and begin your arguments again rather than refine them. You are ignorant to a surprising degree. And to top it off, you count your ignorance as a virtue and condemn simple education, understanding and compassion as vices worthy of perhaps, well, I don't really know how far you want to take this thing. What should we do with Fags? Hmmm? What about people who aren't afraid of queers? What about people who take a step back from their surroundings enough to get a sense of the bigger picture and come back with conclusions that don't match yours?

And I am calling you an idiot mostly because of this statement:
Quote

So you look at a crumbled society and divine the cause of its collapse?  But a society sanctioning a man/sheep union could only be considered a bulwark against such a collapse?  Is this the "rationale" behind your advocacy of gay "marriage?"


If you can't see how truly stupid this was to say then I rest my case. I could dissect this for days. So could most educated people. Every sentence is so wrong as to be almost unbelievable.

So, look in the mirror Thordaddy, that is the face of an idiot. Maybe a nice idiot. Maybe an idiot who has many positive qualities. But an idiot none the less.



[QUOTE][/QUOTE]

Date: 2006/05/03 16:28:08, Link
Author: BWE
Thordaddy,

So, ?? Where is that going? How does that relate to your use of the word liberal?

Date: 2006/05/05 05:43:18, Link
Author: BWE
Quote
BWE,

I've been called all kinds of derogatory names including the use of profanity and you're all worked up because I call forumites "liberals" and use the phrase "homosexual propaganda?"

You're a joker that refuses to engage in the debate.

You've earned your titles. I have engaged in the debate. You have not been able or willing to respond to my comments in a meaningful way.

So, my points have been:

1 -What difference does it make?
2 -What society has ever crumbled without, environmental pressure, military action or loss of trade partners being the major causes?
3 -How could queers getting social security and survivor rights possibly affect society in a negative way?
4 -How could a gay gene possibly refute evolution since positive functions of evolutionary changes can be positive functions to the group (as in we are social animals) since, in the savanah environment those with such a gene probably still did a little humping of the opposite sex?
5 -You are an idiot.

Date: 2006/05/05 05:52:58, Link
Author: BWE
I suspect that thinking in a language is indeed what most people experience. I have spent a good deal of time in central America and I notice that after a few weeks of being there, I start "thinking" in spanish. I have asked dozens of people about this experience and I have recieved unanimous confirmation. I would guess that words are symbols that we can't do without in order to define and conceptualize ideas that exist in time (planning or reflection).

THere must be hard scientific evidence and research on that concept somewhere.
Anyone???

Date: 2006/05/05 08:57:50, Link
Author: BWE
That has certainly been my fascination too. Well said PuckSR.

That is essentially my fascination with the whole content of PT, AtBC, UD, Larry's blog, And the major reason behind my blog. It's sort of like an experiment that puts a creature in a situation it is hopelessly unable to cope with in a petri dish and trying to find commonalities in the creatures' responses to the situation. Make the case for rational thought/behavior, (or add the unsolvable environmental dilemma) and try to understand the inevitable response in it's evironmental context. Fascinating. In the end, it always  seems to boil down to a vilification of education and an exaltation of ignorance. And, so far for me anyway, all the responses boil down to a fear-based reaction.

One interesting thing to note is that rational people will often resort to a fear-based reaction to the fear based cluelessness.

Date: 2006/05/07 05:50:28, Link
Author: BWE
Anyone please correct me if I am wrong in these next several points:
1 -The world at large is not now, nor has it ever been, "fair".
2 -Fairness is like "truthiness" -subjective but at least nominally desirable.
3 -Gay mariage is essentially an issue of fairness. On one side and the other.
4 -Poligamy and most other things people want to do but can't because it is illegal are also issues of fairness.
5 -legally, the only thing that a law can rest on if it is in violation of fairness is public health, safety and welfare.
6 -Christian wingnuts could concievably go into anaphylactic shock over the gay marriage issue, as well as legalizing drugs and prostitution, man-goat love, polygamy, etc.
7 -therefore all kinds of things that really shouldn't make much difference to anyone are in fact a very bad idea because it endangers the public health, safety and welfare by exposing fear-driven folks who accidentally put their christianity on backwards to strange siezure related illnesses.
8 -Thordaddy is an idiot.

Date: 2006/05/07 06:00:19, Link
Author: BWE
Quote
No, they're right.
We, at the lab, are so afraid of evidence that we've decided to cancel our research programs.  


Dam. That's why the lab hasn't sent me back those mercury levels yet. -erm... Does that apply to basic labwork too?

Date: 2006/05/07 06:11:59, Link
Author: BWE
most older societies condidered you to be "born" after you could walk on your own. That was why infantacide was legal and practiced in all preindustrial societies. It hinged on the highly influencial Uggh v. Mbong where the judge in his opinion stated Aaaahhhhh!!!! and threw his club at Mbong.

Thordaddy, give it up. Either it's a legal issue or it's a moral issue. If gay marriage, abortion, drug use, free market capitalism (ala milton friedman), the use of military force et.al. are the right way or the moral way, then why are you doing this? Why not just say, GOD, GUNS and GUTS made this country strong and I will follow blindly, right or wrong?

These aren't good legal arguments. They aren't good moral arguments. In fact they aren't good rational arguments. You need to answer the question "why does it matter?" before you ask questions.

Date: 2006/05/07 06:18:23, Link
Author: BWE
OMG that might be the funniest commercial I've ever seen. I should watch more tv.

Date: 2006/05/07 06:22:37, Link
Author: BWE
Quote
The next shithead who calls me ignorant of the law or biology is going to be scorched by a reply that will be the biggest flame that he ever got.
Larry's enjoying his newfound fame. So are a bunch of people.

Date: 2006/05/07 07:29:41, Link
Author: BWE
Quote
A belly laugh is worth a thousand syllogisms.


A thread that I started yo examine that idea. I think it is important still.

Joe, I am sort of a scientist. I have a masters in marine biology. I deal more with policy stuff now but honestly, science has never been something I have needed to draw too heavily on here. GoP, Larry, Thordiddy, AFDave, etc. have never gotten off the absurdity tarmac. They have no point other than that they are afraid of so many things in the world. I am hopelessly driven to examine the ramblings and ravings of madmen since I write about them in my spare time. I also practice simply putting words down since, one might hope, I would improve my readability with practice.

Although they are just louder now than they used to be, they are still just as remarkably stupid. If we convert them, where will we go to study that particular flavor of humanity?

Date: 2006/05/07 18:52:03, Link
Author: BWE
This thread is all about people who are staggeringly ignorant of nearly everything.

Date: 2006/05/08 03:55:04, Link
Author: BWE
Hmmm...

I like the nuance from geocentrism but I'd really like to see the scale free marriage model because it almost seems dumber. God Ghost, .your so interesting I'll probably forget which way I voted and read anyway. So why don't you just pretend that I voted for the one you like 18 times? That ought to be interesting.

Oh oh oh... I got it. I want a clear and understandable description of how I can understand eternity

Date: 2006/05/08 07:42:58, Link
Author: BWE
Well, no kidding. Letting gays marry. Next we'll be letting the cia sell cocaine.

Date: 2006/05/08 10:19:10, Link
Author: BWE
No, he's exactly the idiot I thought.

Thordiddy,

Why does it matter? What is the value of your tradition?

PuckSR, I think you coherently stated the only good argument against gay marriage and I see that Thordiddy doesn't like it.

Thordiddy, More questions:
1. why are the magnetic alignment of rocks on the seafloor interesting? What is one thing they tell us?

2. What society has ever crumbled due to lax morals?

3. Is god gay or lesbian?

4. Was jesus the product of rape?

5. If gay marriage was legal and your neighbors were 2 married men, would that bother you?

6. If you were injured, would you accept aid from them?

7. You are an idiot.

Date: 2006/05/08 12:02:04, Link
Author: BWE
Thordiiddy,
You are an idiot. Answer the questions.

Date: 2006/05/08 17:16:02, Link
Author: BWE
Thordiddy,

Why does it matter? What is the value of your tradition?

PuckSR, I think you coherently stated the only good argument against gay marriage and I see that Thordiddy doesn't like it.

Thordiddy, More questions:
1. why are the magnetic alignment of rocks on the seafloor interesting? What is one thing they tell us?

2. What society has ever crumbled due to lax morals?

3. Is god gay or lesbian?

4. Was jesus the product of rape?

5. If gay marriage was legal and your neighbors were 2 married men, would that bother you?

6. If you were injured, would you accept aid from them?

7. You are an idiot.

Date: 2006/05/08 18:50:13, Link
Author: BWE
In a nutshell, PuckSR is saying that gays have a different kind of arrangement historically than husband and wife and that marriage basically is a different thing. Fags aren't bad or good or whatever they are just different.

Thordiddy isn't really bad or good either, just stupid. And annoying. And:

Quote
NO THORDADDY....this is wrong.....
This is the exact same argument that was used against interracial marriage....


Yes... and now we are considering gay "marriage."  So those that argued that interracial marriage would lead to gay "marriage" were prescient.


And your feelings on abortion? Gun control? Environmental protection legislation? Yep. I know. It's hard to be one dimentional. Face it Thordiddy, you are a line. A solitary X axis. x=you. If you were to graph your argument it would look like this:

____

Date: 2006/05/09 05:25:28, Link
Author: BWE
On the expert thing:

I am constantly stuck with the notion not that fundies aren't experts but that they lack the fundemental information. Like, if they just understood the physical earth sciences a little better, they would avoid most of their ridiculous ideas. Maybe, geology, oceanography or physical geography 101. Let alone biology. But even in biology, it's usually high school biology that they don't understand. I can't even remember 90% of what I learned in grad school but I have never been even remotely stumped by a fundy's argument. In fact, I can't think of a fundy argument that wouldn't be squashed with any of those 101 level courses- particularly geology and oceanography. But if you throw in 1 physical anthropolgy course, you've crushed the rest of the arguments.

In the end, what they really don't understand is HOW we know the things we know. So it makes them suspect what we know. I have yet to see a coherent understanding of plate tectonics (magnetic alignment of rocks on either side of ridges, age of mountain ranges, etc.) from a fundy.

It becomes comedy quickly when they start to debate god. Sometimes, they try to go all the way to heaven and #### without dealing with the eternity problem. And geologic time is just not possible to fathom.

Date: 2006/05/09 09:35:49, Link
Author: BWE
Quote
Legitimate criteria for DEFINING marriage.

1. Size of Union (restricted to 2 people of opposite sex)


1. your one is two. two things.
2. your number two is exactly what this thread is discussing.
3. opium makes you sleepy because of its soporific effects.

Date: 2006/05/09 12:24:29, Link
Author: BWE
Quote
(Interesting, by the way, how none of the AtBC creo regulars have seen fit to join this particular thread.)


But you can bet they're reading it.

Hi thordiddy, AFDave, Paley.

Date: 2006/05/11 05:49:07, Link
Author: BWE
Thordiddy,

Has a society ever collapsed or come close to collapse due to allowing gay sex?

Can you explain the carbon cycle?

Date: 2006/05/11 05:52:32, Link
Author: BWE
GoP,
Do you ever wonder why you are an object of ridicule? ???

Date: 2006/05/12 05:54:45, Link
Author: BWE
Thordiddy,

For once, although it is also a problem with your argument, you are right. The two seem to be at odds. Gay parents no more likely to have gay children, single mothers - more likely to have gay children.

However, there are huge platform issues that you used to get to the point where that problem would come up. (Personally, I think it is poor form to cite a statistic without a source. Although that appears to be the norm in some spheres)

You are beginning with a set of assumptions that PuckSR tried to help you out with but you, being the ignorant ass that you are, entirely missed his lifeline.

You have to assign a value to gayness before any of this makes any difference. Then you have to defend your reasons for holding that value.

You can't do that without being a bigot.

Thordiddy, you are an idiot.

Date: 2006/05/12 07:29:46, Link
Author: BWE
Darn it Chris, I asked Paley. You just gave him the answer. Jeeze, you must have frustrated a lot of teachers in gradeschool.

Date: 2006/05/12 08:20:39, Link
Author: BWE
I think I see why you want to get at this definition but I wonder- either way, you have to start at your underlying assumptions.

For example, we assume that 2+2=4. It always appears to be accurate but it is still an assumption. We assume as we are walking that we will be able to continue walking. We assume that everyone thinks that eating is important. We assume that at least most people think that perpetuation of our species is important. We assume that there are specific qualities of being and that value exists for some of those qualities. Again, it appears to be true at every point when we examine it. We like certain foods more than others so we note value and assume that our sense of value is somehow an accurate way to make determinations about our world. And it is. But...

Often, our values are based on assumptions that other values we hold are more like 2+2=4 than "I like this more than that". If we are basing values on other values then it is important to understand those more primary values.

T-diddy has some core values that he holds to be self-evidenciary truths. Like, god created the world and humans too maybe. Or god, guns and guts are what made america strong. or whatever.

PuckSR, you are asking for a definition to move forward so that we can have a platform to begin our scientific inquiry from. But I suspect that platform is supported by dozens of tenous more primary platforms. Like "gay is bad", or "non-myFlavor-christian is bad". Or "gay is not bad", or "discrimination is bad". Those values in turn are supported by other values. The statistics are as close to value free as we can get (provided it is raw data) so I think those are important to this discussion but this discussion is only one of values. There are reasons to support those values and evidence is good but in the end, there are only minimal long-term consequenses (from an evolutionary point of view) for any of this particular value system.

So,
T-diddy, evidence for our values:
1- Does gay have a pos. or neg. value?
2- Does gay hurt society at large?
3- What does it mean to be a "crumbling society"?

-PuckSR, my vote is that Homo's are those that are willing to have sex with members of their gender and prefer that kind of encounter to one involving an opposite gender encounter. Other than that, I would postulate a continuum.

Date: 2006/05/12 09:30:05, Link
Author: BWE
Quote
However, IF Common Design is true, then this raises a whole string of potentially life changing questions.  What is this Designer like?  Is it one Designer?  Or many?  If He designed ME, does he want anything from me?


No it doesn't. My life wouldn't change one bit.

When god comes down and appologizes for all the crap people have done in his name, then I'll forgive her maybe. Until then, there is not one single shred of hard evidence that god is in any way interested in life on this planet so the designer hypothesis is at best irrelevant. What is relevant to science at least, is looking at the way things work and figuring out the mechanisms and characteristics of them.

I have read this thread patiently, waiting for you to utter an informed sentence Mr. Dave, but, not to my total surprise, you haven't. You are so totally lacking in the fundemental understanding of the entire subject you are taking on that there is no point arguing these finer details.

If you can tell me things like:

What is the geology of the area you live? When did it start to look like it does now?

What fossils have been discovered that fit into that time scale?

Why do specific flora and fauna (plants and animals-sorry) live in particular places? Why do they move around geographically as climate changes?

What does a top level predator provide to an ecosystem?

Why is there a system of ridges and trenches under the oceans? What do they signify?

Why do scientists think that dinosaurs existed? Why do they think it was so long ago? How do they arive at that belief?

Why do you think that echinoderms as varied as a sea slug and a starfish share certain characteristics but other similar creatures like molluscs (I'm thinking particularly about squid or octopus) don't share those same characteristics?

What does the magnetic orientation of rocks on the sea floor tell us?

And other questions like these I would be surprised. My bet is that at least half of those questions you can't answer off the top of your head. My other bet is that most of the sciency types here can answer all of those questions off the top of their head and that at least some can point out the problem with one of those questions.

Until you can gain that basic knowledge, you really can't discuss finer and more nuanced details that relate to those questions. Chimps and humans question really encompasses all of them to some degree.

Anybody else? Help me out here.

Date: 2006/05/12 11:04:47, Link
Author: BWE
AFDave,

Now that I go back and read the list I wrote, I am more curious than when I wrote it. Can you answer these questions?

Others here: Can you answer those questions?

(Without a reference)

Date: 2006/05/12 11:29:56, Link
Author: BWE
PuckSR,

For the sake of argument... Ya ya I get it. But I was saying...

I hear you asking "Let's create a platform from which to begin testing." Or "What are we using as our base assumptions." Or "Let's have a common definition from which to work." or something like.

And my point is, great. Lets. We can use that definition to begin to examine the circumstantial evidence for the "Gay" gene. But lets also establish what values we are assigning to the word. Because, as you point out in the culture bit there, the value has a lot to do with the definition. If Gay is "Bad" then any willingness to engage in gay sex is gay. If it is "Neutral", then being only attracted to the same sex is gay.

But T-diddy's problem (besides being an idiot) is that he is using his value structure to construct the platform where he begins. What this whole thread has been devoted to is pointing out the arbitrariness of his value structure. He can't even see that because those are the pillars holding up his platform. They must already be assumed in order to begin his argument.

You have to accept the whole construct of protestant stiffness (for lack of a better phrase) in order to begin this line of reasoning. You have to accept that gay is bad to even care.

For example, should pet rock ownership be allowed? Would a pet rock owner gene disprove evolution?
-Same question. Different platform.

Date: 2006/05/12 11:40:36, Link
Author: BWE
But you could also probably talk about the first and second intelligently though, right?

And they are quite elementary to science in general, (earth and life sciences) right?

Anyone with an undergrad degree in some earth or life science could answer them, right?

And, there wouldn't be any disagreement over the answers (other than the vagueness of the one), right?

Date: 2006/05/12 18:21:06, Link
Author: BWE
Ok AFDave. Everyone but you got my point. But I guess I have to speak slowly for you.

Y o u    a r e n ' t   q u a l i f i e d    t o   h a v e   t  h i s    d i s c u s s i o n .

You can't say anything with out a basic knowledge. You couldn't answer those questions because they weren't directly about evolution. BUT! You really can't understand the science of evolution without really getting those questions. Note, when I asked a vague question, the respondents could still respond intelligently.


You have yet to do that.

Date: 2006/05/12 20:43:20, Link
Author: BWE
That is the problem with fundies in general. They don't understand how come we lump them together. They always feel like "they" have a special knowledge. And yet, it's always the exact same knowledge with the exact same understanding behind it.

Dave, GoP, T-diddy, and whoever else like you out there, you have to know a few things first. You should know enough earth science to know how different fields find similar info. You should know enough biology to understand process rather than mechanics. mechanics at the genome level are so tied up in process that they are meaningless without that understanding.

If you could skip the 4-8 grueling years of college and possibly grad school or doctoral dissertation that it takes to get to the point where you can discuss these topics in any meaningful way, don't you think the scientists would be doing it?

I even went to grad school in science and I don't know half of what these guys who are specialists are talking about. The difference between me and the nutjobs though is that I know what subject they are talking about. I know specifically what it is that I don't know. So I know what education I would need to really know what this gene or that gene is really for. And I can tell you this: I know how to look at mine or your or anyones DNA with the naked eye. I've done it in Jr. High biology class where I occasionally guest lecture. But would I be qualified to use new discoveries in genetics to argue that all of science is wrong? I'd have to be pretty convinced, I'll tell you that. And, having undergone a rigorous science training, I can say that It would be impossible without a much more thorough training than that. Look to Hawking for it maybe. But not anyone who starts with belief. That isn't how science works. If you can understand what Gould was saying, you will have come quite a ways but without the cross-discipline general knowledge, you will always fall short.

And Dave, T-diddy, GoP, et. al.- you are the guys who are standing around with your pants around your ankles. It doesn't have to do with gay genes or vitamin c genes or god genes or blue jeans, it has to do with trying to fit reality to your pre-existing belief system rather than the other way around.

There is a lot of disagreement over the nature of the human condition, morality, spirituality etc. among the folks who make fun of you. They (we) aren't a homogeneous group. I bet we could discover nuanced understandings of economics as well as quite unsophisticated ones. That is likely in any subjective field. It's just that once you have learned to look at the data before you come to conclusions, you really can't go back. You can disagree over interpretation but not data. You are disagreeing over data. We can tell whether your arguments are a product of your beliefs rather than any kind of evidence.

After hearing enough folks who think they have an answer - like you guys- we all begin to realize that not only do you not base your arguments on evidence, you actively ignore overwhelming evidence that doesn't support your beliefs.

I'm sorry to break this to you but no one has the slightest idea about god. There is plenty of evidence to suggest that we can feel our connection to the cosmos and whatever but no book on Earth has ever been written by anything other than a human and your idea that the bible contains any truth as to the actual genesis stories is sadly mistaken. There is overwhelming evidence from all sources that converge on a point and the sacred texts don't fall within that space.

As mentioned before, that doesn't make them not sacred, it just makes the idea of sacred a little more complicated. But that is the price we pay for our evolution, we have to think harder and harder to stay afloat.

Date: 2006/05/12 21:02:04, Link
Author: BWE
GoP, you've never dealt with the press, have you? I have. Almost every day in one form or another and you are really, really wrong. The press is out to print what sells. Period.. ..
Right wing, put your fingers in your ears and shout lalalalalala I caaaaan't heeeaaar you!! sold well on the national stage on and off since reagan and before FDR (Hoover). It goes out of favor when a war goes badly or the environment needs cleaning or whenever we need to get together to accomplish something but the viewers drive the news. They cover what their audience wants to know about and the assign who their audience wants to hear to cover it.

Your posts are becoming stupider than T-diddys irf that's possible. Here's a challenge: show us your scale-free hub deal and I will personally make your argument fall into little irreducible pieces and you will look like an idiot. Now, you've seen my posts so you can gauge my intellectual accumen enough to decide if this is a worthy enterprise. If I can't do it, I'll let you post an entry on my blog.

Or are you really just full of scaleable density? Or are you:



:D  :p  :)

Date: 2006/05/12 21:14:37, Link
Author: BWE
Evidence for god?

What was the torture device in Hitchhikers guide where you could see yourself at scale in the universe? anyone remember? I couldn't find a google link in a quick search. Somehow, it reminds me of evidence for god.

Date: 2006/05/12 21:21:44, Link
Author: BWE
Quote
The whole point of the gay agenda is the attempt to equate homoseuxality to heterosexuality based on some false notion that homosexuality is a genetic predisposition and hence "normal."
Hmmm. Where do you get that idea? You are hung up on something else. How do arrive at your value that gay is bad? Why is it bad?


Quote

Most people can see the logic in the genetic basis for heterosexuality, but what is the logic behind a genetic basis for homosexuality?


T-diddy, are you arguing for evolution here? you're Like the Old man and the Sea.

You are using your values as proof of your arguments T-diddy. You are an idiot.

Date: 2006/05/13 10:01:09, Link
Author: BWE
Quote
THINGS THAT ARE NOT AF DAVE'S GOALS
(1)  Get a biology degree
(2)  Become a genetic engineer
(3)  Get an advanced science degree
(4)  Become a biochemical researcher
(5)  Pretend I know more about biology than you
(6)  Become a geologist
(7)  Become an astrophysicist

OK?  ... again, I appreciate all the admonitions to get this or that degree or go buy this or that book ... but it's not necessary ... there are plenty of competent researchers like Mr. Nishikimi out there who give me the data I need, and of course I do have YOU ALL to keep me straight.

And I should point out that you guys do a great job of knowing biology and the workings of DNA and transcription and chromosomes and all these wonderful details.


Those 1st several things do not have to be goals. But you have to have the BASIC knowlege before the ADVANCED knowlege is any use to you. It isn't the advanced stuff that proves evolution or plate techtonics or expanding universe. It's the BASIC stuff. The advanced stuff is simply layers and facets to the picture. Argue genes all day long buddy. It doesn't make the fossil record any less relevant. Argue the fossil record all day long, it doesn't make it's relationship with geology any less relevant. Argue any detail in any specialty field of science and you aren't saying a danm thing about the big picture which shows conclusively and overwhelmingly that, not only is evolution the way speciation DID, DOES, and WILL occur, but that ALL provincial interpretations of religion are mere projection.

Not to say that god isn't there. Merely to say that no one has any privilaged info on it. And that is why your argument keeps going round and round. Because you have to jump to different disciplines to defend your ignorant ideas. As soon as you get on unsure footing in one discipline, a scientist can look at data from another to check a hypothosis. You, in attempting to engage in scientific discussion, are having to do it too. Unfortunately, there isn't a safe haven for you since your provincial view of god has forced you to take positions that are exactly what science DOESN'T find. So you go to science and are shocked that scientists, who are busy discovering more and more detail about how things DO work, don't take you seriously when you spout off ignorant and false "facts" that are easily disprovable with a inter-disciplined first year science curriculum. You are effectively telling nuclear physicists that they are wrong and basing your idea on the fact that a lever reduces the amount of force available.

We can't really speak to your questions because you are too totally lacking in BASIC understanding. You are wrong, ignorant, and your hubris is a projection of fear that you need it to be a certain way so you can't even see that you are wrong. Unlike T-diddy, you don't appear to be an idiot, but you are wrong. It is to big of a task to explain why.

You never answered my questions earlier because you can't. And they are VERY basic questions but the info you need to be able to answer them is critical to understanding almost anything else, especially in the kind of biology that you need to know to understand evolution. Genetics-you can't even DO genetics without understanding evolution. You can't argue genetics without understanding how niches, ecosystems, selective pressures and etc. affect organisms. And you cand understand  niches, ecosystems, selective pressures and etc without understanding a bit of earth science.

So, I'm sorry but you are simply too ignorant to be educated in this blog. Go read geology 101, oceanography 101, astonomy 101, biology 101, and maybe chemistry 101.

Any combination of two or three of these would probably do the trick but you just can't join the debate without these.

Does anybody disagree?

Date: 2006/05/13 10:35:09, Link
Author: BWE
k.e.,
For those who can decipher what you just said, it was beautiful.

Well said.

Date: 2006/05/13 11:56:14, Link
Author: BWE
On one of AFDaves many, many AiG related threads, I asked a series of questions that Seemed like necessary understanding to have to post the kinds of questions he posts.  My questions were:
 
Quote
I have read this thread patiently, waiting for you to utter an informed sentence Mr. Dave, but, not to my total surprise, you haven't. You are so totally lacking in the fundemental understanding of the entire subject you are taking on that there is no point arguing these finer details.

If you can tell me things like:

1-What is the geology of the area you live? When did it start to look like it does now?

2-What fossils have been discovered that fit into that time scale?

3-Why do specific flora and fauna (plants and animals-sorry) live in particular places? Why do they move around geographically as climate changes?

4-What does a top level predator provide to an ecosystem?

5-Why is there a system of ridges and trenches under the oceans? What do they signify?

6-Why do scientists think that dinosaurs existed? Why do they think it was so long ago? How do they arive at that belief?

7-Why do you think that echinoderms as varied as a sea slug and a starfish share certain characteristics but other similar creatures like molluscs (I'm thinking particularly about squid or octopus) don't share those same characteristics?

8-What does the magnetic orientation of rocks on the sea floor tell us?

And other questions like these I would be surprised. My bet is that at least half of those questions you can't answer off the top of your head. My other bet is that most of the sciency types here can answer all of those questions off the top of their head and that at least some can point out the problem with one of those questions.

Until you can gain that basic knowledge, you really can't discuss finer and more nuanced details that relate to those questions. Chimps and humans question really encompasses all of them to some degree.


It got me thinking. Most of the people I know can answer these questions to some degree even if they have NO college level science or very little. And they are very basic science concepts.

My hypothesis is that only those on the extraordinary self-dilusional side of the spectrum on the fundy spectrum CAN answer more than two of these.

So my question is: Is the debate possible, lets say in genetics, if the AiG type doesn't understand these concepts?

Ignorance fueled by the desire to remain ignorant is a foreign concept to me so I am not really sure of the answer. But I think you will just go round and round between the disciplines if the other guy isn't aware. It's a matter of the core. How all the sciences are inter-related.

Anyone?

Date: 2006/05/13 19:34:17, Link
Author: BWE
Yeah, reading science books should get you there. It seems to me that the YEC types might have the hinderance of religion and in that respect they are right that scientists and those like myself who use science at work are really not interested in what they have to say about a topic they care a lot about.

Date: 2006/05/14 04:59:09, Link
Author: BWE
Thank you Steve. That is what I've been thinking that has been nagging at me. If I want to know something about genetics, I will go to someone who really knows. And here's the thing, I will place the information gleaned from that encounter in the file marked "newest, probably best information" in my head.

Having gone some of the way, I know why those who have chosen to specialize are indeed experts. I suppose that anyone who can think critically can do that. It's not an appeal to experts like a falacy. It's an appeal to experts to ask for info. That's kind of where the info comes from. Like what you said steve, they come to you asking about math and then tell you that you don't know. It can be frustrating.

Fundies are caught in what k.e. likes to call "cognative dissonance". They have an authority- a pastor or whatever- telling them one thing, and when they go to someone who actually looks at that stuff, they get an opposite answer.

You eventually realize that one of the two is lying. Well, who's it gonna be, the guy who married you to your wife or some scientist who has forgotten how to even speak english?

To keep their heads from exploding, they start shouting as loud as they can:

La lalalalalalalaalallalallallalalalalalalalala, I can't heeeeeaaar you. lalalalalalalalalalalalalalalala.

And that is what these discussions are. one side shouting that kind of thing but disguising it as a rational question and another side answering the rational question instaed of just shaking their heads and walking away.

I remember one time when a street preacher walked up to the place I was eating in the main square downtown and started preaching just stupid jesus stuff.  He got right next to the small group of people that were enjoying the sunshine and lunch and started shouting at us. Some of the people asked him to leave but he wouldn't. After maybe an excruciating minute, I got up, walked down to the circle he was standing on, and started telling the story of the 3 little pigs in biblical fashion, at his same volume, complete with hand motions and all. It worked, he refused to compete and left (AFDave, if that was you, I am sorry if I hurt your feelings). I sat back down and finished my lunch. It was the most honest conversattion I've ever had with a fundy.

Date: 2006/05/14 05:15:34, Link
Author: BWE
T-diddy,

First: you are an idiot.

Second, If we follow PuckSR's idea out to it's logical conclusion, and actually did the reaseach, we might find a gene that predisposes one to some higher likelyhood of gayness. But we probably wouldn't find one that makes you gay. So all you need to discover is the continuum. That isn't how that kind of trait works. And T-diddy, you are an idiot. If there is a gene that makes you straight, what would happen if it was broken or malfunctioning?

Date: 2006/05/14 07:03:37, Link
Author: BWE
Davey, Davey, Davey,

The problem is that you are NOT answering questions even in the original thread, let alone a new one. You are just telling us what your pastor told you to think. We already know that stuff. In fact, some of the people here could have a deeper discussion of Biblical matters that your pastor probably could.

You are trying to poke holes in minutia and claiming that you are making inroads. You pop a bubble and claim that the bubble machine is not full of soap.

At first, I thought you might be truly thinking that you would like to be educated but that thought quickly evaporated. Preach away buddy. You can join the ranks of the provincial god's last gasps. The unfortunate fact is, you need to be able to modify your spiritual practices to include  the ability to assimilate evidence. Don't get rid of them, we wouldn't want you to lose all your moral guidance and start raping and killing, but modify them.

You are telling us that you know something. well prove it. Answer that list of questions I asked. Because those are the foundation of the kind of science that you want to be able to critique. But do you walk in to your shop teacher and tell him that you have just proved that a table saw doesn't "actually" make straight cuts?

Your appologetics get lame as soon as you delve into them. Your questions have been answered. You just refused to recognize that. Don't talk about genetics like you know anything about it because it just makes you look dumb.

Want to debate the age of the Earth? That might be a better place for you to start. The info is a lot more managable for a guy like you. Maybe you should start there. Then move on to a geologic timeline- You know, so you can get a sense of proportion.

Date: 2006/05/14 08:51:03, Link
Author: BWE
I can see T-diddy shaking with confusion right now.  

"Homo bad, bad homo, gen^^**tic ...Not, is, is, not, Homo bad, bad homo."

PuckSR,
That sums it up nicely.

Date: 2006/05/14 14:09:18, Link
Author: BWE
T-diddy,

Are you trying to say that being gay is a bad thing or are you trying to say that a gene selecting for gayness ought to select itself out?
Quote
Would this not represent a refutation of evolution?  Or more modestly, would this not at the minimum represent a bad mutation naturally selected?  What in evolution would justify a selection of a "gay gene?"


Because your original question has been answered in oh so many ways by every one in this thread. No, it would not represent a problem with ToE.

On the other hand, how do you justify saying it is bad to be gay? Or good for that matter? Or how come you need to know about or at least care about other people's sex life?

What is it T-diddy? Why do you hate gays?

Date: 2006/05/14 20:57:47, Link
Author: BWE
Maybe. I, however, get some kind of a cheap thrill from folks like him. And, I can still post there because I am nice.  :)

Date: 2006/05/15 04:53:22, Link
Author: BWE
Fornicators. That's what my guy was saying.

So what do you say to a fundy like AFDave who just doesn't know enough to even ask intelligent questions?

It's not that you have to know all that stuff, it's just that if you are going to argue against evolution- then you have to know that stuff. Because you will inevitably not understand the main ideas of niches and geologic time.
??

Date: 2006/05/15 05:13:46, Link
Author: BWE
Mperkel, what do you do at service? I have a few ideas. Do ou have a website?

Date: 2006/05/15 06:02:49, Link
Author: BWE
I'm sorry, I just can't get past this. here it is interactively for Dave

And here it is in writing.

Speciation isn't something that happens quickly and AFDave is trying to fit it into his unbelievably, drastically, horrendouly, misunderestimatedly compressed timeline.

When did the split occur Dave? around the time of pharoah? Oh right you don't think there WAS a split. Interestingly, you sparked a conversation between two people who DO know what they are talking about and got some interesting info.

Arg. ???

Date: 2006/05/15 13:09:45, Link
Author: BWE
Quote
But at any rate, the fact that organisms other than humans occasionally manifest homosexual behavior pretty much puts the final nail in the coffin on Thordaddy's absurd claim that homosexuality is some sort of "lifestyle choice," and that it is somehow "against the natural order of things."


Jesus, I was hoping someone else would say it but-oh well:

Masturbation, oral sex and other stranger and more ingenious methods of inducing ejaculation ought to point to the fact that we're just damm horny. Have you ever heard the expression, "Thinking with the little head?"

The continuum is one of many shades and nuances.

Date: 2006/05/15 13:47:51, Link
Author: BWE
Quote
Tyson’s phony dramatic delivery gets tedious real fast, especially with lines like “the building blocks of life arrived special delivery – from outer space!” and “photosynthesis: a clever invention; once it started, it was a runaway success.”  One can only hope this childishness will backfire on today’s precocious youngsters (especially home schoolers).  Maybe this series will be useful some day, to demonstrate what certain mad scientists believed in the early 21st century.  Young minds who don’t know better (especially some public schoolers) should be inoculated against raw propaganda and non-sequiturs like since life is found today in extreme environments, it must have evolved there.  Best give them a chance to learn basic logic first.


This one's for lenny.

Date: 2006/05/15 15:45:35, Link
Author: BWE
Which leads me to wonder, when corals, jellyfish and others of their ilk (Cnidaria and maybe some flatworms??) are reproducing asexually are they following god's plan? and when they are doing it sexually are they being deviant? And how the hel! would you know if they were gay? Or do they have to do it for the halibut to go to he!!? Is every sperm sacred? Is every sperm good?

T-diddy, this is getting confusing. I'm starting to really sweat. (Of course it is 93F in Portland today).

But seriously, you've got us on the ropes. I can't tell where gay stops and deviant starts. I mean, I can't tell where normal stops and molluscs start.  I mean, I don't know if that was my dog or my goat or my uncle last night. Jesus, I gotta lay off the hooch.

Where is the local place to get saved. I think I better go there.  @*Hic !**

Date: 2006/05/15 16:11:40, Link
Author: BWE
That's the problem with god, every time we try to pin something on him we realize it's just projection. :(

Nothing in his world seems to relate much to ours.

Date: 2006/05/15 18:00:14, Link
Author: BWE
Sir T- Have you seen this book? My boss won't buy one. :(

As regards Jennifer, I might have heard of her. Is this her?
(PDF File)

Date: 2006/05/15 18:44:30, Link
Author: BWE
One place for crime statistics... Not enough detail but, well..
http://www.fbi.gov/ucr/cius_04/

Wow, GoP, I was just about to go along with you there but you got wierd and went all goofy.
You Say:
Quote
1) The proportion of majority-on-minority crimes given saturation coverage by the media does not match the true proportion of such crimes, as measured by federal surveys and crime statistics. Roughly 7 out of 8 violent interracial crimes are minority-on-majority..... yet the media's coverage implies the opposite. Why?


And I can kind of track with you. But I would say:

Why wouldn't you open up a competing media outlet that printed all of the crazy crime? If there is a market then people will buy it. Oh yeah, Jerry Springer is doing it already. GoP, Have you ever read the website
www.mediamatters.org
?

It's a left wing website that dedicates it's energy to pointing out a conservative bias in the media. They do a good job of it too. But, the funny thing is, it's not a conservative SOCIAL agenda, it's a conservative POLITICAL agenda. It's maybe not surprising then once you think about it. Liberal folks write about liberal things and buy liberal things and conservative folks write about conservative thingts and buy them too. It feeds on itself. I could certainly entertain that hypotheses and investigate the numbers.

But then you say:
Quote
For the liberal, only the underdog motif counts. The liberal doesn't care about the social group as a cohesive unit - he merely wishes to consume the technological and moral fruits of his society. The individual is all. Any talk about tradition, and how past visions are necessary for a healthy future, is dismissed as reactionary griping. Being the eternal teenager, he doesn't recognise the moral, intellectual, and physical effort that went into creating the West - he merely skims the cream, and complains that there isn't enough to go around. He doesn't care about how his policies damage society - after all, the future is now, and future generations can go rot. And why not? The liberal has no children to care for, no religion to uphold, no rituals to follow - past, present, and future intertwine into a perpetual present, stripped of any context that endows life with meaning. If it feels good, do it, man! But such nihilism can never be content to be, and must itself mirror the drives of the healthy society that surrounds it. So the liberal sets himself in opposition, so that he may create through destroying, give life through abortion, innovate by quashing.


And I'm thinking, " I hope this guy doesn't know how to make a bomb."

Quote
THE PSYCHOLOGY OF MODERN LEFTISM

6. Almost everyone will agree that we live in a deeply troubled society. One of the most widespread manifestations of the craziness of our world is leftism, so a discussion of the psychology of leftism can serve as an introduction to the discussion of the problems of modern society in general.

7. But what is leftism? During the first half of the 20th century leftism could have been practically identified with socialism. Today the movement is fragmented and it is not clear who can properly be called a leftist. When we speak of leftists in this article we have in mind mainly socialists, collectivists, "politically correct" types, feminists, gay and disability activists, animal rights activists and the like. But not everyone who is associated with one of these movements is a leftist. What we are trying to get at in discussing leftism is not so much a movement or an ideology as a psychological type, or rather a collection of related types. Thus, what we mean by "leftism" will emerge more clearly in the course of our discussion of leftist psychology (Also, see paragraphs 227-230.)

8. Even so, our conception of leftism will remain a good deal less clear than we would wish, but there doesn't seem to be any remedy for this. All we are trying to do is indicate in a rough and approximate way the two psychological tendencies that we believe are the main driving force of modern leftism. We by no means claim to be telling the WHOLE truth about leftist psychology. Also, our discussion is meant to apply to modern leftism only. We leave open the question of the extent to which our discussion could be applied to the leftists of the 19th and early 20th century.

9. The two psychological tendencies that underlie modern leftism we call "feelings of inferiority" and "oversocialization." Feelings of inferiority are characteristic of modern leftism as a whole, while oversocialization is characteristic only of a certain segment of modern leftism; but this segment is highly influential.


Is this accurate GoP?

Date: 2006/05/15 19:00:49, Link
Author: BWE
Thanks for the link! I think I'll buy it myself.

I've heard her name in the salmon circles maybe dealing with aquaculture? Not sure, I just remembered that report and pop! googled it on the first try. Go figure.

I'm not a salmon guy really, I deal with offshore groundfish counting, recounting and politicking. Er, I give reports and presentations to people who tell people who tell people who know politicians who tell My Boss's boss's boss that somewhere down the line, he should get someone to give reports to someone who can educate the office of _ who can explain to _ who can then report back to the ambassador who can then tell the Canadians what we think we should do this year. Mostly rockfish (Sebastes) above 40 fathoms to be more specific -although various other fisheries are involved in my job too. But it does provide some good fishing trips.

Date: 2006/05/16 12:04:40, Link
Author: BWE
Quote
Humans are more closely related to starfish  than to 96% of organisms out there.


Be careful, the starfish will get uppity about that one. They are pretty darn proud of their own evolutionary successes.

Seriously Dave, you are trying to do rocket science when you don't have basic physics down. Before any of this works, you need to understand why scientists believe that the earth is around 4 1/2 billion years old.

So please, before you go on and on about genetics, let's establish the age of the earth, and the age of the universe. And what we can and can't know given current understanding. Like, it's ok to have your god hypothesis but you have to understand that 100% of the evidence so far pushes your understanding into the realm of provincial superstition. Sorry. Not kind words I suppose but you are wrong. And education could fix that.

Date: 2006/05/16 12:20:20, Link
Author: BWE
Well, I believe everyone deserves a fair shot. I also believe that it doesn't much matter in the long run.

I have a friend who has a masters in divinity from Yale. He has offered an opinion that some people absolutely need a simple religion with absolute black and white. He thinks that it is better that they have a simple religion than no religion.

This he says while we are at a meditation retreat run by a Thai Zen buddist and a morroccan Yoga master.

I just have such a different view of things.

Date: 2006/05/17 05:36:41, Link
Author: BWE
Well well well. The time has come.

Dave, you are an idiot. Your vacant mind is incapable of synthesizing information into understanding.

I sincerely hope that your children do not end up as misguided as you. Not for them but for me.

Your head is crammed securely up your ass and you have nothing valuable to say. Your god is a pathetic little provincial bigman who can't even say boo to my god because my god is so much stronger and braver than your god. And my god makes better things than your god.

Also, I can run faster, jump higher and screw better than you can.

Your friends don't really like you; they are just pretending.

:)

Wesley, your other thread was precient in that you don't really want to have a poster who is simply an object of ridicule. Is this correct?

Date: 2006/05/17 05:45:59, Link
Author: BWE
Davey dog,
What up bone? (head)

Oops, better go look in the mirror, you put your Christianity on backwards. Does it hurt to be as ridiculous and stupid as you are?

You got rhythm but you got no soul.
Your head is planted in your ass hole.
You think you're smart and that's ok
Because it's more fun for me that way.

Just a little ditty I wrote. Maybe you could put it to a tune? Anyone?

Date: 2006/05/17 06:00:07, Link
Author: BWE
Quote
Well well well. The time has come.

Dave, you are an idiot. Your vacant mind is incapable of synthesizing information into understanding.

I sincerely hope that your children do not end up as misguided as you. Not for them but for me.

Your head is crammed securely up your ass and you have nothing valuable to say. Your god is a pathetic little provincial bigman who can't even say boo to my god because my god is so much stronger and braver than your god. And my god makes better things than your god.

Also, I can run faster, jump higher and screw better than you can.

Your friends don't really like you; they are just pretending.

:)


Oh yeah, I forgot one thing. You harbor deep feelings of regret over your homosexual experimenting in flight school but I don't think any less of you. :)

Date: 2006/05/17 07:30:32, Link
Author: BWE
Hey Davey-dog,

When Noah got drunk and his sons made fun of him, what was the lesson in that? What happened to the Dinosaurs again? Oh yeah, your too freakin' stupid to tie your shoes, that's right.

If it was good enough for the hebrew children, it's good enough for me. *hic!*
:)

Date: 2006/05/17 08:08:04, Link
Author: BWE
T-diddy,
You are an idiot. Besides that, you never answered my questions.

Date: 2006/05/17 10:35:35, Link
Author: BWE
Or we can just make fun of him for his utter stupidity.

How does plate techtonics work Davey-dog?

What does the speed of light tell us?

Does it hurt to be so stupid?

I don't know about the rest of these folks but I for one gave you a chance. You blew it. But, in retrospect I suppose I'm not surprised. You have proven yourself to be an idiot, just like evey other YEC who comes to argue.

Date: 2006/05/17 11:54:32, Link
Author: BWE
Let me amend that statement to say that the things he says are stupid. Davey-dog himself is a joke.

Date: 2006/05/17 12:28:41, Link
Author: BWE
That picture was what I was referencing. It clearly shows his head up his ass. It's surprising that this typing isn't more muffled.

By the way, I am still reading that paper you wrote and I am curious whether you tried to measure any of the wild responses as a control group. i.e. did you watch an event in the wild and then try to recreate it with your fishy in a baggie? And if so, did you set up a categorization system for natural responses that was separate from your experimental response? -(what did you do to control for the effect of the baggie and the observer)

-I appologize if you cover that toward the end, I haven't quite finished yet.

Date: 2006/05/17 12:46:13, Link
Author: BWE
My aquaintances who opted for military service are either out because they finished their time or are heavily into the officer thing. None were even, as far as I know, Christian.

Sorry on the other, I got confused which thread I was in.

Date: 2006/05/17 13:12:55, Link
Author: BWE
By the way, I am still reading that paper you wrote and I am curious whether you tried to measure any of the wild responses as a control group. i.e. did you watch an event in the wild and then try to recreate it with your fishy in a baggie? And if so, did you set up a categorization system for natural responses that was separate from your experimental response? -(what did you do to control for the effect of the baggie and the observer)

-I appologize if you cover that toward the end, I haven't quite finished yet.

Date: 2006/05/17 17:28:04, Link
Author: BWE
AF Dave, once again, your stupidity, ignorance, pathetic excuses for ideas, intellectual self imolation and utter ridiculousness defy the imagination. Well, only if you have the imagination of someone as stupid as, say, you.

I'm sorry to anyone here who thinks Dave is merely dilusional. I would say that you have made an incorrect assessment.

Dave, you are really stupid. I'm sorry but the best advise  you could get is to stop thinking entirely. Just pick someone to believe, believe them and keep your mouth shut. Smile. It will keep you from showing just how far on the left side of the bell curve you really are.

Don't feel bad. Lots of nice people are as fantastically stupid as you. It's not a bad thing. But if you are concerned about things like, whether people make fun of you, or whether you need to make a toast at a wedding or something, it'd be better to say less.

Tell me about magnetic reversals on the seafloor Davey-dildohead. Go ahead, ... let me guess, GodDidIt! Right? HaHahahahahahahah!!! Jesus you are stupid. You make the animals you insult look smart in human terms. Oh  moron of the flying kind, doest thou insist on burying your head so deeply within your nether regions?

Idiot.

Date: 2006/05/17 17:34:13, Link
Author: BWE
Quote
Heh, I had to add this, given that AFDave thinks he's as "dangerous" as Newton and Maxwell.

You're not, Dave. You're a mediocre mind given to delusions of grandeur.


That is waaaaay to kind. I would compare his intellectual ability to another life form but none process less info than moronic sam freedom flying greased pig chasing head faaar up his ass moron idiot dave.

Idiot. Tell me how scientists figure out how old a fossil is. Oh yeah, your too stupid. Sorry. Hahahahahahah!

Idiot.

Date: 2006/05/17 17:47:26, Link
Author: BWE
He's too stupid to know he's stupid. Now I am simply entertaining myself by coming up with creative ways to call him stupid. He's stupid the same way that Everest is big or the Mariana Trench is deep. I want a moron's view of plate techtonics though. Maybe dumbsh!t Dave will forgive me (turn the other cheek and all) and give me his biblical , hahahahahah, slap, heave, hahahahahah, biblically derived view of plate tectonics.

Go ahead Davey-dog, What do everest and mariana trench have to do with tectonics? How many freakin angels does it take to save a poor sot like me. Hahahahaha... I'm cryin, your so stupid. Jesus Chrimeny, you're so stupid you waited for the stop sign to say "go". you're so stupid you sit on the tv and watch the couch.

Date: 2006/05/17 18:37:37, Link
Author: BWE
yee haw! let's see what you got

Date: 2006/05/18 05:24:49, Link
Author: BWE
Hahahahahahahahahahaha!!!

I forgot, Davey-dog, where are we in the sequence? Are we at the part where GodDidIt yet?

Hahahahahahahahaha!!!! Jesus you are stupid. Does it hurt?

I'll make you a challenge Davey-dog:

I'll debate you in a post for post debate and if you can prove me wrong in my hypothesis that you are an utter moron, then I'll let you write a post on my blog. If I win, you let me write a post on your blog.

The question will be the age of the earth. I argue for over 4 billion years, you argue for something less than that.

Idiot.

Date: 2006/05/18 05:48:44, Link
Author: BWE
The only serious tropical diving I have done is around the florida keys and I was way more interested in the barraccuda than the various reef fish but one thing occurred to me on my last trip there. I was diving with a guy who had been diving the area for a long time (He was a little older than me), who said that color in general of the various reef fish changed with the health of the reef. Especially with the prevalence of large fish. He didn't have any data to back up the assertion but he has been diving the area for a long time so I assume that there is some sort of phenomena he has observed. He claims that brighter reds tend to give way to muted oranges and yellows tend to give way to yellow blotches as a reef loses health. (same fish, different colors)

Your piece got me thinking. What do the adults see? Not that there is an answer to the advantages but maybe the adults have a harder time recognizing the juveniles as fast. You could design an experiment to determine response times for adults to react to different colored juveniles.

I guess that would fall under the same heading that other reef biologists have been studying for some time -"why the color?"-

IIRC, A guy in Australia analyzes the spectrums that different fish see and concluded that the damsel types and other, smaller fish see more UV than larger fish. Maybe it changes with age too?

-Funny aside, the fist time I went there, I brought my 6mm wetsuit and hood. Why, I don't know. But it gave me a chuckle every time I came back to the hotel and saw it lying there.

Date: 2006/05/18 06:06:17, Link
Author: BWE
Jesus Davey,

WHy C.S. Lewis? WHy not Dostoyevsky? Any good philosopher knows that C&P is where it's at baby.  Oh yeah, you're not a good philosopher. You're an idiot.

Please, figure out how to lessen the pressure that your head is creating in your rectum. It might be easier to read the questions you have been asked.

Tell me about the himalayas Davey-dog. Why are they so high? Why are the Appalachians so low? Why are there fossils of the same creatures on both sides of the Atlantic when the modern creatures are so dissimilar? Does your god prefer pepsi or coke?

Idiot. Answer a question. Oh yeah, I keep forgetting, you are too stupid.

Date: 2006/05/18 06:09:02, Link
Author: BWE
Quote
As for BWE, I congratulate you.  I have been insulted a lot of different ways, some creative, some boring.  I have to say that this one takes the cake as the most innovative I have ever heard.  If you tell me your mailing address, I would like to send you a certificate for "Most Creative Insult of All Time."  I will be interested to see if you or anyone else can top this one in the future :-)


The guantlet has been thrown.

Date: 2006/05/18 06:21:57, Link
Author: BWE
OK, AF Dave (AKA moron) has just answered the question I asked at the beginning of this thread and now I believe that I can sum up the answer in a way that at least makes me feel good and that will satisfy my wish that Raging Bee not be too offended.

Here goes:

Have as much fun as you want, be as mean as you want as long as the fundy has met at least 3 of these requirements:

1. Answered a scientific question with a summary of a biblical concept.

2. Claimed to have evidence and not produced it.

3. produced evidence that is so laughable that you just can't answer with logic and evidence.

4. Used the words conservative or liberal to describe a broad section of the public that is bad/good.

5. Claimed that something must be true because x number of people believe it.

Once someone crosses that line, debate has ended and comedy has begun. And, I love comedy. So, wings, don't fail me now.

Date: 2006/05/18 06:38:53, Link
Author: BWE
Focault's Pendulum might be the most complicated book I ever read.

I read it before I read davinci code and boy oh boy are they different. Lot's of perspective.

Date: 2006/05/18 12:05:23, Link
Author: BWE
Key Largo, coral reef state park. I have relatives in Jupiter (West Palm Beach) and that's where we go. It's closer.

To select for OCC, spectrum is my best guess. Imagine a creature that can see infra-red and babies that develop exceptionally good insulation. Wouldn't matter where the babies ended up.

That is the luxury of grad school: You are ok with being crushingly poor.

And in Puget sound and the Pacific off Oregon Washington, 6mm feels pretty thin.

Date: 2006/05/18 12:39:38, Link
Author: BWE
I have a dry suit. I brought the 6mm because the dry suit would be too HOT! hahahaha. I do use the wetsuit sometimes though. There is a marine park off Muckelteo where some of the giant octupi hang and Puget Sound warms considerably in the late summer. (I'm thinking ~55F?)

I was thinking terrestrial with infrared. Just that I couldn't think of what you might see with UV.

I chose my thesis to ride on someone else's grant money because I was lazy and because it was fun and because I was quite poor. I had seven 80 gallon tanks to tend! Only a few boat trips even necessary.

No fire sponges but I got a small nick from a stingray and owww owwww owww they hurt. I felt like achilles. Lots of Barraccuda down there. I don't know how people ever get used to that. Now you see em, now you don't.

Date: 2006/05/18 16:25:20, Link
Author: BWE
That's pretty harsh coming from a guy that can't wait to get to FSM heaven. (Not that I blame you, jesus, a beer volcano, I'd think I died and went to heaven, er.. nevermind)

An objective moral code may indeed be possible, but I have to agree with the beervulcan that yours isn't.

But don't let that stop you. The nice thing about moral codes is that they make you feel good. Sometimes, you just need to write it down so you understand where you are coming from. Then you feel good. Decency is a hard word to pin down and it is the central tenet in many moral codes. That doesn't make them any less capable of helping you get along.

I think you are just expressing your frustration with the fundy tendency to want to force the rest of the world into some wierd kind of slavery and using expressly lies, violence and coersion as their primary tools. I'm guessing that is what you are expressing; a resentment of that fact.

Am I close?

(The next session will be $125, payable to PT)

Date: 2006/05/18 16:32:22, Link
Author: BWE
Quote
Quote
Don't let those big meanies get to you. All of their claims, when examined with blind eyes and numb brain, fail to support their case. Here's a random quote from the guy whose ass I'm not fit to lick because I can't understand a single word he says. Note that because this guy talks down to the authors of the paper he mistakenly attacks, he comes off with an aura of authority I personally find sexually appealling, and you will too!


My vote for Best post award.

Steve, chastize me? Me,? Well, I never. Have I done anything to upset anyone? Would I do anything to upset anyone? I mean, I stick to the highest moral code.

Date: 2006/05/18 16:52:52, Link
Author: BWE
What is it about the word horny that you guys don't understand?

Have you ever wondered why guys in prison have gay sex? Because they have moral inferiority as evidenced by their incarceration? No. Because they are horny. Now if you are a little boston terrier and you owner forgot to fix you, you will hump #### near anything that moves. We as people also have a big head to help temper the little one but essentially we do what it takes to achieve orgasm.

If some folks for whatever reason have the switch set backwards, it doesn't lessen their horniness. Come on T-diddy, GoP, every single woman you see, you look at her breasts, hips, Posterior, and stomach. You assess not whether but how it would be first. Whether she is 16 or 65, you do this. We have the good fortune to be able to temper this impulse with positive social skills.

Let's try this one:

You haven't had sex in 2 years and your hands are both in casts. Say you walk down a street every day. One day, a prostitute offers sex for cash. You find the offer repulsive and say no. You get home, stare angrily at your cruel casts and open your mind just a crack. The next day you say no, and the next, but at some point you crack and say yes because you can't stand it. You get your BJ or whatever and she leaves. You feel terrible. You are consumed with guilt because you had such a mental block to it before you did it.

Now, it is a man.

Correct me if I am wrong but that is the situation you are trying to prevent, right? By not allowing gays into the culture, you are trying to prevent people from having this situation to deal with?

This is a serious line of inquiry. It is not a trap or anything, I just want to know why you care about gays so much.

Date: 2006/05/18 20:37:21, Link
Author: BWE
Quote
(I forgot who said this one)
I only brought up the intelligence business because it seemed to me that some of the arguments recently were getting sloppy and basically just calling Dave stupid.

stevestory:
He probably is fairly rational in day-to-day life, just nothing related to science w/r/t conflicts relavent to religion.


Well, steve, you certainly like to look on the bright side...er...

AFDave, I hope you know that I don't have any hard feelings about your stupidity problem. I could believe that you used to be able to think. You are probably a nice guy in that too dumb to tie your shoes kind of a way.

But you are an idiot. That is my hypothesis. And my hypothesis is easily disprovable. I challenge someone to prove me wrong. Show me three sentences strung together coherently.

Date: 2006/05/19 04:55:29, Link
Author: BWE
read this link Davey-dog and see how much you understand.

Your entire last post was simple appologies and defensive piles of horsesh!t Davey dog. Like all your other posts. Quit putting off and star4t putting up. You do know that you are desicively swaying those of us on the fence away from your brand of creationism? Who would want to say they were converted by someone as stupid as you?

Answer some questions.

I have to run off to work now. Would someone please make a short list of simple questions Davey  could answer? Or Davey-dog, why dont you go back and find one yourself.

Here's 2:
WHy are the Appalachians not high but the himalayas are high?

How come scientists think the can use DNA as a sort of a clock? (I think it's in the article above)

Don't write anything else until you have answered those 2 questions.

Date: 2006/05/19 07:50:45, Link
Author: BWE
Quote (PuckSR @ May 18 2006,22:10)
so BWE...your theory is that homosexuality is an issue of your sexual drive and oppurtunity???

Wow...so its not a choice...it just means your open minded and horny as heck.....

I don't know if I have a theory exactly. Genetics would certainly drive elements of sexuality. But horniness ought to have a strong component. I mean, really, haven't you ever felt like just finding a hole in a hollow tree an lubing it up and praying there aren't any bees? It doesn't mean you do it but, feelings in general are the result of genes aren't they?

What I was really getting at is what is T-diddy trying to save? or stop? or say?

It seems to me like some people get pretty hung up on sexuality and have a lot of socially contructed beliefs that affect their emotional reactions to various activities. T-diddy made the claim that a society that allowed sheepfocking was objectively "crumbling" because of that social norm. I replied that, without more evidence, all you could objectively say is that the society allowed sheepfocking. But T-diddy obviously had a problem with sheepfocking. He made the assertion that there was some connection between human sexuality manifesting between two people of the same sex and sheepfocking. I am examining the construct that underlies this assumption.

Horniness.

In the absence of social norms, getting off is pretty much just getting off. We are obviously predispositioned to try to get someone of the opposite sex if possible but we don't really have periods of "non-horniness". So, "is there a genetic component to gayness" has to be seen in the context of the memes that interact with our emotions as well as the situational aspect of our human sexuality.

Also, T-diddy will have to consider that if he chooses to answer the question.

Is T-diddy advocating using legislation or other normative techniques to reduce the opportunity for these situations or is he just randomly against homo sex?

Date: 2006/05/19 09:22:56, Link
Author: BWE
Davey-dog. You are an idiot. Define Spanish. Be careful, that's a trick question. Next Define spanish around the time of song of roland.  

I'll take your bet. But the stakes are different. If I win, I get to write a post on your blog, if you win, you get to write a post for my blog. and one more thing, please answer some age of the earth questions.


Just because I think you are stupid, I am not going to do any preliminary research.

And I am making some assumptions about your claim:

1) the portuguese language substantially changed beginning in the year 1143.

2) The Spanish you are referring to is Castilian

3) The french language and the Castillian language are the major components of modern Portuguese.

4) the dialect of Portuguese you are referring to is the one spoken in Lisbon.

5) That you are making an all or nothing claim similar to  your others (there are no gray areas)

Date: 2006/05/19 09:33:20, Link
Author: BWE
I'll do better. I took your bet with modifications to make it make sense to me. Go look. Idiot. :)

You know Davey-dog, I would stop insulting you if you could demonstrate a little honesty or intelligence. Either one. Read Dante's Inferno for more details on this.

But you are a wanker pure and simple. Nothing upstairs and afraid of what's going on downstairs. And, you are demonstrating behavior and thought processes that earn you the distinction of noted stupidity.

My wiener is smarter than you.

Have a nice day :)

Date: 2006/05/19 09:39:55, Link
Author: BWE
I'd worry about a career involving dangerous equipment.

Date: 2006/05/19 12:06:22, Link
Author: BWE
Rilke,

Darnit. You took some of my thunder. How am I ever going to get dave to take part in a real debate if you spoil it for me?

(P.S. there is a french influence, but Davey-dog has his history messed up)

Davey-dog, you are an idiot. I rest my case.
But I am still having fun making fun of you.

And for anyone who harbored a doubt that Davey-dog was as fantastically stupid as he appears,...Well, I will continue to provide evidence to the contrary :)

OK Davey-dog, how come the Appalachians are low and the Himalayas are high?

Please tell me that you can prove that god made them that way.

By the way, forget what these other guys say, you are probably right on the portuguese thing. I am afraid that I will lose the bet I so foolishly made and you will be writing a post for my blog.

Anything I forgot? Oh yeah, you are an idiot.

Date: 2006/05/19 14:26:09, Link
Author: BWE
He keeps coming back. Haven't you ever seen a 3 stooges episode?

Date: 2006/05/19 14:46:01, Link
Author: BWE
Quote (thordaddy @ May 19 2006,18:47)
ericmurphy,

The point is that those of your mentality are convinced that those that advocate for traditional marriage and advocate against the "normalization"of homosexuality do so out of bigotry and hatred for homosexuals.  You are either an unwitting pawn of the radical gay agenda or you are perfectly aware of your duplicity.

Why can't it just be a matter of OUR heterosexuality?

You don't want to have an "aversion" component to homosexuality because it would indicate an "aversion" component in heterosexuality.  And this "aversion" component for heterosexuality would go a long way in explaining RATIONAL and REASONED discrimination against homosexuality.

And the more you mudding the waters of what it means to be "homosexual" the more you give credence to those that say all sexual proclivities outside of heterosexual reproduction are mere CHOICES.

I was going to shorten your quote to just the good parts but it's all so darn ridiculous, I just included the whole thing.

First, How does A lead to B in your first Paragraph? Please elaborate, I am really interested. Right now it is just untinelligible gibberish.

2nd- Why can't it what??? Dude, you just thoroughly emasculated yourself with that one.

3rd- Rational and Reasoned ... in bizarro world

4th-Choices driven by the genetic urge to get off. We didn't get a highly discriminate horny button.

Tell me again T-diddy, how do societies collapse?
What about my hypothetical situation posted above?
I am getting confused between the mackerel brains posting around here. How old do you suppose the earth is?

Date: 2006/05/19 16:03:43, Link
Author: BWE
Ok, one at a time
Quote
Quote (thordaddy @ May 19 2006,18:47)
The point is that those of your mentality are convinced that those that advocate for traditional marriage and advocate against the "normalization"of homosexuality do so out of bigotry and hatred for homosexuals.  You are either an unwitting pawn of the radical gay agenda or you are perfectly aware of your duplicity.


First, that's a big supposition to assume eric's mentality. but that aside, how does being "convinced that those that advocate for traditional marriage and advocate against the "normalization"of homosexuality do so out of bigotry and hatred for homosexuals."

lead to being "either an unwitting pawn of the radical gay agenda or ... perfectly aware of your duplicity."

Date: 2006/05/20 07:50:56, Link
Author: BWE
I think I might have proved my point. Wow. Easier than I thought. And I didn't even have to trot out a single shred of evidence.

That, perhaps, is what AF Davey-dog was hoping to accomplish. Maybe fundies see the intelligent. educated segment of the population consistently doing that and they figure that's how debate works.

I was hoping for more of a challenge than that. Maybe Salvador.

Date: 2006/05/20 10:48:25, Link
Author: BWE
OMG, or rather,... OM(Not)G.

Date: 2006/05/20 12:27:31, Link
Author: BWE
Just more potential excersizes for those of us in the "Ironic Humor School of Creative Writing".
Quote
The point is that those of your mentality are convinced that those that advocate for traditional marriage and advocate against the "normalization"of homosexuality do so out of bigotry and hatred for homosexuals.  You are either an unwitting pawn of the radical gay agenda or you are perfectly aware of your duplicity.

Why can't it just be a matter of OUR heterosexuality?

Because OUR heterosexuality happens within US, not THEM. When YOUR heterosexuality happens within THEM then THEIR homosexuality happens in YOU and the space aliens return to probe YOU again. Then YOU become THEM and THEY become rulers and force YOU to have GAY SEX with GOATS!

Got that? Write that down.

Date: 2006/05/20 12:32:04, Link
Author: BWE
Quote
be the change you want to see
-ghandi

Date: 2006/05/20 12:36:43, Link
Author: BWE
So Davey-dog, Are you taking my wager? That is pretty darning evidence you've got there. I really wish I could retract my bet but, unfortunately, I already made it. I agree that Rilke was a little simplistic. It will be a hard debate, but I will do my best. So?

Date: 2006/05/20 18:01:55, Link
Author: BWE
Quote
Hey BWE ... thanks for offering to pay up when you lost a bet ...  no need to really pay up though

Oh ... and you can call me an idiot anytime you want to because at least you're funny while you do it ...


I'll pay up gladly. Once I lose. Unless I am mistaken, I haven't offered anything to the debate yet. My question was. Are you taking me up on my revised bet?

Buddy, I don't mind losing but I like to play first.

And, as far as I can tell, you did, in a very small way, set a trap for people who were only too willing to believe you were an idiot in all you say. My hypothesis is that they are still right. Now, about that bet?

Date: 2006/05/20 18:15:54, Link
Author: BWE
I'm quite sure Davey-dog will be offering a correction. I understand where he is coming from. Judging from the dates, I assume he is referring to the Auto de Partilhas being the first document written in what we can call portuguese. I think I can make an argument that he is wrong. It will in fact, prove Davey-dog's intelligence (or lack thereof) because I think either side could be debated well. I'm truly not sure if he knows something I don't. But like I promised him in that thread, I just think he is an idiot so I will do no research until he accepts or rejects my wager. Arden, I may need some help with verbs.

Davey-dog, you are an idiot.

Date: 2006/05/20 18:37:38, Link
Author: BWE
OK, so here is the deal. Davey-dog is an idiot. He has proven over and over and over that he is an idiot. He finally thinks he has a piece of information that he can defend. I think he is so stupid that he can't even defend a defendable position so I challenged him to back up what he says. He won't do it for the fundy-creo crap because, as most people know, it can't be defended. But I think he is so bone headed that he can't even brush his teeth let alone explain an idea when he is offered a counter argument. In fact, I am so sure that I offered to take him up on his bet.

The stakes are different because I don't want his money nor do I want to spend mine. But the winner still gets something good: a chance to post a creationist post on my blog or the chance to post an FSMist type post on his blog.

He seems pretty sure of himself so he probably knows a lot about the subject. I only have a passing interest so I figure it's equal. Idiot Davey-dog with info to start with and me having to look it up. One thing I am fairly confident of is that he will admit defeat in this subject if he loses or know when he has won if he wins. He may be dumber than his ideas about creationism but he isn't so attached to this.

And, Sir T, I too am examining a pathology. And what's good in it for me is that I don't care about the results. It's still funny. And fun.

Now, where did my sheep go?

Date: 2006/05/20 18:45:41, Link
Author: BWE
Davey-dog, AKA the bumbling baboon, AKA Alpo- now meatier than ever, I missed the part where you offered evidence. Would you please quote it in a post?

Why are the Appalachians not tall and the Himalayas very tall? I don't get that part. I prob'ly would have got it but God left our last conversation to go have gay sex with a sheep. He said he'd be right back. That was 30 years ago. I'm starting to think he's not coming back. :(

Date: 2006/05/20 18:55:46, Link
Author: BWE
Ericmurphy,

Um, I could make as good of an argument that English is a mix of germanic and french as I can that Portuguese is not what Davey-dumbo says it is. Typically, the history of a language is classified by the surviving writing. After William, most writing (that was'nt in Latin) from England, was in French for a longish period. I believe that the first written government document that showed a hybridization was around 1300. That's a lot of french.

Arden?

Uh-Oh. Dave, It looks like you have me over a barrel here. Just don't be too mean in what you write in your post if I lose, OK?

Date: 2006/05/20 19:55:00, Link
Author: BWE
I guess that would have been my basic argument. That, although the language of the countryside prevailed, it was drastically changed by the addition of the french. Read Chaucer then read Shakespeare, one right after another and you'll see what I mean. But, yes, English is Germanic in most syntax.

The language itself is something I know very little about. That holds for french and portuguese too. The history of western europe however, I picked up osmotically from my father who was a European History professor for 40 years and wrote 6 or 8 books on the period from roughly 1000 to Henry the Navigator. Honestly, I have never read the books. I also only took one european history course in college where my only recollection is writing a paper on the education system under charlemaigne and one that was a comparison of the Burgundian codes to Roman law. and that was 30 years ago.

The point I guess is that, although you could win if we had to debate linguistics. Davey has a fightin chance.

If I had a linguistics question, I'd ask you. Funny, but that's because I understand what being an expert is. That's why I would go to a bunch of folks here for info. Or other experts.

Davey-dog on the other hand is too stupid to pour his own water but he thinks his wife is crazy for telling him that the flat part of the cup goes on the bottom.

Date: 2006/05/20 20:06:37, Link
Author: BWE
Quote
Quote (thordaddy @ May 20 2006,17:50)
BWE,

Do you think discrimination against homosexuality is wrong?  Why?


Well... I guess I would have to say that I think you have your  brain in backward. No. I don't think it is wrong. Because there are so many choices you have to make before you ever get to the point where you have to decide to discriminate that there is no point in making a deal out that particular choice.

I suppose that I would ask that question in a different way:

Why do you care what other people do?

And, about the "Crumbling Society" bit, have you given my questions any thought?

Date: 2006/05/20 20:11:45, Link
Author: BWE
Darn you guys. Hasn't anyone ever taught you how to bait a trap? You don't just stand around drinking beer and smoking cigarettes after you set the spring.  :)

Date: 2006/05/20 20:19:09, Link
Author: BWE
But he hasn't "Lost". He hasn't done anything more than outline his theory and give the base facts which he intended to build off of. And that is what he has done in all his other arguments too. not one shred of evidence and examination. Not one.

Hey Davey-dog, do you wear dark glasses so people think the guide dog is because your blind?
Idiot.
Why are the Appachians so low and smooth compared to the Cascades or the Himalayas?

Date: 2006/05/20 20:22:55, Link
Author: BWE
Wow. Just wow.

Date: 2006/05/20 20:29:51, Link
Author: BWE
The necessary education appears to be critical thinking skills. You have to be able to recognize dead ends.
Davey-dog and T-diddy have been going far beyond tthe simple "ignorance is bliss" metaphor.

They are maybe this far.

Date: 2006/05/20 20:54:07, Link
Author: BWE
:) Can't slip anything buy you guys can I?

But k.e. uses the term frequently. Also provides that particular link frequently. So to me, the phrase has become his. I usally use, um, different* words to describe behavior that exhibits what some call cognitive dissonance.

* More akin to Stupid, idiot, moron, dumber than a shovel handle etc.

Date: 2006/05/20 21:18:07, Link
Author: BWE
Well, Dave has the option of evangelizing on this bullitin board or not. If he chooses to, I will torment him, if he chooses not to, I won't.

His psychology is messed up for sure. But we all have our crosses to bear, right?;)

I would love to see rational thought come from the guy. No matter how wrong or misguided. But I have no sympathy for the guy who needs to go out into the world and spread stupidity like a layer of peanut butter.

Stay in your cave and wallow in stupidity, otherwise, serve as an example for my children-the same way a mouse serves as an example for a litter of kittens :)

Date: 2006/05/21 06:56:53, Link
Author: BWE
Jesus Davey-dog,

What am I, chopped liver? I offerred to debate you on your stupid liguistic problem and you declare victory before your opening salvos. You present what you think is evidence but refuse to critically examine it. Like you do with your God BS.

You have got to do something about your cranial rectal impaction problem. You didn't win idiot. Not yet anyway.

Date: 2006/05/21 08:24:46, Link
Author: BWE
Thanks Bing,
I especially like the line at the end:
Quote
If you believe in evolution intead of Jesus, you'll end up in he!l


1/2 Davey, it's a good thing you believe in jesus instead of evolution. That way you won't end up in hel1 ... uh oh. Dumbsh1t Dave, Am I going to hel1? Will you tell me how to avoid it without having to lie to myself? I don't believe goddy, er, daddy, er, god wants me to lie to myself and others for some pathetic throwback to a time when god was the only good explanation we had.

Date: 2006/05/21 12:40:48, Link
Author: BWE
Quote
BWE,

I care if a radical super-minority tries to completely abolish a cultural institution that has served our country well even with the relentless assault that has taken place over the last 50 years.  I care even more when the decision to redefine this institution lies in the hands of a few black robes in one very radical state as opposed to the American people.  What an insult that the gay radicals who claim to be so "normal" are trying to subvert the American people and demand "rights" in the name of their homosexual orientation.  If they are seeking societal validation this is the wrong way to seek it.


T-diddy, Hmmm. relentless assault that has taken place over the last 50 years????

Um, what exactly has been assaulted and what is the price for having it pass away?

You said earlier that you "used" to be a liberal til you woke up and realized the lies. (or something like that)

There might be a better way to look at something like that:

I was stuck as an ideologue at one extreme and, because the extremes are the only part of the spectrum I know how to inhabit because of my poorly integrated neural circuitry, when I discovered the problems with the left extreme, I had to throw the whole kit and caboodle away and leap over to the other extreme. When I discover the absurdity of that extreme, I will probably curle up in a ball and start rocking... for the rest of my life.

What does this collapse you are alluding to look like? What bad thing happens?

Mmm. Are you posting under 2 names?

Date: 2006/05/21 12:47:55, Link
Author: BWE
Quote
see, BWE, i told you Dave was completely oblivious.

feel free to set your trap.  he won't see it, even if we discuss the details.


He is too stupid to take the bait anyway. He hasn't answered a single question from anyone because he can't.

Psychosis, severe head trauma and low self esteem from his poor performance in evangelizing are my diagnosis.

My prescription: Taking up the cloth and living on a mountain. Preferrably one 6000 years old.

Date: 2006/05/21 16:22:19, Link
Author: BWE
:)

Date: 2006/05/21 16:30:15, Link
Author: BWE
T-diddy, Hmmm. relentless assault that has taken place over the last 50 years????

Um, what exactly has been assaulted and what is the price for having it pass away?

You said earlier that you "used" to be a liberal til you woke up and realized the lies. (or something like that)

There might be a better way to look at something like that:

I was stuck as an ideologue at one extreme and, because the extremes are the only part of the spectrum I know how to inhabit because of my poorly integrated neural circuitry, when I discovered the problems with the left extreme, I had to throw the whole kit and caboodle away and leap over to the other extreme. When I discover the absurdity of that extreme, I will probably curle up in a ball and start rocking... for the rest of my life.

What does this collapse you are alluding to look like? What bad thing happens?

Quote
Let's say the 3 homosexuals ask for a state-sanctioned marriage, what will the progressive say about this gay "marriage?"


T-diddy, who cares what they say? What is the bad thing that happens?

Quote
Or, let's say that 2 gay adult brothers ask for a state-sanctioned union, what will the progressives say about this gay "marriage?"

T-diddy, who cares what they say? What is the bad thing that happens?

Quote
Secondly, civil rights apply to individuals and not groups of people.  Are you unaware of this simple American tradition?

Um. Jesus you are stupid.

Quote
Gay "marriage" renders marriage meaningless at any societal level.  If you're honest enough to answer the above questions then you will see it very clearly.

What are the different societal levels where the existance of gay marriage makes regular marriage meaningless?  It's not that I'm trying to pick on you t-diddy, it's just that you are so darnded stupid that it's hard to figure out what you mean.

Date: 2006/05/21 19:19:38, Link
Author: BWE
Quote
Once again, Thordaddy shows that he's definitely in the running for the award of dumbest fuck on the planet.
He's certainly made the short bus... er, list, hasn't he? :)

Date: 2006/05/22 04:44:02, Link
Author: BWE
So Daveey, does this mean you are taking my bet?

Date: 2006/05/22 04:56:48, Link
Author: BWE
Quote (Russell @ May 22 2006,09:13)
Imagine that about half the Portuguese vocabulary were identical to French, and half identical to Spanish. IF that were the case, would you have any reason to suspect that they shared a common origin, or could it be "just as easily explained" that the Portuguese independently just happened to pick the same words for the same things? After all, if the French picked a combination of phonemes to represent a particular thing, that shows that it can happen once, and there's no reason the same thing wouldn't happen in Portugal, too. And if it could happen once, there's no reason to doubt it would happen for half of the thousands of words that constitute the basic vocabulary. Anyone see anything wrong with this logic?

Beautiful.

Half-a-Dave, please help me out here. you seem to think you have won some contest or argument or something. I missed that part. Could you point it out to me?

And, on the portuguese and french thing,
I took your bet (modified the wager). As far as I know, we haven't begun to debate yet.

It bothers me that you are claiming victory before I have been able to muster a counter-argument. Also, I guess I should let you state your case first. I trust that you would
elaborate on your burgundian theory.

It sounds like you are pretty sure of yourself. I, am not so sure of myself. I fear I might have taken your challenge too hastily. Ah well, I took you for a fool and now I will have to back that up.

I could start a new thread for just that if you want. Maybe on my blog or yours.

It is troubling to me though that you are claiming victory when neither of us have offered any detailed evidence yet.

Date: 2006/05/22 05:00:56, Link
Author: BWE
So Davey, are you a\taking my bet? You do know that the founders weren't exactly christian right?

Date: 2006/05/22 05:12:40, Link
Author: BWE
Quote
Which way do you go, my progressives friends?  This is the argument I am stuck on because discrimination in the institution of marraige will either exist for all time at some level or the institution will simply not exist at all.
Right. It doesn't seem as if there are more choices does it?

You and AFDave have a running contest to see who can hit more branches as they fall out of the stupid tree.

Let me get this straight. You are claiming a collapse of society. Can you tell us what that would look like?

And, assume I am at home with my wife and kids. We are having a nice evening in the art room doing various craft projects. My daughter is playing piano.

Three doors down, a man is living with a goat and their union is sanctioned by the state. My marriage is in jeopardy?

(By the way, just to add some fuel to your fire, at my wedding, My good friend got a mail order ordination and quoted Khalil-Gibran, Ghandi and Thoureau. Hahahaha!- Maybe MY marriage is the one that is chipping away at the foundation of marriage in this country made strong by god guns and guts.!;)

Date: 2006/05/22 05:21:42, Link
Author: BWE
1/2-a-Dave, if you had another brain it would be lonely.

Are you taking my bet?

You are aware that the founders of this country weren't exactly christian, right? You just made that statement because you're not quite as smart as bait, right?

Tell me again why the Appalachians are low and smooth while the himalayas are high and craggy? And, I need a blueprint for your brain; I'm trying to build an idiot.

You don't know my old professor do you? He was conducting some experiments in Artificial Stupidity and the results sound a lot like you.

Are you taking my bet?

Date: 2006/05/22 05:25:19, Link
Author: BWE
And if I want to marry a goat because god tells me to, then who am I to criticize?

Are you taking my bet 1/2 a Dave? I just looked and saw that you are logged in so I know you are reading.

Date: 2006/05/22 05:32:11, Link
Author: BWE
Quote
A great example of a great Christian "tough guy" !!

*****************************************

You guys just can't get used to the fact that you lost the Portuguese thing, can you ...


John Adams was a deist too. You are so stupid I'm beginning to think it's a miracle.

I haven't even begun to debate the portuguese thing yet. Are you taking my bet? Have you, in fact, shot your whole wad to prove that it is a mix of french and spanish? I can only assume that you have only given the briefest outline.

But, 1/2-a-Dave,
Duh. You are an idiot.

Date: 2006/05/22 05:51:49, Link
Author: BWE
It's giving me a bit of entertainment though.
On the "necessary education" thread someone names Leonides posted this:
Quote
Leonides Posted: May 22 2006,07:27
 
Hi there.
I'm a lurker of several months and have been fascinated by the ongoing 'argument'. I jump in at this point since my background is Psychology, (I have a degree from UCL my Masters in Applied Forensic Psychology temporarily on hold due to real life intruding).

>What if we actually do get somewhere in convincing a creobot that their thinking processes themselves are disfunctional?

The problem here is that the thought processes actually are dysfunctional. There is no real way to alter the thought processes through a medium like this. It would probably require intensive deprogramming like you would try on Cult members.

If someone is open to evidence and so on then they can be persuaded. A lot of these people aren't (and in some cases don't want to be). I often feel that looking at the creobot responses, it's like severe anterograde amnesia that is specifically tailored to remove any evidence that is contrary to their world view. They may read and process responses then ten minutes later it's gone, which is why you find the same idiots re-posting on T.O. about Haeckel charts, the gaps in the fossil record and the rest of the PRATTs, despite being given refutations, links to Journals or the fallacies in their logic being shown up. Continuing the anterograde amnesia theme, I think some sort of 'Memento' style tattooing system might be useful, so they can think ''Haeckel', oh, look, on my forearm, um Haeckel, ah can't use that one.'

Date: 2006/05/22 06:12:56, Link
Author: BWE
Darnit darnit darnit darnit. You are giving away the farm. THere is still the off off off off chance that the only man to push IQ into negative integers would allow me to write a post on his blog.

But this is facinating. All of 1/2-a-dave's posts are now language lessons.

OK, I assume doofus won't take my bet. I also may be giving him too much credit (can you imagine?)

Judging by his dates, I have to guess that, if he were to trot out evidence (which he indeed might not have been going to), it would have been the Auto de Partilhas. As far as I know, this is the first document written in what could be called vernacular portuguese. I think it comes from 1150-80?? ish. I assume his argument would have traced the vocabulary to it's "French" origins. I bet I could trace it to it's "Latin" origins more convincingly. Also, I would have forced definitions of French and Spanish that I believe would have confused and confounded our man with too many yards between his goalposts. I was hoping to do that part too. Also, either way, I win.

Also, as was mentioned earlier, Despite the Norman invasion, English maintained it's basic syntax and borrowed essentially just vocabulary from the french invaders. However, the French words we got are a little closer to latin than modern french maybe. Arden?

Date: 2006/05/22 06:52:04, Link
Author: BWE
DDDDDDDDDAAAAAAAAAAAVVVVVVVEEEEEEEEE!!!!!!!!

AAAAAAARRRRRRREEEEEE
YYYYYOOOOOUUUU
TTTTTTAAAAAAKIKKKIIIINNNNGG
MMMMMYYYYYYY
BBBBEEEEEEETTTTTT
???????????????

When do we start?

Date: 2006/05/22 10:22:12, Link
Author: BWE
Quote
Quote
DDDDDDDDDAAAAAAAAAAAVVVVVVVEEEEEEEEE!!!!!!!!

AAAAAAARRRRRRREEEEEE
YYYYYOOOOOUUUU
TTTTTTAAAAAAKIKKKIIIINNNNGG
MMMMMYYYYYYY
BBBBEEEEEEETTTTTT
???

When do we start?

NNNNNNNNNNNNOOOOOOOOOOO!  I won already ... now be a gentleman and go help Rilke crawl out from under that big branch I sawed off.  I think she hit her head when she fell because she's hallucinating now.


No, you didn't win. I haven't even presented a case yet. How could you have won if I haven't even had my say yet?


Quote
I know you responded to my claim of 'no hominid civilizations' but I don't agree that some bones and cave writing is evidence for this.  My contention is that if apes and humans have a common ancestor, there should be lots of 'beetle brow civilizations' all over the earth with half ape-men who grunt a lot and have a simple language and are at some stage between chimps and humans.  These 'people' should be living today if evolution were true.

(Rilke-- I'm glad to see you believe in Jesus now ... maybe you could tell BWE about Him)



1/2-a-Dave,
three things:

1) What about evolution predicts the homonid societies? This is a point that merits some understanding of niches and ecosystems. And evolution. :(

2) Regarding Rilkes GD, Jesus, and Me: HAHAHAHAHAHA

3) Dave, it's not just because you are so stupid that I am making fun of you. It's because your stupidity is nearly equalled by your hubris in thinking that you are somehow making a case for anything.

-In the Portuguese/French thing: I could have let it go. I understand why you said what you said and I could coherently argue your case to some extent. But you have been so cosmically dense in all of your assertions that I was pointing out that you couldn't even support a nominally supportable claim if presented with an opposing side. I offered to provide that opposing side.

To prove my point, I suppose, you claimed victory instead of engaging in the debate. ???

which brings me to a fourth point. Anybody care to guess what that one is?

Date: 2006/05/22 10:28:07, Link
Author: BWE
Quote
I thought you said god was into sheep?  something about him going off with a sheep for 30 years or sumat?
And I get left with the darn goat. Rrrgh.

Date: 2006/05/22 10:34:20, Link
Author: BWE
GoP, You're alright no matter what everyone says about you.:)

When do we get to hear about the scale-free network dealy-thingy?

Date: 2006/05/22 12:28:56, Link
Author: BWE
hahahahahahahaha!!!!

WhooHoo.

HAHAHAHAHAHAH!!!

(wiping tears from eyes)

T-diddy,

OK, let's find out where you're going. They are all ok. So is sex with goats. Then what?

Date: 2006/05/22 14:09:10, Link
Author: BWE
OK, so go through a thread and analyze the methodology Davey or t-diddy uses. That's what I'd do first. See what the pattern looks like linearly. You could potentially find pressure  points.

Do it for 3 or 4 threads and patterns of short circuits should emerge. My guess is that the same "type" of question generates most of the short circuits. Maybe the 80/20 rule.

Devise a way to bypass the short circuiting mechanism and test it. You've got a lab right here. It'd be interesting. I'll help by asking provocative questions to get them blabbering once you know what you're looking for.

I've refined the art of baiting some so I might be able to offer some criticisms.

Good Luck :)

Date: 2006/05/22 17:07:40, Link
Author: BWE
Shhh. He's logged in. He'll hear you.

Date: 2006/05/22 17:26:12, Link
Author: BWE
How bout:
You know that you are right. Click.
You know that you are right. Whir.
You know that you are right. Click.
You know that you are right. Whir.
You know that you are right. Click.
You know that you are right. Whir.
You know that you are right. Click.
You know that you are right. Whir.
You know that you are right. Click.
You know that you are right. Whir.
You know that you are right. Click.

Date: 2006/05/22 19:02:33, Link
Author: BWE
Stagefright. He's logged on a few times I've noticed. The cat is out of the bag now. He's frustrated that the portuguese thing went south when he thought it was north.
Is thaty the tubes?

Date: 2006/05/22 19:30:16, Link
Author: BWE
Quote
Dave's Personal Testimony

Dave grew up in a Christian home, the youngest son of a Bible Translator for a native tribe in northern Brazil. He was saved at an early age and memorized hundreds of Bible verses as a kid thanks to the Bible Memory Association which included memory booklets, a reward system and camps.

Dave received an Electrical Engineering degree in 1986 and became an Air Force pilot the same year. During his Air Force years, he wrote thought-provoking Christian articles and flyers for distribution to co-workers. In 1996, Dave left the Air Force to go into business in the Kansas City area. In 2003, Dave sold his telecommunications business where he served as President/COO/CFO to a public company based in Leawood, Kansas.

Dave is married to the former [ name removed by me ] of Dallas, Texas and has five children - [names removed by me] Dave's four oldest children have been participants in the AWANA Bible Memory Program and have also attended Kids 4 Truth Clubs since inception. Dave has a unique vantage point with kids in BOTH programs at the same time. Dave's primary interest in Kids 4 Truth is in the power of the web for its ability to deliver THE TRUTH in a dynamic multi-media format. Dave currently serves his church, Tri-City Ministries, as a deacon, 3rd grade boys Sunday School teacher, baseball coach, Urban LIFE pianist, and volunteer pilot.


emphasis mine.

Human face on a strange man. I wonder what his AF buddies thought of his writing?

Date: 2006/05/22 19:37:01, Link
Author: BWE
Did you ever read "The Poisonwood Bible" by Barbara Kingsolver?

Utterly amazing book but it does leave you a bit sick.
Highly recommend it though.

Date: 2006/05/22 19:41:58, Link
Author: BWE
Well, I guess it depends on your definition of a happy ending. Yeah I suppose so.

Have you ever read anything by her? She is maybe in the top 10 american authors.

Date: 2006/05/22 19:44:54, Link
Author: BWE
If you could get just one post on UD, what would it say?

Date: 2006/05/22 20:09:58, Link
Author: BWE
Poisonwood bible is about a missionary's family in africa.

Fiction.

Quite sickening but incredible.

Yeah I know, I read too much.
Way too much.

Date: 2006/05/22 21:06:12, Link
Author: BWE
I'm trying right now. Ive put all his posts from one thread into one text file and I am posting them on a new post. Takes a bit though.

Date: 2006/05/22 21:08:17, Link
Author: BWE
afdave

Posted: May 08 2006,08:55  
DIFFICULT QUESTIONS REMAIN FOR APE/HUMAN ORIGINS

I appreciate the good information that was exchanged on my "Chimp Chromosome Thread."  I have learned some important information regarding the similarity of the genomes of apes and humans.  I agree that the similarities are quite striking indeed and cannot be dismissed as some Creationists attempt to do.

However, I believe there are a number of major issues which would have to be solved before a scientist could logically adopt the firm position that humans and apes DO IN FACT share a common ancestor.  Of course, I am becoming quite proficient at searching the "Index to Creationist Claims" and the Article DB at Talk Origins now BEFORE posting my questions here, so as not to waste your time.  I will summarize the points of agreement that I share with Neo-Darwinists, then pose my questions.  I have surveyed the various Creationist refutations of common descent for apes and humans and have found most of them to be inadequate.  These inadequacies are spelled out rather nicely by Todd Charles Wood (2006) of the Center for Origins Research at Bryan College in Dayton, Tennessee, who appears from this paper to be a fair-minded creationist.
Wood Article (2006)

Points of Agreement between myself (Wood also) and Common Descent Advocates
(1)  Nucleotide mismatches appear to be very small ~1.5%
(2)  Alignment gaps are also very small ~3-4%
(3)  Human Chromosome 2 does in fact appear to be a result of the fusion of 2 chimp chromosomes
(4)  The pseudogene for Vitamin C production does in fact appear to support common descent theory
(5)  Body similarities are indeed very striking and pose interesting questions
(6)  Many creationist arguments are inadequate.

Summary of Inadequacies of Creationist Responses (Wood)
(1) Similarity pointing to Common Design is inadequate.
Quote omitted

(2) Possibility of higher % differences proves nothing.
Quote omitted

(3) There may be NO "Haldane's Dillema" at all.
Quote omitted

Wood then goes on to propose an intriguing alternative ...
Quote omitted

and he asks an important question which serves as an excellent prelude to my own questions ...
Quote
What is a Genome? This might seem like a trivial and self-evident question, but its simplicity hides a deep challenge (Wood 2001). The Bible teaches that God created adult organisms and presumably even complete ecosystems by covering the land with plants. Thus, the Bible favors a holistic perspective of organisms. Modern molecular biology has favored the opposite perspective: that life is the complicated interaction of molecules and that DNA is the “code of life.” If the molecular viewpoint is correct, then the differences between organisms that really matter are indeed the differences in the DNA.
and Yada yada

This paper by Wood is quite interesting to me and serves well as a prelude to my own questions which I shall now present to you ...

(1) How do we explain the complete lack of 'Hominid Civilizations' (for lack of a better term) today?  It seems to me that if Common Descent Theory is correct, that  we would expect to see numerous 'civilizations' of 'less evolved' humans.  I suppose a hopeful candidate for this type of civilization has been the remote tribes of jungle natives found throughout the world.  However, I have firsthand experience with one such tribe, the Wai-Wai indians of Southern Guyana/Northern Brazil (My father is a Bible Translator for this tribe), and we have observed no evidence of anything 'primitive' about their human characteristics.  To be sure, their civilization and technology was quite primitive (they were basically hunter/gatherers), but their language is every bit as complex as English or Spanish or many other languages (I speak the language some and have a copy of their grammar, which my dad produced).  Their behaviour is in no way 'primitive' for the purpose of determining if they are 'less evolved.'  They laugh, cry, make jokes, tell stories, get mad at one another, read, write, learn foreign languages, play guitars and keyboards, have political battles, and in short do everything that any human society also does.  The main difference is in technology, which of course is not advanced.  As far as I know, there are Apes and there are Humans.  And there are no existing 'in-betweens.'  How do you explain this?

(2) The fossil record of human evolution is unconvincing to me.  Here is the supposed evidence from Talk Origins ...
Quote omitted

Do we not have plenty of LIVING HUMANS which could correlate very nicely with some of these fossil finds, but which we now know are completely human?  i.e. Pygmies and 'Aborigines' ?  

(3) Some have claimed that for all practical purposes, we are apes and biologically speaking, I see what they are saying.  But does this not minimize the ENORMOUS non-biological differences?  Humans have highly complex symbolic languages.  Apes probably communicate some, but do they communicate in DIFFERENT LANGUAGES in different parts of the world?  Are there any apes that have learned how to write?  Do apes organize themselves into 'governments' and seek to conquer  other ape groups?  Is there any indication of abstract thinking among the apes?  Is there any evidence of any 'technology' developed by apes?  Even primitive technology?  And this is only the tip of the iceberg with such questions.

(4) Has anyone thought about the implications of an assertion by a government entity that "Apes are 98.5% human and therefore should be afforded certain 'human rights.'"  This would be a silly idea to me of course, but it appears to be a logical conclusion of some evolutionist thinking.

(5) Was not Adolf Hitler affected by current evolutionary thinking when he came up with his "Aryan Master Race" theory?  I believe he was, and why shouldn't he have been?  Isn't it logical to assume that some races might be 'less evolved' than others if human evolution is true?  How about slavery?  Did not many whites view themselves as 'more evolved' than blacks, thus justifying their ownership and ill treatment of slaves?  And if human evolution is true, why would Hitler and slave owners be wrong in their actions?  After all, we 'enslave' chimps in zoos and we do medical experiments resulting in the death of lab rats.  Why should we not do the same with 'less evolved' humans?

My conclusion then is that in spite of striking genome similarities, humans and the apes are VERY DIFFERENT in many important ways.  All the evidence that I have seen so far is explained in a much better way by the Biblical assertion that mankind was made "in the image of God."  It appears to me also that Neo-Darwininsts are not even close to being able to answer ANY of the above questions in a satisfactory manner.  But maybe you will prove me wrong.

OK.  That should do it for starters.  I welcome your comments.

----------------------------------

Arden Chatfield said ...
Quote
The 'Hitler = Darwin' equation has been tried out by every creationist for the last 60 years. It's bullshit. Start here: http://www.talkorigins.org/indexcc/CA/CA006_1.html

I did and it is extremely weak.

Then go look here for a much stronger case.

The Holocaust and Darwinism

Quote
Hitler was especially determined to prevent Aryans from breeding with non-Aryans, a concern that eventually resulted in the ‘final solution’. Once the inferior races were exterminated, Hitler believed that future generations would be eternally grateful for the improvement that his programs brought to humanity:

‘The Germans were the higher race, destined for a glorious evolutionary future. For this reason it was essential that the Jews should be segregated, otherwise mixed marriages would take place. Were this to happen, all nature’s efforts “to establish an evolutionary higher stage of being may thus be rendered futile” (Mein Kampf).’ 20

Individuals are not only far less important than the race, but the Nazis concluded that certain races were not human, but were animals:

‘The Jews, labelled subhumans, became nonbeings. It was both legal and right to exterminate them in the collectivist and evolutionist viewpoint. They were not considered … persons in the sight of the German government.’ 34

As a result, the Darwinist movement was ‘one of the most powerful forces in the nineteenth–twentieth centuries German intellectual history [and] may be fully understood as a prelude to the doctrine of national socialism [Nazism]’.35 Why did evolution catch hold in Germany faster, and take a firmer hold there than any other place in the world?


But OK.  You don't want to accept this?  What about the other questions?

Ltracey said ...
Quote
Whoa, I seriously cannot believe we just saw another instance of "why are there still pygmies and dwarves?".

That's not what I am saying.  I am saying if a pygmy or some LIVING HUMAN that is not the same size or shape as the mean average of all humans, could not the fossil it made be virtually indistinguishable from the supposed human ancestor fossils found at Talk Origins.

I'm saying that if certain LIVING HUMANS and LIVING APES died, we might easily have the same fossil situation that we currently do have.  Is this not correct?

Tom Ames said ...
Quote
"What is the Bernoulli effect? Well, the Bible teaches..."  Sounds kinda dumb, doesn't it?

Sure, THAT does.  But you are distorting what the paragraph says.  Read the context.  What Wood is saying is "What is a Genome?  It is something worth studying, no question.  But is the Genome going to explain the real differences?  No.  There are differences which have to be accounted for by means OTHER THAN Genome studies."

Remember, that I and apparently Wood view the Bible as a SOURCE FOR PLAUSIBLE HYPOTHESES.  I also believe in Biblical inerrancy.  But this is a separate issue which must be proven on its own merits.  Biblical inerrancy has nothing to do with the issue you just raised.

Norm said ...
Quote
The most evolved life forms on our planet are probably bacteria and virii. They go through more generations and mutations in shorter time periods.

There is no such thing as "less evolved" or "more evolved" in the context you want to use them. There is only more fit or less fit to the niche you find yourself living in.

This is an amazing statement to me.  Do most of you guys really believe this?

---------------------
I said ...
Quote
That's not what I am saying.  I am saying if a pygmy or some LIVING HUMAN that is not the same size or shape as the mean average of all humans, could not the fossil it made be virtually indistinguishable from the supposed human ancestor fossils found at Talk Origins.

I'm saying that if certain LIVING HUMANS and LIVING APES died, we might easily have the same fossil situation that we currently do have.  Is this not correct?


Oops.  Let's try that again ...

That's not what I am saying.  I am saying if a pygmy or some LIVING HUMAN that is not the same size or shape as the mean average of all humans DIED, could not the fossil it made be virtually indistinguishable from the supposed human ancestor fossils found at Talk Origins??

I'm saying that if certain LIVING HUMANS and LIVING APES died, we might easily have the same fossil situation that we currently do have.  Is this not correct?

-------------------------------------------

Norm said ...
Quote
Human Brain Is Still Evolving

Howard Hughes Medical Institute researchers who have analyzed sequence variations in two genes that regulate brain size in human populations have found evidence that the human brain is still evolving.

They speculate that if the human species continues to survive, the human brain may continue to evolve, driven by the pressures of natural selection. Their data suggest that major variants in these genes arose at roughly the same times as the origin of culture in human populations as well as the advent of agriculture and written language.


and he also said this ...
Quote
You seem to think that human intelligence is some sort of goal in evolution. It's not. There is no goal except for an organism's instinct to survive and reproduce itself. Brains won't be of use to all. ... and ... The most evolved life forms on our planet are probably bacteria and virii. They go through more generations and mutations in shorter time periods.
There is no such thing as "less evolved" or "more evolved" in the context you want to use them. There is only more fit or less fit to the niche you find yourself living in.


These seem to be contradictory statements to me.  On the one hand you seem to be saying that the brain is evolving (I assume this means humans are getting smarter), then on the other hand you say that bacteria are the most 'evolved' ???

Let me just explain that MY conception is this:

MORE EVOLVED=More Intelligent and More Abilities.  For example, apes can walk, climb, eat, drink, sleep, communicate in a limited way, etc.  Humans can of course do all these things and much more including blow all the rest of life on Planet Earth to smithereens.  This is what I'M talking about.  

If you want me to use a new term so I don't confuse your minds, please suggest one.
------------------------------------------------------
Quote
How about you go get a high-school biology textbook and shut up for a while.

PLEASE go get some education (not from Answers in Genesis) and come back in 6-12 months.


Out of answers and energy, perhaps?  I'm starting to make sense and you are frustrated?  Maybe evolutionary explanations are not so great as they once seemed to you?  But you still want to hang onto them because you have your life invested in them?

Hmmmm ....
------------------------------------------
Quote
More Koko news.

I acknowledged up front that apes have communication ability and even some of the other abilities mentioned here.  This does not overcome the ENORMOUS differences between Apes and Humans.  The BEST explanation remains, as it did before Darwin, that an Intelligent Designer made Humans to be Humans and Apes to be Apes.
Quote
Oh, look. The evidence shows that the differences between the various races are negligible, and that their abilities are essentially identical. Huh. I guess that makes it an instance of "Things are not always what you expect."

My point exactly.  Things ARE NOT as one would expect if evolution were true.
Quote
It is your next line ...that the reality-based people here will take issue with. 'All the evidence that I have seen so far is explained in a much better way by the Biblical assertion that mankind was made "in the image of God."'

Why?  What is wrong with proposing this as a hypothesis and testing it?  This is what am doing on my other thread (well into Point 1 already).  If the evidence fails to support it, then fine.  I will abandon the proposition.

You should not be calling people here 'reality based.' Because many of them refuse to consider the possibility of what may in fact be quite legitimate REALITIES -- God, angels, demons, afterlife, etc.  I will be showing excellent evidence for just these types of realities on my other thread.  I cannot prove them, but there is much evidence.  A better term for the people here might be 'naturalistic based.'  In other words, they only acknowledge things they can test with their meters and such.  They think that there is no 'God-meter' so to speak, so they reject the possibility out of hand. I will show that this is a mistake.
Quote
What I wanted to ask you was what are we suppose to make of the non-gaps(I don't know what else to call a non-gap, maybe evidence woudl be a good name, but if anyone has an idea please do tell) in the fossil evidence?  You know, the places that make all those gaps the creationists complain about possible.  All that evidence has to mean something.  Especially since the evidence between the gaps shows such flow(again a bad word but the only one I could think of) between features and anytime a new piece of evidence is found it fits into the flow just as we would expect it to.  Focusing only on the gaps gives the lopsided picture that the gaps are all that is important, but as I said above without the evidence there would be no gaps; or, rephrased, all of prehistory would would be one giant gap.  And if creationism was true(especially YEC) that is all we would expect.  One giant gap.  Why can't creationists get that?

I will cover this on my other thread.  Keep checking back.  Thanks for the question.
Quote
(Arden)Ah yes, where would creationists be without comparisons of Hitler and Darwin? And where would they be with AIG? (Didn't use AIG this time ... are you happy?) Okay, Dave try answering this.
Adolf Hitler was a Christian. Catholic, in fact. The great majority of Nazis were Christians of some kind. Hitler frequently rationalized his attitudes towards 'racial purity' by appeals to Jesus and God. From this, one could conclude that a natural consequence of Christianity is murdering Jews. You presumably disagree. So do I. But why is this any less reasonable than your logic? It's FAR EASIER to find statements by the Nazis invoking Jesus for what they did than invoking Darwin.
(Joe the Ordinary Guy) Sure he [Hitler] was. But, as above, I think most people would describe him as “wrong”; he MISINTERPRETED evolutionary theory and arrived at bad conclusions. Wasn’t he also a Christian? Would you say he followed Christian precepts correctly?

I might concede this point.  It is true that various twisted versions of Christianity has wreaked enormous havoc on the human race, the medieval Catholic Church being a case in point, in my opinion.  But history also has a very recent example of a nation which based its laws upon the general Protestant interpretation of Christianity (the USA)--there is a very strong case that this is true--it should be self-evident, but may not be now thanks to post-1950 (or so) revisionists of American history.  America (and the British Empire before it)  owes its success more than anything else to the Bible and to the teachings of Jesus of Nazareth.  And by "success", I mean equality, prosperity, culture, conveniences, art, music, good treatment of women and children, etc.  Note that people from all over the world want to come to America.  I cannot help but think that the story of Great Britain and America would have been quite different (maybe like the USSR?) had they been founded upon Darwinism instead of upon the Bible and the teachings of Jesus.  Do you disagree with this?

To me, basing society upon the Bible and the teachings of Jesus has been demonstrated to be a good idea, whether they happen to be true or not.  And basing a society upon Darwinism would be a bad idea, whether it is true or not.  But I believe I have a "double whammy" if you will.  Not only do I believe Darwinism is unsupported by adequate evidence AND has bad societal influences, but I also believe that Biblical Christianity and YEC is supported by overwhelming evidence AND is good for society.  

This explains my zeal in fighting AGAINST Darwinism and FOR Biblical Christianity and Creationism.

Quote
Evolutionary theory does not provide any support for the arguments you try to make.  These are issues for society, not science, to resolve.
True, and I am not an official member of the science community, but policy makers rely on what they think is good science many times to make good decisions.  I am a concerned citizen with a scientific mind who feels that a pseudo-science called Neo-Darwinism is being called science on a large scale.  This gives politicians scientific sounding reasons to implement potentially disastrous policies in our society.

Quote
Christians had been discriminating against and killing jews for well over a thousand years before Hitler was born.
Twisted Christianity had been.  You are correct.  It got so bad that a man named Martin Luther turned things upside down.  The result?  The translation of the Bible into the English language and the attendant success of the British Empire, followed by the founding of the United States squarely upon the Bible also, again with great results.  Note also the DECLINE of the British Empire coincident with the REJECTION of the validity and authority of the Bible.

Quote
Tell us what to do, now, Dave. Obviously we have to start from scratch. I mean, I assume I have to get one of those Jesus fish eating a Darwin fish for my car, and vote Republican this fall, but aside from that, I'm at a loss.
No one will make you do any of those things.  That's the beauty of America.  We let people be Atheist or Islamic or Buddhist or Nothing with no penalties.  And the reason for this is the Christian worldview which is unique in the world in that it allows maximum freedom.

What we DO want is to NOT have our Creationist views ridiculed in the public square, and we want school children to hear both sides of the evidence (whether in ID format or Creo format, I don't care).  I hear this is starting to happen in the UK and I think this is great!
---------------------------------------------------------------
Quote
Since you seem to have abandoned the previous thread, I'll repost my simple, unanswered question here:

Do you or do you not find the very idea that humans are evolved apes offensive?

If it does indeed turn out to be false when I have finished my investigation into the claim, then YES, I would be offended at the idea of teaching it as if it were true.

I will resume posts on my other thread tomorrow morning.  I was not avoiding yours or anyone's questions over there.
----------------------------------------------------
Quote
To #### with it all -- let's play Hitler ping-pong!


We are getting off on rabbit trails.  I said I would concede the Hitler point.

Let me put us back on the main track.

The BOTTOM, BOTTOM, BOTTOM line for me is this, guys.

None of this discussion here changes the simple FACT that ...

(a) WE REALLY DON'T KNOW FOR SURE IF HUMANS EVOLVED FROM APE-LIKE ANCESTORS, AND I'M NOT SURE WE EVER WILL.

and ...

(b) WE REALLY DON'T KNOW FOR SURE IF "GODDIDIT" AND WE CERTAINLY CAN'T "PROVE" THAT.

OK?  

Now ... my BIG problem is this ...

Why are we standing up in science classes and teaching kids that Ape to Human Evolution is a FACT?  This is dishonest and potentially damaging to society for any number of debatable reasons.  What we SHOULD be doing is telling them BOTH THEORIES--DESIGN and NO DESIGN and clearly let them know they are UNPROVEN THEORIES and it is up to YOU and YOUR PARENTS to decide.  My tax dollars are funding this education system just like yours are and I have a different opinion on something that is an unprovable fact in either direction.  Why is my opinion shut out and vilified?  Is this country supposed to be a representative democracy or is it not?  Last time I checked IT WAS.

And that ... my friends ... is the BOTTOM LINE on this thread.
--------------------------
Let me just put to rest all the talk about "More Evolved=More Abilities, etc." ...

When comparing Apes and Humans (which is the topic of this thread), I am simply saying this ... Humans Have More Abilities than Apes

Let's just forget about the bacteria and the rest until another day ...

OK?  Everybody happy now?

Also, this type of thing from Aftershave ...
Quote
Let's use AFDave "logic", shall we?

Those evil Nazis used their knowledge of chemistry to produce high explosives and poisonous gas, so therefore the Atomic Theory of Chemistry must be scientifically wrong!

Worse than that, those evil Nazis used their knowledge of physics and gravity to aim and drop their bombs, so therefore Newtonian physics and the Theory of Gravity must be scientifically wrong!

How can we teach such blasphemy as chemistry and physics to our children???

Let's say someone drops AFDave into the middle of the Pacific with no raft, into a pack of sharks, to see which is "more evolved".  Any bets?


is a sure indicator that this person has nothing left to say that is substantive ...

this does not help the image of evolution promoters ...

the YECs on the other hand thank you for ranting so ...

Could you maybe do some more?  Maybe go tell 4 friends to show up and insult me too ... then you would be 5 times as effective :-)
---------------------------------------------------------------------------
Well ... one thing is sure ... most of you are answering me precisely as I expected you to answer ...

We'll see you guys tomorrow for some more fun ... :-)
---------------------
Good morning everyone!

I hope everyone has had an excellent night's sleep so your mind is clear and your wits are sharp!  The remaining half of my brain that's not "religion darkened" feels pretty good, so I'm ready to go at it again hammer and tongs!  

It was a fun day for me yesterday ... I learned some really interesting things, and my wife and I got some great laughs from some of the creative answers you gave.

I do see that some of my "Chief Insult Hurlers" have abandoned that tactic apparently because they found it ineffective for their cause.  We'll see how long it takes ALL the Insult Hurlers to figure this out. (You know ... some are more "highly evolved" than others, so it takes a while with some ... just kidding, JUST KIDDING! :-)  )


NOTEWORTHY HIGHLIGHTS FROM YESTERDAY'S SKIRMISHES

Tom Ames runs for cover when the "B WORD"  is mentioned ...
Quote
What is a Genome? This might seem like a trivial and self-evident question, but its simplicity hides a deep challenge (Wood 2001). The Bible (RED ALERT!! RED ALERT!! ALL PERSONNEL TAKE COVER IMMEDIATELY!! THE DEPLORABLE WORD HAS BEEN SPOKEN!;) teaches that God created adult organisms and presumably even complete ecosystems by covering the land with plants. Thus, the Bible (RED ALERT!! RED ALERT!!;) favors a holistic perspective of organisms. Modern molecular biology has favored the opposite perspective: that life is the complicated interaction of molecules and that DNA is the “code of life.” If the molecular viewpoint is correct, then the differences between organisms that really matter are indeed the differences in the DNA. If a holistic perspective is correct, then perhaps differences in the DNA are not paramount to understanding organismal differences.Complicating this reasoning is the fact that differences in DNA do indeed cause differences at the organismal level. There is a definite relationship between phenotype and genotype, even though the relationship is not as simple as Mendel might have imagined it. We could understand the genome as a repository of some of the information necessary for the physical composition of the organism (Wood 2001). In that case, far more important than the genome may be its cellular context, which interprets and applies the information stored in the genome. Since some of the cellular context is coded by the genome, we have something of a chicken/egg problem, which can only be resolved by a creation event.The similarity of the human and chimpanzee genomes offers evidence that the genome could primarily be a repository. If the fixed nucleotide mismatches between the chimpanzee and human genomes are 1.06%, then the original nucleotide identity could be as high as 99%. At that high level of similarity, perhaps it is not impossible to believe that God created humans and chimpanzees with identical genomes. The known differences between human and chimpanzee biochemistry (see Varki 2000; Varki and Atheide 2005) may well rule this out, but it is an intriguing possibility. Even at 99% identity, however, the biological and behavioral differences between chimpanzees and humans indicate that the source of these differences is not likely to be found entirely in the genome sequences. Theologically, the high similarity of humans and chimpanzees reinforces our spiritual – not physical (Ecc. 3:18-21) (RED ALERT!! RED ALERT!!;) – distinctiveness from the animals. It is the image of God (RED ALERT!! RED ALERT!! THE OTHER DEPLORABLE WORD HAS BEEN SPOKEN!;) that makes us human not some intrinsically valuable genetic element.(p.12)


NOTE:  Let me emphasize again that for YECs showing evidence of YEC Theory, the Bible is a SOURCE FOR HYPOTHESES.  Belief in Biblical inerrancy IS NOT required in this discussion.  This is a SEPARATE ISSUE and stands or falls on its own merits.

Quote
The most evolved life forms on our planet are probably bacteria and virii.
I just LOVE this one!  My kids got a great laugh too.  I quickly learned yesterday that I am not up to date on the latest version of THE GREAT MYTH, so I thank all of you for fixing that.  You'll have to pardon me for making this mistake.  When I was in grade school, I remember all the encyclopedias showing Evolution going something like AMOEBAS - WORMS - SQUIDS - FISH - AMPHIBIANS - MAMMALS - APES - HUMANS (did I get that right?), with humans at the top of the tree.  Anyway, I remember seeing a nice little Ape to Human progression and I remember quotes from Huxley and the like saying things about whites being "more evolved" than humans.  I guess it stands to reason that ND Theory would have to change as racism became less fashionable worldwide throughout the 20th Century.  And I do apologize for not keeping up on the latest version of THE GREAT MYTH.  The Bible (My "myth" as you call it) says the same thing THIS century as it did in Darwin's day, so it's easier to keep up with than YOUR MYTH.

Quote
Human Brain Is Still Evolving: Howard Hughes Medical Institute researchers who have analyzed sequence variations in two genes that regulate brain size in human populations have found evidence that the human brain is still evolving.

And why shouldn't it be if evolution is true?  It seems that the ToE would actually PREDICT continual brain sophistication (oops ... there's one of those evil "directional" words) ... er, shall we say, er ... I'm at a loss ... anyway ... ToE should predict continual brain sophistication so that at some point there may actually be some kind of Super Homo Sapiens species who might be able to leap tall buildings in a single bound, play 100 simultaneous chess games, memorize large books in minutes, etc, etc.

Quote
Why should Common Descent produce “Hominid Civilizations”? There’s no reason to assume that this would be the case.

Actually, there is EVERY reason to believe this should be the case if the ToE is true.

Quote
After Darwin, a new possibility was raised: that those at the top of the social pyramid deserved to be there for natural reasons rather than religious reasons. There has never been ANY doubt by those at the top that their position is deserved. So these "natural" justifications have been deployed both by nations (as in Germany) and by scientists (searching for natural explanations for why the French are superior to the Germans or vice versa (depending on who's doing the study), or why whites are superior to blacks (again depending on who's doing the study). In brief, it fell out of fashion for those born into privilege to say God put them there, and into fashion to say they are "more evolved" and rose to the top from sheer innate superiority.


Quote
The anti-semitic attitudes that allowed for various attrocities - including the Holocaust - came directly from Christianity.  The notion that Hitler just came up with the idea of killing off jews all on his own is simply absurd.  Christians had been discriminating against and killing jews for well over a thousand years before Hitler was born.  Hitler was just continuing a popular tradition, and adding his own spin to the process.

You need to remove the word 'Christianity' from this one and insert 'Catholicism' instead.  The two are vastly different as I will show on a future "Martin Luther" post.  That one should be fun!

Quote
How can you hope to find any flaws in something of which you have no understanding?

My 1st grader can easily grasp the truth that Apes are Apes and Humans are Humans and that they probably HAVE ALWAYS BEEN just that, and probably WILL ALWAYS BE just that.  It doesn't take very much understanding of biology.  The reason you don't grasp this is beyond me.  Maybe too much ToE indocrination in higher education?

Quote
But you come in with arrogance and attitude on top of that. You don't show any respect for the opinions of people who do know things.
I'll give you that one.  I did come in kind of cocky on the chimp chromo thing and you are right ... I should not be cocky, but I did show respect for people's opinions when they showed me the truth.  I have always said I would ... and I did.  You got me on that one, and now I agree with you that it does in fact appear that this supports ToE.  So basically now you are "one bucket full" of water closer to draining the ocean.  You should feel justifiably proud.

Quote
If creationism offered some explanations of the otherwise unexplained, if it made any predictions at all that worked, I still have my life and my work. It wouldn't cost me a thing to adopt it. If it worked. But it doesn't.
Stay with me.  I will be resuming my work on my "Creator God Hypothesis" thread and I hope for your sake that it makes sense to you.  The world is truly a fun place when you have the right view of it!

Quote
Now, let's talk about what you have invested in creationism. Suppose we were able to convince you that AiG is just as obviously, glaringly, unambiguously wrong about everything else as I hope you have come to realize they are about the chromosome fusion story. Suppose you had to accept what every scientist who's looked at the evidence objectively accepts: that the earth is billions of years old, and that humans are just one little twig on the tree of life, that has been on the scene for but an infinitesimal fraction of the planet's history. Would that make you reassess your thoughts on life and your alleged god?

Sure.  I'd probably think there ISN'T a God.  And yes, I would be disappointed.  I admit that I LIKE the idea of there being one.  But I don't think I am necessarily jaded by this.  I think everyone's thinking is affected somewhat by their "wanters", but we have to keep this "wanter" under control.  "Evos", like "Creos" also have "wanters" and many of them DON'T WANT there to be a God because they think their life would somehow be worse, or they'd have to tie half their brain behind their back, or some such thing.

Quote
What does this (Hitler) have to do with the biologically history of the planet Earth?
Simply this. If you compare the two "World Views" you have something like the following major points:

DARWINISM:  
Survival of the fittest
Humans are animals-nothing more
No God required-I'm not accountable to anyone but myself

CHRISTIANITY (American Protestantism specifically):
God created mankind in His image
All humans are created equal
Don't kill, don't steal, etc.
Treat others as you would have them treat you
Love one another
Turn the other cheek
Bless your enemies
If your enemy is thirsty, give him a drink
Do not repay evil for evil

Now ... which of these is more conducive to a Holocaust?  You tell me.  I'm not discounting other factors.  It's true that Hitler was influenced by Catholicism, the Occult, and other factors as well.  So my point is ...

NOT ONLY IS DARWINISM FALSE AND AN INSULT TO INTELLIGENCE ... demonstrably so as we saw for many years with Henry Morris and Co. and are now seeing with Dembski, Denton, Behe, etc.

BUT IT IS ALSO AN BAD FOUNDATION UPON WHICH TO BUILD A NATION.
I don't know of a single one that was built on the Principles listed above under "Darwinism" that I would want to live in.  Do you?

In stark contrast to that, we have at least TWO examples of nations who built their laws squarely upon the CHRISTIANITY principles listed above:  Great Britain and the USA.

Now you see what gives me such zeal in fighting Darwinism.

Again, so no one misses it ... the two reasons I fight Darwinism are ...
(A) IT IS FALSE
(B) IT IS HARMFUL TO SOCIETY

Are there any questions?  Is my position perfectly clear?

By the way, for those of you wise enough to "get off the Darwin train" BEFORE the train wreck, your buddy Bill Dembski has come up with a neat list of over 500 scientists who have had the kahoonas to sign their names to a public statement that says ...
Quote
A Scientific Dissent From Darwinism
"We are skeptical of claims for the ability of random mutation and natural selection to account for the complexity of life. Careful examination of the evidence for Darwinian theory should be encouraged."


It also notes that ...
Quote
The scientists on this list dispute the first claim and stand as living testimony in contradiction to the second. Since Discovery Institute launched this list in 2001 [in response to the PBS "Evolution" propaganda piece] over 500 scientists have courageously stepped forward to sign their names. The list is growing and includes scientists from the US National Academy of Sciences, Russian, Polish and Czech National Academies, as well as from universities such as Yale, Princeton, Stanford, MIT, UC Berkeley, UCLA, and others.


Here's the link ... [url="http://www.dissentfromdarwin.org"]

(What?  We have rebels in the Ivy League too?  Heaven help us! er ... Deep space help us! (?) ... er ... May the Force help us! ... er ... well ... anyway, SOMEONE help us!;)

THOUGHT QUESTION FOR THE DAY:  If over 500 scientists have actually had the kahoonas to SIGN such a document, how many others AGREE with the document, but are AFRAID to sign it because of peer pressure, fear of not getting tenured, etc., etc.

Hmmmm ....

Quote
so afdave, have you confronted AIG about the lies on their site as you said you were going to do yet?

Patience, my friend.  These things take time.  AIG is so popular right now that they get ZILLIONS of questions every day and it takes time to get to mine.  Actually, I think the only way I will get an answer in any reasonable amount of time will be if I use my connections.  But I don't even know for sure if that will work quickly.  Stay tuned, though.

Quote
The problem is not that chimps, and the animal kingdom in general, is so far behind.  It is that you are so completely unknowing of just how capable chimps really are and that you are full of species superiority about how far advanced humans really are.
Yes. Maybe we should take this up in Congress and maybe come up with an "Ape Bill of Rights."  Good idea.  I'll take this one with me on my next trip to Washington.  Oh ... and maybe we could have an "Ape Olympics" and make it a world class event ... and maybe we should modify laws to allow Apes free access to various public places like Walmart and the Public Library, etc.  Excellent idea.  I like your progressiveness.

Quote
Dave, the reason people are becoming frustrated with you is because most of the questions you have, which you seem to view as huge problems for evolutionary biology, are in fact a result of your limited understanding of evolutionary biology.
I have an alternative explanation for the frustration (imagine that!;)  Mine is like this ...

STAGE 1: ToE advocates are becoming frustrated because their explanations are sounding more and more like pro-geocentrism and pro-flat-earth arguments as time goes on.  
STAGE 2: The Ship of Darwin has hit an iceberg and a few brave souls are jumping into life boats before it sinks.  See www.dissentfromdarwin.org
STAGE 3: And now, ordinary amateur scientists like me are jumping in the fray and shining a light on a foolish theory.
STAGE 4: Frustration ensues, followed by name calling, arrogant and belittling comments, talk of censorship, and the like.
STAGE 5: This is turn fuels more doubts in people minds. ("Why would that guy resort to name calling?  Doesn't he have any GOODS?" etc.)  
STAGE 6: Which in turn fuels more frustration and mental anguish.  And so the cycle goes until finally for some ... in a desperate moment ... possibly in the middle of the night ... or out on a peaceful lake while fishing ...
STAGE 7: THE LIGHT BULB COMES ON!  (Trumpets) And one more Darwinist is rescued from the darkness of error.

Quote
How do you test for God?
With a God Meter of course.  No.  Seriously, there are some very good ways.  Cosmic fine tuning and Biological Machines are great for starters.  And if I could get everyone on this thread to agree with me, I could hop back over to that thread (AF Dave's UPDATED Creator God Hypothesis) and give you more.  Lots more.  Stay with me.  We'll get there.

Quote
Let's say someone drops AFDave into the middle of the Pacific with no raft, into a pack of sharks, to see which is "more evolved".  Any bets?
Aftershave ... you're in STAGE 4.  See above.  (Which means there's hope for you)

Quote
Why is my opinion shut out and vilified?

That's an easy one.  Because your ideas are not within the mainstream of scientific understanding today.  It's that simple.

Yes.  Galileo's ideas were not mainstream either.  Right.

Quote
Why do you ignore the fact that the chimp/human DNA thing is a PRETTY DURN BIG piece of evidence in favor of evolution, especially since it is the proof of predictions made before people even knew there was such a thing as DNA?
I don't ignore it.  In fact I've acknowledged it several times to prove my sense of fairness and honesty.  Go read the whole "Chimp Chromo" thread and you will see this.  I'm trying to set a good example for how someone should act when they are proven wrong on a point as I was.

And here it would be appropriate for me to repeat what I told Steve Story ... that with your "Chimp Chromo" victory ...

... you are "one bucket full" of water closer to draining the ocean.  You should feel justifiably proud.

Quote
AFDave, since you refer to 'more evolved' humans, do you admit that we are the result of some evolution?
No.  I do not believe there is such a thing as 'more evolved' humans.  I just asked our ToE advocates why there ARE NO EXAMPLES of 'more evolved' or 'less evolved' humans.  There should be some living today if ToE is true.

Quote
For the umpteenth time – science is NOT a democracy, and scientific truth is NOT decided by popular vote.  Your opinion based on ignorance  doesn’t mean jack sh*t to the scientific realities of the evidence. Dave, for an otherwise intelligent guy, you’re sure doing a good impersonation of a cement-headed dumbf*ck.
Not just STAGE 4.  SERIOUS, "E.R." STAGE 4.  See above.

Quote
We're teaching kids that this is science's best guess and its as factual as this kind of science ever gets.
There are apparently more and more scientists who have a DIFFERENT guess.  But let's not consider their guess.  They are obviously 'unscientific.'

Quote
Looking at human society, behaviour, anatomy, physiology and genetics, our close evolutionary relationship to the great apes is obvious. Remember the vitC gene?
No disagreement with any of this.  I just think it indicates COMMON DESIGN, not common descent.  Not a looney, fringe idea. Should be taught in school too.  I'm in good company ... Newton for one.  Apparently thousands of currently living scientists as well in all major universities.

Quote
But you have demonstrated here that you are not really competent to judge.
Agreed.  That's why I enlist the help of Morris, Dembski, Meyer, Denton, Behe, etc. etc.

Quote
And of course, evidence doesn't matter. But in the world of science, evidence DOES matter.
Evidence DOES matter.  That's why we are having this discussion.  Because the EVIDENCE favors COMMON DESIGN, not common descent.

Quote
But what we are discussing here is science, and science is NOT a democracy.
Quite true.  Science is not a democracy.  We have to go with the evidence.  But politicians are elected by majority.  And politicians give funding to public schools and universities.  And if universities behave irresponsibly and teach junk science -- like Darwinism -- and vilify people who don't, then the electorate can demand that the politicians RE-direct the funds to responsible schools.

Quote
afdave, if you need retarded "science" (your idiotic AIG approved "science") to justify your faith in god you were in a world of hurt long before you came to this web site.
I think you must not yet know WHY I came to this website.

Quote
To trot out an over used but apt comparrison.  A recent poll came out that said barely 1/3 of questioned people could locate Iraq on a map.  Does that mean that:
1)  We should improve geographic education to make sure that Americans are more aware of the world around them or
2)  We should "teach the controversy" and show both sides of the issue, both those people who believe Iraq is in the middle east, and those people who pointed at Australia and said "I think it's around here somewhere".


Your analogy works if you assume that "Teaching Darwinism = Teaching that Iraq is Somewhere near the North Pole", which I of course do believe is a good equation.  And in this case, YES, I would advocate (2).  

Quote
Why are we standing up in science classes and teaching kids that Ape to Human Evolution is a FACT?  Because we teach them that gravity makes apples fall.
Jeannot, Jeannot.  Come now.  Look what you just did.  You compared something with ABUNDANT EVIDENCE THAT WE SEE EVERY DAY (Gravity), with something for which there is NO EVIDENCE OF IT OCCURRING (Apelike ancestor becoming Human).  Or do you see this occurring in France?  (I can think of a joke about the REVERSE occurring, but I will be nice and refrain.  Besides, I liked Lafayette.)  I was beginning to be impressed with your grasp of science (the DNA replication info). How could you make this basic error?

Quote
Speaking of which, how are you doing with supporting your three assertions? Eric is referring to these ...
1. The Bible is literally inerrant;
2. The earth is not billions of years old, but only thousands of years old; and
3. Evolution cannot explain the origin of species.

FIRST, these are not assertions that I made in my Creator God Hypothesis although I heartily agree with them all and they all have mountains of evidence to support them which I hope we can get into.  The reason I did not make them in my Hypothesis is that there are more important things to show evidence for first.  It is most important that I BEGIN with the PHYSICAL EVIDENCE ... namely, the Cosmos and the Living World around us.  This evidence includes Cosmic Fine Tuning, Biological Machines and Relativity.  Next we should observe Humanity and Moral Laws which in fact are REAL THINGS, although we cannot "see" them.  From this evidence we can postulate a Cause for all these phenomena.  There are other phenomena we can observe to get a better and better description of what this Cause might be like.  If we can establish a pretty good case for the existence of a Great First Cause, then we are not unreasonable to postulate than maybe He gave us a written message.  We posulate the Bible as a possible candidate for THE MESSAGE OF GOD TO MANKIND because of its uniqueness and seemingly supernatural character, then test our theory in detail.  If this theory is well supported from things easily verifiable, we can now move on and investigate various claims of the Bible such as the Flood, Young Earth, the Changing of Languages at Babel, etc. which are disputed widely today.  This is the general outline I am following.  Again, remember that I have never before published a "God Hypothesis" ... I am proposing one and working out the exact details of how it should go with YOUR HELP!  Thank you!  As for proving Evolution to be false, this is not my priority, as some others are doing a good job of that.  Henry Morris, Michael Denton and Michael Behe, to name a few.  Denton was more polite than I would have been in titling his book.  Instead of "Evolution: A Theory in Crisis", I would have named it "Evolution: Impending Train Wreck."

NOTE:  Let me emphasize again that for YECs showing evidence of YEC Theory, the Bible is a SOURCE FOR PLAUSIBLE HYPOTHESES, nothing more.  Belief in Biblical inerrancy IS NOT required in this discussion.  This is a SEPARATE ISSUE and stands or falls on its own merits.

Quote
But can you get it through the front door of that meritocracy honestly?
Yes.  This is happening as we speak.

Quote
No doubt my teaching about common ancestry (especially regarding humans and apes) makes you feel uncomfortable, since you deny the starting premise.
Again, I am perfectly comfortable teaching things THAT ARE TRUE.  What I am uncomfortable with is ASSERTING things AS IF they were proven, when in fact they are not, by YOUR OWN STANDARDS.

Quote
"More evolved" is a difficult term and issue.  However, I don't think that it is truly meaningless in biology, nor that it would necessarily apply to the highly successful micro-organisms better than to multi-celled eukaryotes.
Glen ... I enjoyed reading your entire piece.  Very insightful.  Thanks!

Quote
AFDave, it seems that the history of Christianity is another thing that you could learn more about. Next time you are researching, Google "Martin Luther" and anti-semitism. Read his actual writings. With regard to your claims about history, I will just observe that correlation is not causation.
I'm sure I would agree with you.  But this has nothing to do with my point.  Go back and read my point again.  We'll do another thread an ML.  He's one of my favorites.  But not now.  I have alot on my plate :-)

Quote
Indeed, Dave should not start thinking that all the Christians who mistreated Jews were all Catholics, and that Protestants all treated them well. Many high ranking Nazis were Protestants as well. Here's what Wikipedia says about Luther:
Agreed.  It was Protestants who burned William Tyndale at the stake.  You are absolutely right.  But this does not change the fact of history that the Protestant Reformation changed the world for the better.

Quote
Add American history to the list of subjects AFDave knows less about than he thinks.
Oh?  I'll take you up on the challenge sometime.  That will be fun too!

Quote
There are some rules here at ATBC, and I predict you won't persist in babbling your nonsense any longer.
Jeannot, have you never heard of a nifty little thing made famous by Americans called FREEDOM OF SPEECH?  Do you not have this in France?

BTW ... I salute Steve and Wes for honoring Free Speech!  You have my accolades.

Quote
Offer a "theological biology" class.....
The Darwinist Religious belief on Origins would be PERFECT for this class.

Quote
Exactly Paul. Individuals of our species get a HUGE leg up on our planet by being immersed in the current incarnation of human culture of whatever location they happen to be born. Where would they be if they were born into the wild and cared for by animals, or by parents that had no concept of language, and if they had no contact with anything manmade? That recent thread that touched on the subject of feral children leads me to think that they wouldn't fare very well. The extremely rare child that is raised by animals imprints upon their adoptive parents, crawling like dogs, or imitating chickens. We spend years with our families and in schools learning just the basics about the world and how to interact with it.

Seeing the capabilies of Koko, given the advantage of being taught an already established, open ended language that promotes structured thought, leaves me quite awestruck at how smart and similar to us gorillas are. Whoever said that these ape societies are the 'Hominid Civilizations' afdave is looking for is right. It just goes to show what a good ecological niche it is that we used to share. There's plenty of room in the jungle for apes.
I agree.  All the apes need is a good environment and they will become rocket scientists.  When I am in Washington next, I will suggest to Ike Skelton that he introduce legislation for a new, tax-funded, "Primate Education Program."  Maybe we could even have a new cabinet level office ... we already have the Department of Education ... why not have the Department of Ape Education.  

Quote
Is every aspiring AF pilot guaranteed to get his wings and then be allowed to fly fighter jets?  Or is there a winnowing out process so that only those who have passed a battery of rigorous tests will be deemed qualified?

And who gets to decide if an aspiring pilot has the right skills and attributes to fly F-22s instead of tankers or trainers, or gets to fly at all?  Is it AF cooks, and drivers, and mechanics?  Or is the judgment made by a group of senior pilots who have themselves put in the years learning the trade, and know what separates the real aviators from the wanna-be ones?

I think we should give wings and assign fighter duty to everyone who applies.
Why are we standing up in the Air Force Academy and teaching that some people make better pilots than others is a FACT?  This is dishonest and potentially damaging to society for any number of debatable reasons.  What we SHOULD be doing is telling them BOTH THEORIES—ONLY A FEW PEOPLE MAKE SUPERIOR PILOTS and ALL POTENTIAL PILOTS ARE EQUALLY CAPABLE and clearly let them know they are UNPROVEN THEORIES and it is up to EACH PILOT HIMSELF and HIS PARENTS to decide if he is qualified.  My tax dollars are funding the military budget for F-22’s, etc. just like yours are and I have a different opinion on something that is an unprovable fact in either direction.  Why is my opinion shut out and vilified?  Is this country supposed to be a representative democracy or is it not?  Last time I checked IT WAS. You do believe in the democratic process, don’t you Dave?  Shouldn’t it be applied here too?  I’m really curious to hear your answers.
Good question.  I knew you could say something substantive. Answer:  The generals who set the rules EARNED THE RIGHT to do so by exercising sound judgment regarding EASILY VERIFIABLE TRUTHS.  What is this EASILY VERIFIABLE TRUTH?  It's very easy to distinguish the good pilot candidates from the bad ones.  In science today, we are talking about a different matter.  We are talking about many qualified students who can do much in the way of good, useful scientific work regardless of their worldview.  To exclude people because of their worldview is like excluding people based on sex or religious preference, ESPECIALLY when there are thousands of "Darwin dissenters" among scinetists in all major universities AND half the US and British population rejects Darwinism.  This is a significant difference.  Contrast this with putting the following question on the next national ballot, "Do you think there should be a selection process in choosing fighter pilots?"  I think you'd be very close to 100% YES.

Quote
Why would somebody be offended by having been taught something that was believed by scientists at the time, but that found out later to be incorrect?
No problem with teaching Evolution as a Theory espoused by many good scientists.  Let's just be honest and call it a theory though and quit saying it is a proven fact and shutting out the ID view.

Quote
Now let's try this again.  Do you or do you not find the very idea that humans are evolved apes (as are, for Flint's benefit, all present-day apes) offensive?
I'm perfectly fine with the idea if it turns out to be proven true.

Quote
I said ... Do we not have plenty of LIVING HUMANS which could correlate very nicely with some of these fossil finds, but which we now know are completely human?
Let me explain this one again, since it was misunderstood.

I am saying that if we took an assortment of recently (let's say they all died at once yesterday, OK?) dead African pygmies, maybe some dead dwarfs, some dead Aborigines, some dead gorillas, etc. (a morbid thought to be sure, but you get the idea ... we are collecting 'ape-like bones';) ... but if we somehow collected all these bones, we could quite possibly bury fragments of them in various places throughout the world and have a 'hominid" fossil situation  quite closely resembling the naturally occurring situation which we do have.  Make sense?  Now that you understand what I am saying, please ... go ahead and refute me.  Who knows?  Maybe you can.


MAIN POINTS I LEARNED YESTERDAY
(1) Humans are Humans
(2) Apes are Apes
(3) No one has observed Apelike ancestors becoming Humans in their lifetimes and no one ever will.
(4) Fossil evidence is dicey at best
(5) Genetic similarities are striking, but can just as easily be explained by Common Design (probably better when we really get into it) as by Common Descent
(6) Creos and Evos have strong and opposite opinions about something which cannot be proven because NO ONE CAN OBSERVE IT HAPPENING.  Contrast this with Gravity, etc.
(7) Evos are the "rulers" in academia right now and they like to call the Creos "non-scientific"
(8) There's hope for academia in spite of this thanks to courageous people like Morris, Dembski, Meyer, Denton, Behe and apparently a growing number of good scientists (over 500 signatories so far on a Darwin Dissent Document)

I need to get back to my main Creator God Hypothesis today if I can.  So do me a favor and just agree with me quickly so we can get on with it, would you?   :-)
----------------------------------------
Quote
Dave, sometimes your understanding of evolution seems very cartoonish. I really, really think you should read a few good books on evolutionary topics aimed at a general readership.
Is there a better author than Dawkins for this type of book?  I do read him some.
-------------------------------------
Quote
But here we are, a few days later, and now you're back to insisting that humans aren't even related to apes (despite the fact that humans are apes). Are we now going to have to assume that points you conceded a week ago are no longer conceded? Does this mean we're going to have to go over the same ground again and again with you, à la Thordaddy? Because that will get old very quickly.


No, no.  We will not have to cover anything over again.  I DO agree with all those things I said I agree with.  

I agree that I need to explain more fully why I believe the similarities favor Common Design over Common Descent.  I will try to address this soon.

Thanks
------------------------------------
Good morning to all my "Evo" friends ...

The Vitamin C issue with apes and humans seems to be a very compelling evidence for you that Apes and Humans do indeed share a common ancestor.

OK.  Let's take a look.  I assume everyone is familiar with the Talk Origins article my Dr. Edward Max here and the AIG article by Woodmorappe here, right?

Dr. Max begins with an analogy to a plagiarism case ...
Quote
One way to distinguish between copying and independent creation is suggested by analogy to the following two cases from the legal literature. In 1941 the author of a chemistry textbook brought suit charging that portions of his textbook had been plagiarized by the author of a competing textbook (Colonial Book Co, Inc. v. Amsco School Publications, Inc., 41 F. Supp.156 (S.D.N.Y. 1941), aff'd 142 F.2d 362 (2nd Cir. 1944)). In 1946 the publisher of a trade directory for the construction industry made similar charges against a competing directory publisher (Sub-Contractors Register, Inc. v McGovern's Contractors & Builders Manual, Inc. 69 F.Supp. 507, 509 (S.D.N.Y. 194

Date: 2006/05/22 21:12:11, Link
Author: BWE
6)). In both cases, mere similarity between the contents of the alleged copies and the originals was not considered compelling evidence of copying. After all, both chemistry textbooks were describing the same body of chemical knowledge (the books were designed to "function similarly") and both directories listed members of the same industry, so substantial resemblance would be expected even if no copying had occurred. However, in both cases errors present in the "originals" appeared in the alleged copies. The courts judged that it was inconceivable that the same errors could have been made independently by each plaintiff and defendant, and ruled in both cases that copying had occurred. The principle that duplicated errors imply copying is now well established in copyright law. (In recognition of this fact, directory publishers routinely include false entries in their directories to trap potential plagiarizers.)


Now I have read both articles in their entirety, but before Dr. Max even gets into the details of gene "mistakes", there is one very large item jumps out at me. The analogy seems very clever, but there is a huge assumption that is made which I consider to be invalid and to me this destroys the whole analogy.  See what you think and please correct me if I am wrong.

OK.  Are you ready?  With the plagiarism case, we are talking about printed words in a well-known language.  In the GLO gene case, we are talking about genetic "words" in a poorly-understood language.  I hope I don't have to cite the recent literature to prove to you how poorly we understand the genetic language.  If you do a Google Scholar search, you will see numerous articles talking about pseudogene and "junk DNA" function and how much we are learning and how much there is remaining to be learned.  Here's just one with an appropriate comment from Woodmorappe ...
Quote
Balakirev, E.S. and Ayala, F.J., Pseudogenes: are they ‘junk’ or functional DNA? Annual Review of Genetics 37:123–151, 2003. The very title of this article would have, only a few years ago, been almost on a par with the following: ‘The Earth: is it spherical or flat?’


Are you with me so far?  I don't want to lose anyone.  Again, I am saying that ...

With the plagiarism case, we are talking about printed words in a well-known language.  In the GLO gene case, we are talking about genetic "words" in a poorly-understood language.  This is a big, big difference.

Notice again that Dr. Max's whole argument rests on the following ...
Quote
In both cases, mere similarity between the contents of the alleged copies and the originals was not considered compelling evidence of copying ... The principle that duplicated errors imply copying is now well established in copyright law.


Do you see where I am going?  Dr. Max is assuming that the state of the GLO gene in humans and apes is an error and with our as yet limited knowledge of gene function, genome function as a whole, pseudogene function discoveries, and "not-junk-after-all" discoveries about "junk DNA", this seems to be an enormous unwarranted assumption.  If, in fact, this GLO gene turns out to have some function, then Max's whole argument fails, because now the gene would be rightly interpreted as part of the correct informational content analogous to the correct informational content in the textbooks.

To emphasize this point, consider a passage of text from a language which you do not know, but I do (my dad's jungle tribe for whom he is a Bible translator).  In this case, I am playing the role of the hypothetical "Designer" and you are playing the role of the genetic researcher trying to unlock the code.    Let us say the above plagiarism case involved the following text ...

Quote

ORIGINAL TEXT:  Twaihsom me thakwa xatkene roowo pono komo ahnoro.  Yipinin yaw so tko xakne Kaan.  Ero ke Tumumuru tak nimyakne rma okwe twaihsom mera tak ehtome so.  Waipini ro me xa matko naxe Noro pona enine komo.

ALLEGED PLAGIARIZED TEXT:  Twaihsom me thakwa xatkene roowo pono komo.  Yipinin yaw so xakne Kaan.  Ero ke Tumumuru tak nimyakne okwe twaihsom mera tak ehtome so. Waipini ro me naxe Noro pona enine komo.


While a word by word comparison of the above text gives some evidence of plagiarism, i.e. they are similar, you cannot conclude this positively if we use the court case guidelines because you do not know the language so as to be able to detect errors.

Now I DO know the language, so I can identify an error, namely that the word "cewnaninhiri" which means "only begotten" (it is John 3:16) is left out of both texts.

So we see that for Dr. Max's argument to be valid, we have to know the language which obviously, genetic researchers do not yet very well.


Now there is something else interesting here.  This text of John 3:16 could be rendered in a number of different ways and yet communicate the same meaning.  For example, we could say ...
Quote
Yipinin yaw so xakne Kaan roowo pono komo poko. Ero ke Tumumuru tak nimyakne okwe twaihsom mera tak ehtome so. Waipini ro me naxe Kaan pona enine komo.


I know the language well enough to know that this would communicate the same message, but with different structure.

Now, back to biology.  It is my theory that this is exactly the situation which we will find in the genomes of various organisms as we understand more and more about them every year.  I predict that we will find that the genetic code is a very real language, complete with "words", "sentences", "phrases", "paragraphs", and different ways of saying the same thing.

Now, here is something else ...

How do you explain the similarity of the GLO gene "defects" of humans and guinea pigs? (you knew I was going to go here, didn't you)  Apparently, something like 36% of the substitutions are the same when compared to the functional rat GLO gene.  If we assume that there is some pro-simian ancestor that has a functional GLO gene, then it would appear that humans are more closely related to guinea pigs than to this pro-simian ancestor.  This would seem to defy the evolutionary scenario.  How do you explain this?

OK.  There's some food for thought.  Now pick me apart.


Oh ... and here the quote from Balakirev and Ayala for you

Quote
Annual Review of Genetics
Vol. 37: 123-151 (Volume publication date December 2003)
(doi:10.1146/annurev.genet.37.040103.103949)

First published online as a Review in Advance on June 25, 2003

PSEUDOGENES: Are They "Junk" or Functional DNA?

Evgeniy S. Balakirev1,2 and ­Francisco J. Ayala1­
1Department of Ecology and Evolutionary Biology, University of California, Irvine, California 92697-2525; email: fjayala@uci.edu

2Institute of Marine Biology, Vladivostok 690041,

Russia and Academy of Ecology, Marine Biology, and Biotechnology, Far Eastern State University, Vladivostok 690600, Russia; email: esbalak@bio.dvgu.ru

Pseudogenes have been defined as nonfunctional sequences of genomic DNA originally derived from functional genes. It is therefore assumed that all pseudogene mutations are selectively neutral and have equal probability to become fixed in the population. Rather, pseudogenes that have been suitably investigated often exhibit functional roles, such as gene expression, gene regulation, generation of genetic (antibody, antigenic, and other) diversity. Pseudogenes are involved in gene conversion or recombination with functional genes. Link to article

And here's one I like from Dr. Max that confirms what us YECers so often say about mutations ...
Quote
Mutations causing genetic diseases and malformations are generally so detrimental to the organism's survival and reproductive success that in the wild--i.e. in the absence of modern medical science--they would tend to be "weeded out" by the pressure of natural selection. Rarely, mutations can be beneficial to an organism: these rare cases form the basis for evolutionary adaptations that improve the "fitness" of an organism to its environment.Link to article
----------------------------
And now, while you all are busy refuting me on this thread, I will hop back over to the "Creator God Hypothesis" thread and dive in again ...

It appears that no one accepts the evidence for a Creator I have given so far, so we will explore that some and find out why ...

See you there ... :-)
-------------------------------
Quote
Then, you notice a paragraph of about 400 characters that's identical in both samples. It's not in the same place in both texts, but it is absolutely identical down to the individual character. You even note that at the end of the fifth sentence, there's an extra period. You have no idea what any of the text means, but is there any doubt, at this point, that one sample was in fact at least partially copied from the other? Is there any possible doubt that both articles share a common provenance?

You don't need to know anything whatsoever about the language to make this determination, Dave. And it is far from true that biologists know nothing at all about the genetic code. In fact, they may not know what all the "paragraphs" (i.e., genes) in the genetic code mean, but they sure know what the "words" (i.e., codons) mean.


Are you saying that this is what has been found?  I did not understand that from the findings of the authors below ...

My knowledge of this
Quote
All we really know is that ... (a) it is somewhat similar to the functional rat GLO gene (149 out of 647 substitutions when comparing humans to rats, 96 out of 647 substitutions when comparing guinea pigs to rats),

comes from this
Quote
Inai, Y., Ohta, Y. and Nishikimi, M., The whole structure of the human non-functional L-gulono-ã-lactone oxidase gene—the gene responsible for scurvy—and the evolution of repetitive sequences thereon, J. Nutritional Science and Vitaminology (Tokyo) 49(5):315–319, 2003.


Apparently we do not have a situation of identical sequences if I am reading this correctly.  Or maybe there is another study that I could not find which states that the human and ape GLO genes ARE identical?
-------------------------
Again ... IF we find the GLO gene sequences identical (or very close) in apes (I think we only have rat, human and GP currently), why does this prove common descent of apes and humans?  We do not KNOW that the human (and presumable ape) manifestation is in fact an "error" because we don't know the genetic language well enough yet.  All we know is that BOTH apes and humans cannot synthesize Vitamin C.  It is and ASSUMPTION to say that "see it's because their GLO gene is broken."  How can you say that?  Maybe that's was never intended to BE a GLO gene in the first place.  You don't know because you don't know the language well enough yet.

My bet is that when we DO learn the language well enough, we will see it has a purpose far different that Vitamin C production.

Here's another analogy ...

Do you think that "The dog is barking" and "The dog is barfing" means that the second sentence is somehow "broken"??  Of course not.  They are both valid sentences but they mean ENTIRELY different things.

Also, in our language, the same words can mean two different things in different contexts, i.e. "bark" (dog) and "bark" (on a tree).

I really think Dr. Max is making a bad analogy and assuming too many things.
-------------------------------
Quote
Can you tell me what a "frameshift mutation" is?
Can you tell me the significance of a frameshift mutation?

Somewhat familiar ... I can read up on it quickly if I need to ...

But go ahead ... why is that significant here?  I honestly want to understand this

Quote
Yeah. Look at the cytochrome c gene.
I thought were talking about the GLO gene which supposedly formerly allowed Vit C production in primates, but now is broken and does not anymore.  Why do you mention Cytochrome C genes?
---------------------
Quote
What if "The dog is barking" and "The dog is barfing" were two sentences from two different novels that were 95+% similar?

You seem to be forgetting the Vitamin C stuff happens in that kind of context.


No I'm not forgetting.  But OK.  Let's write a "novel" describing how to make a pine tree and another "novel" that describes how to make an oak tree.  OK?

HOW TO MAKE A PINE TREE
Start with a 50 foot long piece of soft wood.  Add some rough bark.  Poke it upright in the ground.  Add some kinda straight branches that angle down.  Add leaves that are thin and poky.  Etc. Etc.

Voila!  Pine Tree!

HOW TO MAKE AN OAK TREE
Start with a 50 foot long piece of hard wood.  Add some semi-rough bark.  Poke it upright in the ground.  Add some kinda crooked branches that angle up.  Add leaves that are broad and smooth.  Etc. Etc.

Voila!  Oak Tree!

Now ... notice they are 95% (or so) similar?  Do they share a common ancestor?  No.  I assembled them in my backyard with raw materials following these highly detailed instructions. (I didn't really, but I could have)

The burden of proof for Common Descent seems to me to be much more difficult that the burden of proof on Common Design.

Thoughts?
-------------------------
Quote
Wrong again, pine breath! You are the common ancestor of both.

Hey watch it, oak breath ... I am the common DESIGNER of both :-)

Quote
It's hard to judge as you haven't presented any evidence for common design.
This is what the ID movement is all about.  Stay tuned!  And tell your friends to quit throwing fire bombs and at least listen .... then make judgment.

That's the hard part -- even getting people to listen --because most people are so set in their thinking.

Well ... I'm quitting until evening ... so I guess I'm gonna start losing now by default.
-----------------------
Good morning everyone--

We are getting close to wrapping up this thread and I feel it is an important thread because the differences between apes and humans are in fact immense, and whether you realize it or not, there are many major issues riding on the answer to the question, "Common Descent or Common Design?"  

The bottom line, of course, is ...

IF Common Descent is true, then there is no need for a Creator.  Humans are free to believe in one, or pretend there is one, or whatever.  None of the 'God talk' really matters much and those who don't care to participate in 'God think' are free to leave 'Him' completely out of their thoughts and discussions.  There is no afterlife, no heaven, no ####, no judgment for actions in this life, and the best we can do is live in harmony with our fellow man and have a good time until we die.  And when we die, that's the end of the story.

However, IF Common Design is true, then this raises a whole string of potentially life changing questions.  What is this Designer like?  Is it one Designer?  Or many?  If He designed ME, does he want anything from me?  The Creation myths are well known ... could there be any truth to any of them?  After all, there is one in particular that speaks of a Creator God who will someday hold humans accountable for their actions.  Could there be any truth to this?  Could it be that the Creator God spoken of in the Bible might in fact be one and the same as the Designer of the Cosmos and Biological Systems for which evidence continues to mount?

I think it was Renier (can't remember for sure) who said that he "used to be a YEC fundy" but is no longer because of the Vitamin C issue.

Just to recap yesterday ... Talk Origins has two relevant articles that I found

(1)  Plagiarized Errors and Molecular Genetics
Another argument in the evolution-creation controversy
by Edward E. Max, M.D., Ph.D.

and

(2)  29+ Evidences for Macroevolution, Part 2: Past History
Copyright © 1999-2004 by Douglas Theobald, Ph.D.
Prediction 2.3: Molecular vestigial characters

Abstracts for the 3 articles referred to by the second article are as follows:
Quote
Abstracts from Talk Origins:  29+ Evidences - Vitamin C Pseudogene

1: J Biol Chem. 1992 Oct 25;267(30):21967-72. Related Articles, Links  
Guinea pigs possess a highly mutated gene for L-gulono-gamma-lactone oxidase, the key enzyme for L-ascorbic acid biosynthesis missing in this species.
Nishikimi M, Kawai T, Yagi K.
Institute of Applied Biochemistry, Yagi Memorial Park, Gifu, Japan.
Guinea pigs cannot synthesize L-ascorbic acid because of their deficiency in L-gulono-gamma-lactone oxidase, a key enzyme for the biosynthesis of this vitamin in higher animals. In this study we isolated the L-gulono-gamma-lactone oxidase gene of the rat and the homologue of this gene of the guinea pig by screening rat and guinea pig genomic DNA libraries in lambda phage vectors, respectively, using a rat L-gulono-gamma-lactone oxidase cDNA as a probe. Sequencing analysis showed that the amino acid sequence of the rat enzyme is encoded by 12 exons and that all the intron/exon boundaries follow the GT/AG rule. On the other hand, regions corresponding to exons I and V were not identified in the guinea pig L-gulono-gamma-lactone oxidase gene homologue. Other defects found in this gene homologue are a deletion of the nucleotide sequence corresponding to a 3' 84-base pair part of rat exon VI, a 2-base pair deletion in the remaining exon VI-related region, and nonconformance to the GT/AG rule at one of the putative intron/exon boundaries. Furthermore, a large number of mutations were found in the amino acid-coding regions of the guinea pig sequence; more than half of them lead to nonconservative amino acid changes, and there are three stop codons as well. Thus it is clear that the guinea pig homologue of the L-gulono-gamma-lactone oxidase gene exists as a pseudogene that randomly accumulated a large number of mutations without functional constraint since the gene ceased to be active during evolution. On the basis of the neutral theory of evolution, the date of the loss of L-gulono-gamma-lactone oxidase in the ancestors of the guinea pig was roughly calculated to be less than 20 million years ago.

J Biol Chem. 1994 May 6;269(18):13685-8. Related Articles, Links  
Cloning and chromosomal mapping of the human nonfunctional gene for L-gulono-gamma-lactone oxidase, the enzyme for L-ascorbic acid biosynthesis missing in man.
Nishikimi M, Fukuyama R, Minoshima S, Shimizu N, Yagi K.
Institute of Applied Biochemistry, Yagi Memorial Park, Gifu, Japan.
Man is among the exceptional higher animals that are unable to synthesize L-ascorbic acid because of their deficiency in L-gulono-gamma-lactone oxidase, the enzyme catalyzing the terminal step in L-ascorbic acid biosynthesis. In the present study, we isolated a segment of the nonfunctional L-gulono-gamma-lactone oxidase gene from a human genomic library, and mapped it on chromosome 8p21.1 by spot blot hybridization using flow-sorted human chromosomes and fluorescence in situ hybridization. Sequencing analysis indicated that the isolated segment represented a 3'-part of the gene, where the regions corresponding to exons VII, IX, X, and XII of the rat L-gulono-gamma-lactone oxidase gene remain with probable deletion of the regions corresponding to exons VIII and XI. In the identified exon regions were found various anomalous nucleotide changes, such as deletion and insertion of nucleotide(s) and nonconformance to the GT/AG rule at intron/exon boundaries. When the conceptual amino acid sequences deduced from the four exon sequences were compared with the corresponding rat sequences, there were a large number of nonconservative substitutions and also two stop codons. These findings indicate that the human nonfunctional L-gulono-gamma-lactone oxidase gene has accumulated a large number of mutations without selective pressure since it ceased to function during evolution.

Biochimica Biophysica Acta, International Journal of Biochemistry and Biophysics,(ISSN: 00063002) 1999 Oct 18;1472(1-2):408-11.  Related Articles, Links
Random nucleotide substitutions in primate nonfunctional gene for L-gulono-gamma-lactone oxidase, the missing enzyme in L-ascorbic acid biosynthesis.
Ohta Y, Nishikimi M.
Department of Biochemistry, Wakayama Medical College, Japan.
Humans and other primates have no functional gene for L-gulono-gamma-lactone oxidase that catalyzes the last step of L-ascorbic acid biosynthesis. The 164-nucleotide sequence of exon X of the gene was compared among human, chimpanzee, orangutan, and macaque, and it was found that nucleotide substitutions had occurred at random throughout the sequence with a single nucleotide deletion, indicating that the primate L-gulono-gamma-lactone oxidase genes are a typical example of pseudogene.

The first article above compares the functional rat GLO gene with the supposedly homologous guinea pig GLO gene and finds significant differences.  They say "Thus it is clear that the guinea pig homologue of the L-gulono-gamma-lactone oxidase gene exists as a pseudogene that randomly accumulated a large number of mutations without functional constraint since the gene ceased to be active during evolution."

The second article does the same comparison for rats and humans and concludes ... "These findings indicate that the human nonfunctional L-gulono-gamma-lactone oxidase gene has accumulated a large number of mutations without selective pressure since it ceased to function during evolution."

The third article does the same comparison among humans, chimpanzees, orangutans, and macaques, and it was found that "nucleotide substitutions had occurred at random throughout the sequence with a single nucleotide deletion, indicating that the primate L-gulono-gamma-lactone oxidase genes are a typical example of pseudogene."

Dr. Max draws on these findings and compares the situation to a copyright court case.  His argument is that since apes and humans have the same "errors" in the "broken GLO gene", this shows that apes and humans have a common ancestor.

Now this has one HUGE assumption which appears to me to be entirely unwarranted.  now maybe it is warranted,  but no one gave me any reasons that it should be yesterday

DR. MAX's HUGE ASSUMPTION
The apparently homologous "GLO gene" in humans, primates and guinea pigs used to function to produce Vitamin C, but now no longer does.  As such this constitutes a "broken gene" caused by random mutation.  My question is ... why do you assume these 3 organisms EVER had a functioning GLO gene?  Maybe this gene DOES HAVE a function which we just don't know about.  After all, we are seeing a dramatic reversal in the area of pseudogenes.  Scientists are all of a sudden finding all kinds of purpose for them.  Do a Google Scholar search to see this.

Does anyone have any good arguments for why this is a good assumption to make?

Because Dr. Max's whole argument rests on this being a valid assumption.  If it is not valid, then his whole argument fails.

OK ... now tell me ... why is this assumption valid?

(By the way, Tom Ames, I didn't see that frame shift mutations have anything to do with this discussion, but please correct me if I am wrong)
-----------------------
Thanks to Tom Ames for clarifying one point -- I thought you were bringing up something that was relevant to our discussion of the supposedly "broken GLO gene", but apparently I was mistaken.  

Maybe it's time for a review again.  I'll put it in bold so no one will miss it ... then I'll repeat it a few days from now for the slow ones

THINGS THAT ARE NOT AF DAVE'S GOALS
(1)  Get a biology degree
(2)  Become a genetic engineer
(3)  Get an advanced science degree
(4)  Become a biochemical researcher
(5)  Pretend I know more about biology than you
(6)  Become a geologist
(7)  Become an astrophysicist

OK?  ... again, I appreciate all the admonitions to get this or that degree or go buy this or that book ... but it's not necessary ... there are plenty of competent researchers like Mr. Nishikimi out there who give me the data I need, and of course I do have YOU ALL to keep me straight.

And I should point out that you guys do a great job of knowing biology and the workings of DNA and transcription and chromosomes and all these wonderful details.

Your problem is NOT your comprehension of the data or in understanding the mechanics of how things work.  You are even quite good at explaining this stuff -- Incorygible did a great job explaining the transcription thing.  Spent a lot of time on it too, I understand.

Your problem is simply your interpretation of data and your sometimes faulty logic.  I don't fault you for this ... it's understandable because of the overwhelming power of your Darwinian worldview.  You have been fed a steady diet of Darwinism since you were very young and it wields much power over your minds (much like a religion) and while this is not a problem for most of the things you do, it makes you fall into saying some illogical things when you start trying to explain your view of origins.



THINGS THAT ARE AF DAVE'S GOALS HERE AT PANDA'S THUMB
(1)  Find out firsthand why Darwinists believe humans and apes have a common ancestor and evaluate if this is reasonable.  We're making good progress here.
(2)  Find out firsthand why Darwinists are apparently losing the PR game in the USA.  I find it strange that Darwinists have been so unsuccessful in convincing the public of their views because of the virtual monopoly that Darwinists hold over schools, museums, magazines, the media, etc.
(3)  Present my evidence that supports a Designer, followed by evidence for YEC, the Flood, the inerrancy of the Bible, etc.
(4)  Help as many open-minded folks as possible who read my threads walk through all of my "SEVEN STAGES IN THE EVOLUTION OF A FORMER DARWINIST."

Again, these are ...

SEVEN STAGES IN THE EVOLUTION OF A FORMER DARWINIST
STAGE 1: ToE advocates are becoming frustrated because their explanations are sounding more and more like pro-geocentrism and pro-flat-earth arguments as time goes on.  
STAGE 2: The Ship of Darwin has hit an iceberg and a few brave souls are jumping into life boats before it sinks.  See www.dissentfromdarwin.org
STAGE 3: And now, ordinary amateur scientists like me are jumping in the fray and shining the light on their weak arguments.
STAGE 4: Frustration ensues, followed by name calling, arrogant and belittling comments, talk of censorship, and the like.
STAGE 5: This is turn fuels more doubts in people minds. ("Why would that guy resort to name calling?  Doesn't he have any GOODS?" etc.)  
STAGE 6: Which in turn fuels more frustration and mental anguish.  And so the cycle goes until finally for some ... in a desperate moment ... possibly in the middle of the night ... or out on a peaceful lake while fishing ...
STAGE 7: THE LIGHT BULB COMES ON!  (Trumpets) And one more Darwinist is rescued from the darkness of error.


Now that we have that clarified, the present issue that we are discussing is ...


THE SUPPOSEDLY BROKEN VITAMIN C GENE IN HUMANS AND APES
Again, some of you need to re-read yesterday's posts because someone made the same mistake today which was made yesterday, namely, someone today was basically saying ...

"Of course humans and apes have a broken Vitamin C gene.  Isn't that obvious?  Wouldn't it be obvious if there were some tires and broken car pieces laying on the side of the road that we were viewing a broken car?"

YES with the car.  NO with the genes.

Your mistake in logic is that you have ASSUMED that humans and apes at one time in their history actually had a functional GLO gene.  This has to be your assumption if you say it is "broken" now, and the fact is that you do not know this.  Also, you are assuming that you (or the genetics researchers, rather) know enough about the genetic language to even recognize an error.  My contention is that we (genetic researchers) know SO LITTLE about any genomes, that we cannot assert that this gene or that gene is broken.

Please tell me that you guys ARE aware of all the new information coming in about "junk DNA" that apparently isn't junk after all (the gene we are discussing IS one of those genes, right?)?  

You guys are the biology experts ... you should know this.

So am I clear now?  You guys did very well on the Chimp Chromosome thing, but on this thread, it seems you don't have much understanding of this particular issue and many of you apparently have not even read the relevant articles.

Do you really want me to go away from this thread thinking you guys are confused about this issue?  Because right now, that's what I think.  Remember, one of my goals is to try to determine why Darwinists have been only mildly successful in selling their views on the open market.  Your arguments on this thread so far help me understand why this is.

Maybe you can think about some of this tonight and redeem your arguments tomorrow.

Remember, you guys did good just last week on the chromo thing ... I know you guys can give me some substance on this thread as well.

Again, this is really simple ... all you have to do is present evidence of WHY you are so sure that humans and apes formerly had a functioning GLO gene, but now do not.  Simple, right?  Sleep on it ... it'll probably come to you.

(Oh, and BTW ... I think Atheists are very good, moral people ... it's the long term trend of society that worries me, but we'll get to that elsewhere ...)

Have a good night and I'll see you in the morning!
-------------------------
Argystokes said ...

Quote
Hi AFDave,

Let me see if I can add something to the conversation.

You've been arguing that what appears to be a broken GLO in primates may not be in fact broken at all, but is rather a designed stretch of DNA that performs some unknown function (we'll call this "pseudo-GLO").  You haven't stated it explicitly, but I think we can infer that this putative function has nothing to do with Vitamin C synthesis (seeing as primates and guinea pigs can't do it).  That is, pseudo-GLO has a function entirely distinct from regular GLO.

If pseudo-GLO has a distinct function, we could use the framework of common design (as well as common descent) to predict that pseudo-GLO would be found in organisms that have functioning GLO.  This is because there is no reason to predict that a gene unrelated to Vitamin C would only be found in GLO-deficient species.

So there are two possible scenarios:
(1) Pseudo-GLO is found throughout the animal kingdom (either ubiquitously, randomly, or in nested hierarchies).  This type of scenario, where a species has a functional gene and a pseudogene is not uncommon.

(2) Pseudo-GLO is only found in species unable to synthesize vitamin C.

It seems to me that a design hypothesis would only predict scenario (1), for reasons discussed above.  Common descent would predict either scenario (2), or scenario (1) with nested hierarchies of Pseudo-GLO (this would be the result of a duplication of GLO followed by the inactivation of one of the copies, which still persists in the population).  Seeing pseudo-GLOs (especially those that look very much alike) randomly throughout the animal kingdom would certainly be a surprise to me (I can think of a mechanism by which it might occur, but we won't get in to that).  Ubiquitous pseudo-GLO would strongly imply that it has an important function, but would not really support either common descent or common design over the other.

I haven't done the research to find out which is the case, but there should be sufficient online tools to find out which is the correct scenario.  With the relatively low number of genomes sequenced, it is probably not possible right now (using good ole look-it-up-online methods) to differentiate between the subscenarios of scenario (1).

I'm willing to look up the information for you (assuming you don't know how to do a BLAST search) if you're willing to concede that scenario (2) does not logically fit with a special creation model.

So how's about it, Dave?  Shall we do some science?


This is an excellent discussion here.  I like the terminology you use to keep everything clear.  You are correct that I have lately focused on the question "Why are researchers so sure this is a broken gene?"  I think this is a legitimate question to ask (but I could be wrong) in light of statements like this from Watson (co-discoverer of DNA) in 2003 ...


Quote
‘The most humbling aspect of the Human Genome Project so far has been the realization that we know remarkably little about what the vast majority of human genes do.(Watson, J.D., DNA: The Secret of Life, Alfred A. Knopf, New York, p. 217, 2003.)

and we are obviously learning much about pseudogenes as the following title suggests ...

Quote
PSEUDOGENES: Are They "Junk" or Functional DNA?
Evgeniy S. Balakirev1,2 and ­Francisco J. Ayala1­
1Department of Ecology and Evolutionary Biology, University of California, Irvine, California 92697-2525; email: fjayala@uci.edu
2Institute of Marine Biology, Vladivostok 690041,
Russia and Academy of Ecology, Marine Biology, and Biotechnology, Far Eastern State University, Vladivostok 690600, Russia; email: esbalak@bio.dvgu.ru



And the answer may well turn out to be that it is in fact a broken gene, when more is known.  But if the answer is "Yes, it IS broken", then there is another question which immediately follows.  I mentioned this early on and we never explored it.  The next questions would be these ... "Did it break independently in humans and apes?  Or did it break in our ape-like ancestor and get transmitted to both apes and humans as Dr. Max asserts?"  Is it not just as plausible that both ape and human GLO "broke" independently?  Design hypothesis predicts similarity in the the two genomes also, but for a different reason than common descent advocates.  It seems to me that it is quite probable that IF apes and humans did in fact at one time have functional GLO, the functional genes would have been quite similar (is it not true that OTHER functional genes found today in apes and humans are similar?)and the large differences b/t apes and humans that we see today would have also been seen at that time in the past.  This scenario also seems to me to be supported by the 2003 Inai study comparing guinea pig and human pseudo-GLO.  Guinea pigs and humans are obviously not in sister groups, but they both have pseudo-GLO, which actually has 36% "identicalness" according to the report.  Are we to conclude that humans are more closely related to guinea pigs who (like humans) have pseudo-GLO, than to pro-simians who have functional GLO?  It seems that the guinea pig-human pseudo GLO similarity all by itself falsifies common descent for apes and humans.

So I think the following possibilities exist ...
(1) Pseudo-GLO is NOT "broken GLO" and is found throughout the animal kingdom (either ubiquitously, randomly, or in nested hierarchies).  This type of scenario, where a species has a functional gene and a pseudogene is not uncommon.
(2) Pseudo-GLO IS "broken GLO" and is only found in species unable to synthesize vitamin C ... this is because the gene "broke" in the ape-like ancestor, then this "broken gene" was copied throughout the evolutionary path to humans.  If this is true, however, you would still need to explain how the gene broke independently in the guinea pig ancestor, but wound up in modern guinea pigs looking "36% similar" to modern human pseudo-GLO.  You have the problem of the appearance that humans are more closely related to guinea pigs than to the pro-simians! (who have functional GLO)
(3) Pseudo-GLO IS "broken GLO" and is only found in species unable to synthesize vitamin C ... this is because all animals were designed with a functional gene, but now some have independently lost function because of mutations.


I realize that at this point, I have not given positive evidence for the Design Hypothesis regarding apes and humans, because that was not my goal on this thread.  I have only pointed out that Dr. Max's assumptions -- (a) this is a broken gene and (b) if it is broken, this proves common descent -- are unwarranted assumptions.

This whole thread started because someone (I think Renier) said he used to be a YEC advocate, but abandoned it because of this issue which he thought was a closed case.  If nothing else, I think I have shown that it is definitely not a closed case.

As for which of the above 3 scenarios is true, I obviously do not know yet.  It does appear that (2) is not consistent with the evidence that we DO have.  My suspicion is that (3) will turn out to be the correct one when more is known.  Either (1) or (3) appears to be consistent with the Design Hypothesis.




Quote
ps Once again could you confirm or deny that you don't think we can infer any of this stuff as we didn't see it happen.
I confirm that we can indeed infer many things in spite of the fact that we did not see it happen with our own eyes.  In fact, this is my exact argument on my other thread where I INFER a the idea of a Super-Intelligent Engineer from "apparently engineered" biological "machines."  I also INFER an Intelligent "Parameter Setter" from the "apparent precise setting" of the many parameters required for life in the Cosmos in which we find ourselves.


Quote
1- This is ironical, coming from someone taking the Bible as evidence for his hypothesis.
Again, if you read my threads, you will see that Bible is  a source for plausible hypotheses.  It is not "evidence" to support them.  My evidence comes from scientific observation of nature.


Quote
It's not an assumption. It's a tested hypothesis that follows from the theory of evolution. It's been cross-checked in thousands of organisms and it fits neatly with all the data. I asked you to explain why Nishikimi could expect to find gulo-homologous sequences in humans, orangs and guinea pigs, if not because of common descent. No response.
Are you saying that the analysis proposed by Argystokes has already been done?  I know of GLO being analyzed in a few primates, guinea pigs and humans, but thousands of organisms?  



Quote
By the way, it's rather amusing to see you try to lecture people on mistakes in logic:  "IF Common Descent is true, then there is no need for a Creator....There is no afterlife, no heaven, no ####, no judgment for actions in this life, and the best we can do is live in harmony with our fellow man and have a good time until we die.  And when we die, that's the end of the story.
Is this what you consider logic? There couldn't possibly be a God, heaven, he##, and common descent? Why not?
Notice carefully what you just did ...

I said this ..."IF Common Descent is true, then there is no need for a Creator"

and you quoted me as saying this ...

"There couldn't possibly be a God, heaven, he##,and common descent?

BIG, BIG difference.  Think about it.  We need to be very careful in our quotes and our logic.  I believe these types of assumptions, rushes to judgment, and lack of sound logic are precisely why Darwinists are painting themselves into a corner which will ultimately be an embarrassment to them.  We have already seen the embarrasment to Darwinists of their failed predictions in the fossil record.  Darwinists predicted continuous transitional forms in the fossil record.  Creationists predicted ubiquitous gaps.  Creationists were correct.  Darwinists predicted true "vertical evolution" (or macro-evolution), but leading evolutionary scientists have now admitted that no true vertical evolution from one kind of organism to a more complex kind has ever been observed in all human history. Creationists predicted that any "evolution" would be lateral or downward and this has been confirmed.  Creationists also predicted the limited variation that we see in natural and artificial selection, but Darwinists try to use this as evidence for their failed predictions of true vertical evolution, when in fact it is better evidence for "designed adaptability" put in the originl created "kinds" by the Creator.  Since all this and many other things outlined by Denton and others have been embarrassing and unanswerable by Darwininsts, they are now repeating the same logical mistakes at the molecular level.  I predict the results will be the same.  And if that were not enough, they are calling Creationists and ID people stupid for questioning their theories!!


Quote
After all, it could be that the Flying Spaghetti Monster created us with his noodly appendage.
I admit this is a logical possibility.  I challenge you to find evidence which supports it.

Quote
AFDave: Your smugness is quite grating. I assume you're doing that on purpose, no? It always amazes me how the preachiest christians lack what I would have thought would be the "zeroth commandment" of christianity: humility.
Have I not demonstrated humility by "eating crow" graciously about the chimp chromosome issue?  I think what you perceive as smugness here is in reality a little bit of satire and poking fun at a theory.  I am trying very hard to use innovative tools to jar people's thinking.  I think Darwinists are so steeped in logical fallacies that it takes something rather jarring to make them wake up and see the errors.

Quote
I think that idea sounds a little screwy, but it does seem to me that some junk DNA won't be the vesigial stuff we are predicting. Supposedly 90 percent of our genetic material is this junk DNA, but our bodies don't support 90 percent  junk organs -- or vestigial organs -- why would our DNA?
My point exactly.  I am not familiar with the "fractal" theory or whatever it was.  I do not claim to have an idea about what all that "junk DNA" does.  It will be fun to investigate it though.

Quote
No, dave. It's not an assumption. It's an inference, based on evidence. There's a difference.

Thank you for agreeing with me (and Meyer) that INFERENCES to the Best Explanation are valid.  This is exactly what I am doing on my other thread to try to explain a Creator.
--------------------
Quote
I just performed a quick BLAST of GULO (exon 10), and the homology between human and chimp is 97%.
No surprises there, right?

So you want the original article? ... I can probably have it on Monday or Tuesday ...

Are you saying you will agree with me if I give it to you?

(Just kidding!;)
---------------------------------
Quote
It's not even necessarily true on that 'one little piece of DNA'. Whats the sequence similarity for the GLOs? We just know in this discussion that two are broken. It's absolutely idiotic to use this single fact to infer things about common descent.


Steve!  My buddy!  You and I agree on something ... I KNEW it would happen sooner or later.

That's what I've been trying to say ... Dr. Max's article on T.O. uses this as evidence of common descent for apes and humans.  My point has been all along that this assertion is not warranted with just this little bit of knowledge that we have.

But I'm also not saying it proves Common Design.  It obviously doesn't, but it at least argues that either one is a possibility.

Again, the whole thing started with Renier saying "Look ... Dr. Max has proven common descent with this Vitamin C thing" which I think he has not.
-----------------------------
Quote
afdave, that's just retarded! And you're quote mining. steve is talking about that so called 36% similarity being poor evidence of our relatedness to rats.


Aw come on ... you mean Steve isn't agreeing with me here?  Bummer ...

Oh well ... gotta keep trying!  Gonna happen sooner or later ...

I AM interested in hearing the outcome of the big Saturday night event ... "Max vs. Woodmorappe"

Faid?  Any more analysis from your corner?
-----------------------------
Quote
Why do you ask? Got anything to share?


I thought you were going to show why Dr. Max of Talk Origins is correct and Woodmorappe of AIG is wrong on this "Vitamin C gene" issue.

That's what we were talking about ...
-------------------------------
Quote
There it is.  They [AIG] don't do science, they do apologetics.  They don't do any scientific research for themselves--the best you can say is that they are armchair critics.


Armchair critics ... er, yes ... sort of like you, right?

It's funny that Evos think that Creos should "do their own research."  That would be like me saying   "PT and TO people shouldn't quote researchers like Nikimishi and Inai ... they should do their own research!!"

Pretty silly argument, now, isn't it?

Yeah, I thought so ... you can take it back if you like ... I won't embarrass you by quoting you further.
------------------------------
Quote
So Dave, since 36% of similarity between the broken GLO genes in guinea pigs and human are very low and support our view, what is your interpretation?

My view is that Dr. Max made an unwarranted assertion by saying that "GLO mistakes" were copied from the common ancestor of apes and humans.  I think the GLO situation we have in humans and apes today could just as easily support Common Design Theory.  

Of course, it is fine for him to have that interpretation if he chooses.  I just think we know too little to be dogmatic as he seems to be.

Renier said that basically this was a closed case for him and was the very issue that made him abandon the YEC position.

*********************
Separate issue:  the guinea pig thing

This is interesting, but I'm not saying anything dogmatic about it.  I really don't understand enough about it and I would value Jeannot's analysis of the AIG article.  Jeannot, do you also have the Inai article that AIG quotes?

It appears that they are saying that humans would be more closely related to guinea pigs (because humans also have broken GLO) than to pro-simians (functional GLO) if we followed evolutionary logic, but this is obviously absurd, because they are not related.  Again, I don't know if I agree with this or not.

I think they are also pointing out that evolutionists agree that guinea pig GLO broke independently from the simian line, so why shouldn't we expect ape GLO to break independently from human GLO?

We should.  At the very least, we cannot dogmatically say that the GLO gene definitely broke in the common ancestor, then was copied to apes and humans.

Do you agree?
------------------------
Faid said ...  
Quote
Dave, we're referring to AiG and all their proclaimed experts, like Woodmorappe, not you. You reply by referring to us.
And AiG does not quote scientific research that supports Genesis (because there isn't any, and they cannot come up with any), so they take existing scientific research and try to twist and distort its data to their liking. They're liars, dave.


I was not referring to you.  What I said was ...  
Quote
That would be like me saying "PT and TO people shouldn't quote researchers like Nikimishi and Inai ... they should do their own research!!"


My point was that people like Dr. Max on Talk Origins use other people's research (Inai, Nikimishi, etc.) and draw conclusions ... why shouldn't AIG do the same?  Obviously they are going to have different conclusions because they hold a different world view.  This is not lying.  You have not shown me one lie they have told.  You have shown me that Dr. Wieland was uninformed about transcription direction being unimportant.  And I agreed with you. But you have not shown me that they lie.


Quote
It's not simply the fact that GLO is 'broken.' It's the exact nature of the 'breaks.' That's what supports evolution & common descent.

You realize that genes are generally a few thousand base pairs long (or longer), right? And you realize that there are many, many, many different genetic changes that can 'break' (inactivate) any given change?

So, if humans and other great apes all have an inactivated GLO gene, and the cause of the inactivation is virtually identical in all of them, that's evidence for evolution via common descent. Not proof. Evidence.

I do understand all this, yes.   I think my understanding is correct that human and ape genes are about 95% (or 97) similar.  My assumption would be that the inactivated GLO gene would likewise be approximately 95% (or 97 or whatever it really is) similar also.  Is this correct?  Or am I to understand that human and ape GLO is 100% IDENTICAL?  Can someone confirm this for me?

If the former is true, then to me it is clear that Dr. Max's assertion that this proves common descent is an OK guess, but it doesn't close the case.  One could just as easily say that apes and humans are separate designs and the GLO broke independently in each.  Why should we think it would not?  Apparently it did also break independently in guinea pigs.

And again, the 36% thing to me is a side issue.  What I am trying to show is simply that Renier said that Dr. Max said that the broken GLO in humans is exactly 100% the same as in apes.  Enter Dr. Max's copyright case. And yes, IF this is the situation we in fact have, then I would agree ... it looks like common descent.


Quote
What we can say is that evolution not only provides detailed, mechanistic explanations of the available data, is also accurately and reproducibly predicts new observations. Creationism does neither of those things. That's why evolution is science, and creationism is not. That's why evolution should be taught in science class, and creationism should not.
Creationism HAS provided many detailed explanations of the available data and has accurately predicted many things, including ubiquitous gaps in the fossil record and the inability to induce "good changes" or "vertical evolution" in fruit flies by "speeding up the evolutionary timescale." It has predicted a certain "fixity of kinds" and "downward evolution" (not "upward") (note we are using MY terminolgy here in which humans are "at the top" of the hierarchy and single celled organisms are at the bottom--this is my convention, of course, but I believe it to be a good convention which in many ways can be a useful organizational tool) which in fact has been observed--i.e.  our bodies continue to accumulate more and more harmful mutations and the bacteria are winning, among other things.  It hypothesized that coal does not require millions of years to form, but can be formed quite quickly.  This has now been shown.  It hypothesized that sedimentation such as that seen in the Grand Canyon is not formed gradually over millions of years, but is formed catastrophically.  This has now been proven at Mt. Saint Helens where there is a "miniature Grand Canyon which was not there before 1980.  Creationism and the idea of the the Curse has the only sensible description of human nature which lines up with what we actually observe.  And many other things which we have already begun to get into on my "Creator God Hypothesis" thread.


Quote
According to common design, the creator would have put broken copies of a gene in each species, copies that reflect the current phylogeny, built with coding genes. Why would he? A broken gene is not part of a design, it's useless.

You said you would readily accept any evidence for common descent. I don't think you are sincere. What kind of proof would convince you?
Please see above.  Can you confirm that the broken GLO gene is 100% identical to the broken ape GLO gene?  If so, then I think you have something.


Quote
And what are your thoughts on the fact that AIG only referred to the 36% homology between guinea pigs and humans, but forgot to mention the 97% identity between us and chimpanzees? Silly mistake again?
No.  Just irrelevant to their discussion.  The whole Inai paper discussion (I think) is intended to show that "Guinea pigs GLO gene broke independently.  Why shouldn't apes and humans GLO gene ALSO break independently?  They may be trying to say something further than this also when they get into the pro-simian discussion and 36% etc., but I don't really follow that part of their argument.  They freely acknowledge elsewhere that there is great similarity in ape and human genes, so it is clear they are not trying to obfuscate.  They may think it will come in a bit less--maybe 90%--when more is known, but even if it stays at 95-97, this does no damage to their idea that apes and humans DO NOT share a common ancestor.  A house builder builds many houses that look similar--97% similar probably--but this is obviously because of a Common Designer, not Common Descent.

By the way, the 36% 'similarness' number comes from 47 out of 129 substitutions, i.e. 47/129=0.36.  I do have the complete Inai article, and they themselves say "A high percentage of the same substitutions in the total substitutions (36%) indicates that there were many hot spots for nucleotide substitution throughout the sequences examined." (Journal of Nutritional Science & Vitaminology, 2003, Vol. 49, Issue 5,p. 316).  This does not lead to any profound conclusions for me ... how about you?

I did not see anything in this article which would confirm 100% identicalness of human GLO to ape GLO.  Possibly some other article has this?


Quote
I keep asking, and you keep not answering: what, in the "common design theory", would have led Nishikimi to expect to find gulo homologs in humans and guinea pigs?"
To me it is quite conceivable that a Designer designed functional GLO genes in all the distinct "originally created kinds."  The fact that Human Designers make similar structures to perform similar function should have led Nishikimi to expect to find homologues in the natural world as well.  I don't think the genes have to be identical to be functional.  Just as several different codons can code for a particular protein (I think that's correct, right?--help me all you genetics experts). Similarly, in the English language, I can say I'm going to go grocery shopping in a variety of different ways ... "I'm going to go buy some food" and "I'm gonna drop by Safeway and restock our vittles" and "I'm going to go to town and get our pantry restocked" all communicate the same idea but with very different words.  There is no reason in my mind to think that the situation in genetics is any different than this.  


Quote
Apparently the fossil evidence, DNA sequence analysis, chromosome structure, and a coherent theory are not enough. What kind of proof would convince you?
100% identicalness of the GLO gene between apes and humans would be a good piece of evidence to me.  The whale evolution sequences presented to me are very unconvincing.  The chromosome thing is the best one I have been given yet, but again, considering the above discussion, why couldn't a Designer have used the '2A and 2B' chromosome info that he used for apes, modified it slightly by fusing it and a few other changes, then inserted this into the human genome?  Or vice versa.  Maybe He used Human chromosome 2, split it into two and put it into the chimp genome as 2A and 2B.  When an artist creates two pieces of artwork, they may be very similar, and the artist may reuse certain pieces of one in creating the other.  Certainly software 'artists' do this.  I've done this myself many times.  Why write a second program entirely from scratch when you can reuse some code snippets and save yourself some time?  Again, I am not saying here that I can prove this definitely happened.  I am just saying that it is perfectly plausible and exactly what we should expect from a Designer.  Some kind of 'upward evolution' (my definition of upward -- humans at the top, one-celled organisms at the bottom) in fruit flies would be impressive.  I think these experiments try to 'fast forward' evolution.  But all I've ever heard of is dead fruit flies, deformed fruit flies, etc.  Never 'advanced' fruit flies with major increased abilities.

Jeannot said ...  
Quote
Anyway, the percentage of identical substitutions between human and chimp is certainly well above 36%.
I would expect it to be around the same as the general genetic similarity -- 95-97%.  This would be consistent with Design Theory.


Quote
To check that, we should gather several sequences from rodents, primates (and maybe other mammals), if available, and build a maximum likelihood our parsimony phylogeny. The three sequences alone (rat, guinea pig and human) won't do.
Agreed.  Does anyone have a paper comparing human and chimp GLO, for example?  Is it 100% identical?  Or 95-97% as I predict.


Quote
...You know, it's a good thing creationists like Dave drop by from time to time and try to "enlighten" us: It helps us refresh things we had forgotten, learn things we didn't know, have constructive debates (such as this) we'd normally not have, and in the end appreciate science even more.
See ... even ugly, flea-bitten dogs are good for something ... to throw rocks at, kick when your mad, etc. :-)

Faid said ...  
Quote
Did I mention that this is fun?
Well ... at least I am contributing entertainment value to everyone if nothing else ... think of me a side show at the carnival that you didn't have to pay for!


Quote
I wonder why AFDave isn't hear setting you all straight about your convergences and your BLASTs and what have you.
Oh, I was there alright.  I actually read these posts on my Blackberry at church during the boring announcements.  I just have never tried posting from my Blackberry.


Quote
From what I hear, he's busy posting over at his newfound haven at UD right now. But I'm sure he'll be back...
Oh yes.  I'll be back.  I wouldn't call UD a haven.  Those guys all agree with me.  What fun is that?  I just thought I'd better spread the word about that fun quote from TO before someone at TO changes it to sound ... er ... less supportive of Creos.


Quote
And he has a website:
http://airdave.blogspot.com

He gets Warren Buffet quoting Jesus:
http://airdave.blogspot.com/2005....te.html

But he doesn't seem to know that Warren Buffet is an atheist, like Bill Gates and George Soros.
Oh I know he is.  That's irrelevant to me.  I posted this in response to a friend that maintains that you shouldn't be quoting Jesus at work.  My response was "Well, why not?  Warren Buffet does!"

While you are at my blog site, you guys HAVE to try my "Mist, Ghost or Computer Graphics?" link ... but turn your speakers up loud.


Quote
When did the split occur Dave? around the time of pharoah? Oh right you don't think there WAS a split. Interestingly, you sparked a conversation between two people who DO know what they are talking about and got some interesting info.
Of course.  I like it when this happens.  BTW, I did see your questions and I have good answers, but I'm on a particular train of thought and would like to answer them in my own sequence.  Did you read the latest page on my "God Hypo" thread?
------------------
Quote
Dave, no one understand why you want GLO to be 100% identical between human and chimps, since that's precisely what evolution doesn't predict. This pseudogene is not selected, so it can freely accumulate mutations at a high rate.


I just thought this was the whole premise of Dr. Max's argument -- that a mistake was copied identically from the common ancestor to apes and also to humans.

If this is not the case, then he does not have an argument, in my opinion.
-------------------------
He does not have an argument, in my opinion, if the error is not copied 100%.  Remember the copyright case that Dr. Max made an analogy to?

If we are just talking about the same difference as with other genes, then this is just as easily explained by common design as common descent.

Everyone else--I'll look at your points in the morning.
--------------------
OK.  It's time for a review.

Date: 2006/05/22 21:19:10, Link
Author: BWE
I started this thread with 3 items which to me argue powerfully against common descent of apes and humans.  You can go back to the start of the thread and read them fully if you like, but here they are ...

1-Complete Absence of Hominid Civilizations Today
2-Unconvincing Fossil Record
3-Enormous Non-physical Differences Between Apes and Humans

I also mentioned 2 possible implications of common descent which to me are kind of interesting to think about, but have nothing to do with proving or disproving common descent, so I will not bring them up again.

I then brought up the Vitamin C issue which was raised to me by Renier in another thread.  Renier said that he used to be a YEC but the "broken Vitamin C" commonality between apes and humans was the major issue that made him abandon the YEC position.

I read the link that Renier referred me to, "Plagiarized Errors and Molecular Genetics" by Dr. Edward E. Max, MD, PhD at Talk Origins.  I think you all know Dr. Max's argument.  He says that in the same way that plagiarism was proven in the copyright case because an error was duplicated, so also common descent is proven with apes and humans because their genomes contain the same error, namely the broken GULO gene.

I said that Dr. Max is making an unwarranted assumption in saying this for two possible reasons.  And at that time, I did not have enough information to know which was the most probable reason for his unwarranted assumption.  The two possible reasons were (I now put them in the order that I believe most likely) ...

Scenario 1-The GULO gene could have broken independently in apes and in humans.  The Inai article shows that it did indeed break independently in guinea pigs, so why should it not break independently in apes and humans?       OR ..

Scenario 2-The "broken" GULO gene was never a functional GULO gene in either apes or humans.  It always has had some unknown function and still does to this day.  Argystokes called this possibility "pseudo-GLO" and rightly asserted that we should be able to find this gene's homologue throughout the animal kingdom--even in animals that do have a functional GULO gene.

We went through some logic exercises comparing the DNA code to relatively unknown languages, and we went down a small rabbit trail with the AIG article and the whole "humans are more closely related to guinea pigs since they both have broken GULO and 36% similar substitutions" idea that AIG seems to be promoting.  To tell you the truth, I honestly don't even know what AIG is asserting exactly, but to me it has very little bearing (if any) on the main issue that we are discussing.

We ended up yesterday determining that the "broken" GULO gene is not 100% identical between apes and humans and you say that this is not predicted by evolution anyway.  OK fine. I think we agree that there is roughly 95% similarity as is also the case for most other genes compared between apes and humans.

So now we are back to Scenario 1 (I'm not sure anyone has ruled out Scenario 2, mind you ... if anyone has info to rule this out, please say so) and your contention is that 95% similarity of the broken GULO gene is powerful evidence of common descent, right?  

Well I disagree and here is why.

1-We have already seen that the GULO gene "broke" independently in guinea pigs.  Why should it not "break" independently in humans and apes?  I think Common Descent or Common Design can explain this equally well.  It is not deterministic between the two competing views.
2-You give me analogies of houses designed without steps but this is not analogous to the situation we have.  I will explain why, but let me first review the Creationist position.

Again, my Creationist Theory regarding apes and humans is that there was one pair of human "kind" ancestors and one pair of ape "kind" ancestors.  Now I do not have a formal definition of "kind" yet and I admit there may have been a "monkey kind" pair as well, but this is not important for the present discussion.  The general idea of Creationist Theory is that there were a relatively limited number of "kinds" created by God, and that God "programmed" enough genetic information into each separate genome so that each "kind" would be able to adapt to the various environments in which they found themselves as they spread out all over the earth.  Today, of course, we find that monkeys and apes have diversified into many different species and that humans also have diversified greatly.

If Scenario 1 above is confirmed, then it is perfectly logical to assume that the Creator designed apes and humans separately, then mutations later caused the GULO gene to break independently in both.  What is so unbelievable about this?  After all, it is a creationist prediction that organisms will accumulate more and more harmful mutations with each generation.  This has been heartily confirmed with fruit flies with "evolution on fast forward."  Why should it be any different with apes and humans?  The "missing steps on the houses" analogy does not apply because no creationist is proposing that apes or humans were originally designed with a broken GULO gene.  It is also perfectly consistent with Creationist Theory that apes and humans have 95% similarity in their genomes.  After all, why shouldn't they?  They do look about 95% similar in their morphology.  But this supports Common Design just as well as it supports Common Descent.  Sure, apes and humans could have had a common ancestor.  And if they did, we would expect to see 95% similarity, an apparently fused gene, etc.  But we would then have what I consider to be 3 enormous challenges outlined above.

Now I do realize that proposing a Creator is an enormous challenge to the intellect as well.  And I do appreciate your objections to this idea that you have voiced.  I admit that I have absolutely no idea how the Creator designed these creatures.  Does he have a neat "Animal Design Software" package that he has on His computer that he can "drag and drop" different animal parts, then hit "Process" and the computer spits out the genome?  I have no idea and I know it challenges the mind to try to imagine how any Supernatural Being could achieve the designs we see in Nature.  But to me it is an even larger mental challenge to envision how it all comes about by random mutation and natural selection.  The probabilities against evolution of gross morphological changes are staggering.  The experimental evidence is non-existent.  The fruit flies get damaged or killed when we "speed up evolution."  And where did the first single cell organism come from?  I don't think anyone has a clue about that.  The proposals for how the bacterial flagellum and other innovations might have evolved are just as "Alice-in-Wonderland-ish" to me as proposing a Creator.  I have read them.  They are a joke to me. The fossil record is extremely weak.  The "evidence" that the earth is millions of years old is based on unwarranted assumptions which I will show.  The typological perception of nature shown by Denton to exist at the molecular level is powerful confirmation of the Creationist model, not the common descent model (in spite of Talk Origins lame attempt to discredit it).  It is obvious that a global tectonic and hydraulic catastrophe was responsible for the universal phenomenon of sedimentary, fossiliferous rocks, not uniformitarian processes over millions of years.  More on all of these issues on my other thread.

But just because I have no idea how the Creator might have designed these creatures does not mean that He did not.  And I admit that I am not going to be able to "prove" to you that He did with the "Scientific Method" as you understand it. This is an extremely important point.  Scientists today do not admit certain kinds of evidence into the arena and I (and Meyer, et al) believe this is an enormous mistake.  To explain this simply, what you are really saying when you say that a "God Hypothesis" is unscientific, is that you rule out the "ET Hypothesis" that maybe an advanced civilization "planted" life here, and you rule out any possibility of any kind of Intelligence that could have been responsible for life here on earth.  This to me is ultra-naive.  Why are we so proud as to think there could be no advanced civilization that is far advanced in their technology so that they would be able to sit down at their computers and design 1000 or so distinct, original "kinds" and "plant them" here on earth?  Maybe we are one big "science experiment" to them. Or maybe it's not a civilization at all. Maybe its ONE SUPER-MIND, like God, for example.  To me, it is utter folly to rule out these possibilities.  And to really explore these issues, we need a broader definition of science than your definitions.  Falsifiability and some of the other demarcation criteria proposed last century must be dispensed with.  We need a robust science that admits all possibilities.  Quackery should not be defined and dictated by a ruling elite of naturalistic scientists.  We should allow quackery to take its course and wind up on the rubbish heap of junk science all by itself through action of the free market of ideas.  Allow astrology into the arena.  It will die a quick death on its own.  Allow Scientology and "Christian Scientists" into the arena.  They will die as well.  Allow homeopathy and acupuncture and everything else you can think of into the arena.  Who cares?  They will not gain a majority if they don't have any merit.  The only reason flat earthism and geocentrism gained a majority was because the ruling elite (the Catholic Church) force fed it to the people.  In my opinion, this is why neo-Darwinism has any following at all among the people.  It is basically being force fed by the "ruling elite" of the scientific community, which I think is quite heavily funded by the government.  

Now don't accuse me of thinking there is some kind of conspiracy among scientists.  I don't think that.  I just think there is a powerfully tempting idea out there among scientists called Darwinism, or naturalistic evolution, or whatever you want to call it.  Scientists like it because it requires no Creator and that has a lot of good implications from their perspective.  Younger scientists are taught this theory and want approval from superiors and peers alike.  So naturally they overlook some of the glaring difficulties and explain them away.  And so the cycle goes in academia.  But I do not think there is some hierarchy somewhere that is somehow planning to brainwash everyone with Darwinism.  I just think there is a government funded consensus and the result is that it has a similar effect as the medieval Catholic church did in that the people are force fed some rather strange views of Origins.

Anyway, back to the Vitamin C issue.  Let's get to the bottom line.  

It appears to me that no one here has a convincing argument that favors Common Descent over Common Design to explain the "broken" gene in both apes and humans.  Either one can explain it just as well.

Am I correct?  Or am I missing something?

(Note for Faid:  I know you are trying very hard to get me to see that the AIG people are a bunch of liars, so I'll tell you what I'll do.  I'll agree with you that they are all a bunch of liars and we all know what a liar I am--I've been told this many times here--and I would add that the Talk Origins people are probably liars as well, and probably many of you are also liars, and of course, the President is a liar and all Republicans are liars.  So why don't we just agree that we are ALL a bunch of liars, then we can agree on something and get on with arguing.  What do you think?  :-)


(One more note:  As a side issue, I am interested in hearing continuing dialog about the AIG paper by Woodmorappe and what your analysis is regarding what their argument even is and the various data which may confirm or refute it.  But I am more interested in people presenting actual relevant data to me as opposed to evolutionary analysis of that data.)

(And remember ... I WILL become an evolutionist if the evidence is convincing enough to me.)
----------------------------
Quote
If you went to church and saw half a dozen kids sitting together, and all had HUGE noses (way bigger than anyone else there, except for one of the adults sitting with them), you could conclude that each kid had a separate set of parents, and just happen to all be sitting together.  Or you could bust out Occam's Razor and conclude that they are siblings.  Oh, they also look a lot alike aside from their noses as well.  And there's no such thing as a bignose club.


Kids with big noses and other features that look alike is in an entirely different universe than what we are talking about.

What we are talking about is going to church and seeing some chimps on the same pew as some boys.  The creationist says "Gee, I think they are not related."  The evolutionist says, "Gee, I think they ARE related."

No you go figure who's right.

Russell said ...
Quote
You seem to have missed the entire point of the Max article. Shared ancestry predicts shared errors. That's what you see in the primate gulo gene. A completely different set of errors is seen in the guinea pig gulo gene, indicating a separate origin. Got that? Common ancestry predicts the same errors in humans and the other primates; a separate set in guinea pigs. If the errors occurred independently in guinea pigs, chimps, monkeys, and humans, you would expect the errors to be similarly diverse in all of them.


Shared ancestry predicts shared errors ... no problem.  I agree.  But Creationism predicts the same thing, namely, the Creator made apes and humans as separate kinds with functional GULO, then both might lose function through mutational degeneration.  Big deal.  This is what creationists expect.  I would expect other species to lose the function in years to come also.  What do we find in apes and humans?  Voila!  95% similar broken GULO!  No surprise there.  Even if it is the same substitution (or deletion or whatever) in apes and humans, so what?  Humans and Guinea Pigs have 36%  (High percentage to use Inai's words) identical substitutions.  Why shouldn't apes and humans also have an even higher % of identical substitutions?

Dr. Max does not even say the error itself is identical.  He just says both apes and humans have broken GLO.  But even if there were some "identicalness" this proves nothing for evolutionists.

Also note the bold print in Dr. Max's article where he makes the goofy assertion that Creationists believe that humans and guinea pigs were designed to function without GLO.

Baloney.

I just got through telling you what THIS creationist believes--they were both designed with functional GLO (if Scenario 1 is true), but then it broke.

Russell-- you have proven nothing.  

From Dr. Max's article ...


Quote
Guinea pigs and primates, including humans, get sick unless they consume ascorbic acid in their diet. For humans and guinea pigs, ascorbic acid is thus a vitamin (vitamin C), while most other species can synthesize their own ascorbic acid and thus do not require this molecule in their diet. The reason humans and guinea pigs cannot manufacture their own ascorbic acid is that they lack a functional gene encoding the enzyme protein known as L-gulono-gamma-lactone oxidase (GLO), which is required for synthesizing ascorbic acid. In most mammals functional GLO genes are present, inherited - according to the evolutionary hypothesis - from a functional GLO gene in a common ancestor of mammals. According to this view, GLO gene copies in the human and guinea pig lineages were inactivated by mutations. Presumably this occurred separately in guinea pig and primate ancestors whose natural diets were so rich in ascorbic acid that the absence of GLO enzyme activity was not a disadvantage--it did not cause selective pressure against the defective gene.

Molecular geneticists who examine DNA sequences from an evolutionary perspective know that large gene deletions are rare, so scientists expected that non-functional mutant GLO gene copies--known as "pseudogenes"--might still be present in primates and guinea pigs as relics of the functional ancestral gene. In contrast, Creationists believe that humans and guinea pigs were each created independently of all other species and must have been "designed" to function without GLO. If this were true, these two species would not be expected to carry a defective copy of the GLO gene. In fact, GLO pseudogenes have been detected in both guinea pigs and humans (Nishikimi et al. J Biol Chem 267: 21967, 1992; Nishikimi et al. J Biol Chem 269:13685, 1994), consistent with the evolutionary view; presumably, related pseudogenes also exist in non-human primates that require dietary vitamin C. The kinds of mutations found in the human and guinea pig pseudogenes are typical of the ones seen in genetic diseases like those mentioned earlier. In this essay I call the human and guinea pig GLO DNA sequences "unitary pseudogenes" to distinguish them from two other kinds of pseudogene occurring in a species that also possesses a functional copy of the same gene (see below). Readers should note that the term "unitary pseudogene" is used here for convenience; there is no standard nomenclature to describe this rare type of pseudogene.
------------------------------
I said ...

Dr. Max does not even say the error itself is identical.  He just says both apes and humans have broken GLO.  But even if there were some "identicalness" this proves nothing for evolutionists.

And I add that ...

the reason this "identicalness" proves nothing for evolutionists is because of the 36% "identicalness" with guniea pigs!  Are you going to tell me that Guinea pigs and humans are related?  I hope not.
-------------------------------
Quote
*It could be just me, but I'm pretty sure that earlier in the thread (i.e., before you shifted gears) you argued that they WERE designed that way for an unknown function.  Is my memory faulty, Dave?

No.  Your memory is not faulty.  I think the 2 scenarios I mentioned early today are possibilities.  You have not given me enough information to decide which one is correct.  All you have given me is that ape and human "broken" GULO is about 95% similar.  No one has confirmed for me if this "broken" GULO gene also occurs throughout the animal kingdom and may have some unknown function, as Argystokes suggested.
----------------------------------

Date: 2006/05/22 21:21:59, Link
Author: BWE
Posts: 223
Joined: April 2006

Posted: May 16 2006,21:53  
Keep trying to insult me, Aftershave.  It might work yet if you just keep it up long enough!  I like the new angle of insult ... very innovative.  Maybe you could insult my wife next.

You go right ahead and send your kids after those "competitive jobs" so they can spend their life working for someone else.  Mine already have their own business like their dad ... maybe my kids will hire some of your kids if they are smart and work real hard.  

:-)
-----------------------------
Where to start?  Probably the best place would be to float a reminder to you about "The Big Picture of This Thread" and "Your Role" vs. "My Role" and how this little discussion of GULO fits into the big picture.

(1)  One reason I am here at PT is to see if there really is anything substantive to evolutionary arguments.  Seems like a good place to find out would be a forum where evolutionary scientists hang out.
(2)  Notice that on this thread, it is not my primary goal to prove to you something positive about the Creationist view of Apes and Humans.  It is to see if YOU have some positive, convincing proof that would make me rethink my position that Apes and Humans are separately created kinds.
(3)  Someone has pointed out that I just want everyone else to run around chasing data and I myself don't want to do any "real scientific work."  Well, in this case, YES.  The burden is upon you to try to convince me.  I have always felt sorry for evolutionists in a way, because I have always thought it would be a huge undertaking to try to defend many aspects of it, and so many arguments have crashed and burned in the past when new information is known.  I'm finding this to be true with Ape/Human issues in general and with the GULO issue in particular.  Sorry if this observation frustrates you, but it's an honest observation.
(4)  Someone has correctly observed that I am an apologist for YEC.  I'm glad someone has figured this out because it is true.  I have said many times that I don't want to become a specialized scientist in a particular field--we have many of those already.  But I am being honest when I say that I would abandon the YEC position if given some convincing evidence for NOT being a YEC.  It's just that no one has yet.

Now that we have that "role review" under our belts, let's dive in.

Just so Faid is not insulted that I never look at his links, I'll post something from one of his links ...

Quote
B-1: The GULO Gene as an Example of Shared Deletions:
Given below is the alignment for the same part of the GULO gene that we examined in lesson A on Vitamin C,
along with the corresponding sequences from 3 primate species that are incapable of synthesizing Vitamin C, the
chimpanzee, the orangutan, and the crab-eating macaque.
Human TACCTGGTGGGGGTACGCTTCACCTGGAG-GATGACATCCTACTGAGCCCC
Chimpanzee TACCTGGTGGGGCTACGCTTCACCTGGAG-GATGACATCCTACTGAGCCCC
Orangutan TACCCGGTGGGGGTGCGCTTCACCCAGAG-GATGACGTCCTACTGAGCCCC
Macaque TAACCGGTGGGGGTGCGCTTCACCCAAGG-GATGACATCATACTGAGCCCC
Rat TACCCCGTAGAGGTGCGCTTCACCCGAGGCGATGACATTCTGCTGAGCCCC
Link to article


Oh, by the way ... maybe I should have clarified this earlier ... YECs have no problem with the idea of Apes and Monkeys having a common ancestor.  We actually agree that they did.  I think Noah took a pair of genetically rich "ape/monkeys" on the ark and these diversified into the many varieties we see today.

So the only thing I care about here is the Ape-Human thing ... the supposed shared ancestry.  

Now let's analyze this.   As I have found in so many areas, you make many assumptions:

1)  You assume that the ONLY reason human and ape GULO does not work is because of this single deletion.  Am I correct?
2)  You are assuming that pseudo-GULO is in fact "broken GULO".  Argystokes has not yet demonstrated that to me.  To me it is a possibility that "pseudo-GULO" has some as yet undiscovered function.  Remember the good old "vestigial" organs that turned out to have function after all?  Why wouldn't "vestigial" GULO turn out the same way?
3)  You are assuming that this "deletion" is in fact a deletion.  The word deletion implies that it was there at one time in history and now is not due to a mutation.  I think you base your idea that it is a deletion by comparing it to rat GULO.  A tempting comparison and I do see your logic, but how is this conclusive?  An interesting experiment in this regard would be to delete the "C" in question in the rat GULO, then see if rat Vitamin C production ceases.  Has this been done?  Is it even possible?  How about inserting a "C" into some ape GULO, then seeing if Vitamin C production commences?  I did read the Rat/GP/Trout experiment and it is interesting, but does this prove that the "C deletion" is definitely the cause of non-functionality?  
4)  You assume that this "C deletion" occurring independently in apes and humans is a highly unlikely event.  Why is it so unlikely?  After all, there are many identical substitutions in an unrelated ... er ... *cough* ... distantly related (yes, yes, I forgot my head yesterday for a moment ... it is still a challenge for me to remember that you all think ALL organisms are related through common ancestry), i.e. our furry friend, the guinea pig.



Quote
Dave, this is the part you're not getting: Creationism predicts everything. Creationism is an ad hoc hypothesis that can always fall back on the proposition that the Creator could always have done something in a particular way, and given we know almost nothing about the Creator, we cannot make assumptions about why it would do something.

Now, Dave. Tell me something you could in principle find in the natural world that Creationism would not predict. Can you do it?


Creationism does NOT predict everything.  Here are 5 things it does not predict. (but evolution does predict and has been proven wrong)

1) "Upward evolution" ... it predicts "downward"
2) "Seamless fossil record" ... it predicts ubiquitous gaps
3) "Hominid civilizations" (or half-human to make Norm happy on terminology) ... it predicts fully human civilizations and fully ape "civilizations."
4) "Millions of years coal production" ... it predicts rapid coal formation
5) "An infinite universe" ... it predicts a finite universe that had a beginning

How far do you want me to go on?  I could keep going a long time, but you get the idea.  So you are incorrect.  Creationism does not predict everything.  

Evolution, on the other hand is almost "God-like" (actually fairy-talish) in its supposed explanatory power.  If a guy like Michael Behe comes at you with an irreducibly complex biological system like the flagellum, the "Evo Fairy Tale Machine" goes into high gear cranking out stacks of "just so" stories about how you all wish it might have happened.  None of this can be tested experimentally, of course, and no one has ever observed such an innovation happening in nature, and we all know what happens to fruit flies when you "speed up" evolution, but who cares about all of that.  On they go creating large volumes of "scholarly articles" which in reality are nothing more than "Alice-in-Wonderland" tales without the "fun story appeal."  Have you ever waded through one of those "How a Flagellum Evolved" technical papers?  I don't blame you if you haven't.  You would no doubt have headache afterwards if you did.



Quote
Also, as a side note, does Creationism make any predictions as to the number of "kinds" there are out there? Or does Creationism even have an estimate of the number of "kinds"? Because evolution does. It has a nice little diagram of the organizational structure of life on earth. Does Creationism have its own diagram, or does it just plagiarize the one created by real scientists?

I think they do somewhere.  I can find out pretty easily from AIG or ICR or someplace.  I just threw out that 1000 number.  I have no idea what a good number might be.  The actual number was not important to my argument yesterday, so I just picked one out of the air.



Quote
Seriously Dave, you are trying to do rocket science when you don't have basic physics down. Before any of this works, you need to understand why scientists believe that the earth is around 4 1/2 billion years old.
Yes.  The magic potion of evolution ... millions and billions of years.  I hate to be so unkind as to tell you that you might need to pay attention, but if you read this thread, millions of years doesn't have anything to do with the questions I have raised on this thread.


Quote
If you still refuse to address them, I'll have no choice but to infer that:
a) either you're in some OCD state, where you think that checking the link is like "giving in to temptation", expressing doubt in the eyes of you-know-who, or
b) You have already checked the links, but don't want to address them- and that is dishonesty.
Whew! I cut and pasted Faid's quotes.  Now he won't think I'm in an OCD state!


Quote
Mine says that you will not find a functional GULO region in this primate.  Yours has no reason to predict this.  Note that despite argystoke's interesting proposed experiment, we have no reason to expect the converse.  That is, we might well expect to find additional broken GULO regions in rats and other animals that still have functioning GULO and can synthesize vitamin C.  This would indicate duplication (similar to that found in hemoglobin genes and many others).  It would not indicate some vital and as-yet unknown function of the pseudo-GULO.  So, while it's an interesting idea, it wouldn't provide any magic bullet to decide between your "scenarios".  I notice that you didn't have enough understanding of the question to realize this.

Mine says that if we spliced a rat or mouse GULO gene into the primate's liver cells (as we have done for humans), it would be able to synthesize vitamin C.  Yours has no reason to predict this.  Mine says we couldn't do the same for a fish.  Yours?

Mine says that this pseudogene is likely the result of a retrovirus, and that the mutation occurred about 40 million years ago, in the shared ancestors of that primate and us.  Yours?

What does your "theory" predict for our newfound primate, Dave?

Or let's leave the hypothetical primate.  Let's look at a hamster, Dave.  What does your "theory" predict for hamster GULO?  Is a hamster part of the guinea pig kind?  The rat kind?  Its own kind?  Does it matter?  Can you -- without peeking at those hocus-pocus evolutionary phylogenies tracing ancestry -- predict anything about hamster GULO and vitamin C production?  Can you test your predictions on your own?

Who doesn't know the language here, Dave?
You are the biology expert.  I am the apologist.  Remember the role discussion above?  By the way, I am very impressed with some of the technical knowledge displayed here.  I don't want to trivialize that.  I am just pointing out some items which appear to be logical fallacies to me.

OK.  Over to you ...
-------------------------------
Quote
OA asks AFDave for the fourth time

New thread, my friend, new thread.  This one is about "Ape Questions" as you might find out by scientifically analyzing the title.

Go start a new one if Wesley will let you and I'll see if I can find time to come over and visit ...

Cheers!

(I did enjoy "Top Gun" ... glad to see you did too!;)
-------------------------
Quote
Tell us Dave, what incentive would anyone have in doing hours and hours of research and writing just so a disingenuous knucklehead like you can reject the data with a few flip sentences?

Dunno.  A lot have done it so far though.  Why would they not continue?  Maybe they have an insane fascination with 'brain damage' ??

(As someone here put forward)
---------------------------------
Or maybe it's the 'sharpening knives on dull stones' idea.

Who knows!
-------------------------------

OK THIS IS MY PROJECT SO I JUST WANT TO POINT OUT WHERE THIS COMMENT IS IN SEQUENCE :) :)

BWE

Posted: May 17 2006,10:36  
Well well well. The time has come.

Dave, you are an idiot. Your vacant mind is incapable of synthesizing information into understanding.

I sincerely hope that your children do not end up as misguided as you. Not for them but for me.

Your head is crammed securely up your ass and you have nothing valuable to say. Your god is a pathetic little provincial bigman who can't even say boo to my god because my god is so much stronger and braver than your god. And my god makes better things than your god.

Also, I can run faster, jump higher and screw better than you can.

Your friends don't really like you; they are just pretending.

:)

Wesley, your other thread was precient in that you don't really want to have a poster who is simply an object of ridicule. Is this correct?
----------------------------
AF Dave  said ...
Quote
Creationism does NOT predict everything.  Here are 5 things it does not predict. (but evolution does predict and has been proven wrong)

1) "Upward evolution" ... it predicts "downward"
2) "Seamless fossil record" ... it predicts ubiquitous gaps
3) "Hominid civilizations" (or half-human to make Norm happy on terminology) ... it predicts fully human civilizations and fully ape "civilizations."
4) "Millions of years coal production" ... it predicts rapid coal formation
5) "An infinite universe" ... it predicts a finite universe that had a beginning

How far do you want me to go on?  I could keep going a long time, but you get the idea.  So you are incorrect.  Creationism does not predict everything.


qetzal said ...  
Quote
Just in case there are any lurkers out there who think this is persuasive, I'll point out that none of these are predictions of evolution. I will also ask afdave: if we observe any of these things, do you agree that it's evidence against Creationism?


*Ahem* ... sorry ... I should have said these used to be predictions of evolution ...

Until they were disproven ...

Now, of course they are no longer predictions of evolution.


More ape fun tomorrow morning!  See you then!
-------------------------
BWE said ...
Quote
Also, I can run faster, jump higher and screw better than you can.


Eric, Chris, Jeannot, Incorygible, Norm, Qetzal (others also)... I truly admire all of you for your knowledge of your field and your ability to express your thoughts matter-of-factly (even though I disagree with you).  (End serious comment, begin sarcasm) I also wanted to highlite some of the abilities of one of your team members.  These abilities may come in handy in a future debate.  Just kidding.  Don't worry.  I really don't lump you in with anyone else, and my judgment of your character has nothing to do with my judgment of anyone else's ... I just saw a chance for a joke.  I wouldn't want people lumping me in with certain other YECs.  As for BWE, I congratulate you.  I have been insulted a lot of different ways, some creative, some boring.  I have to say that this one takes the cake as the most innovative I have ever heard.  If you tell me your mailing address, I would like to send you a certificate for "Most Creative Insult of All Time."  I will be interested to see if you or anyone else can top this one in the future :-)

Quote
Also, I assume you don't believe that humans once had a tail although you think that the monkape kind either evolved one or lost one.


If it was one original kind, then there would originally have been a tail and it would have been lost over time.  Creationism predicts the loss of function, not gain.  There may, however, have been a separate monkey kind and an ape kind.


Quote
Science itself is evolutionary and a thousand wrong ideas are tested before we hit on ideas that work. So, if there were an ID research program I wouldn't object. What I object to is the fact that they're faking having any  research program and instead spending millions on PR and lawyers and think tanks that  invent ways to lie and distort.
Science is not evolutionary because it is directed by intelligence.  I am glad that you would support an ID Research Program.  ID has to spend millions on PR to even get any research off the ground to see if there is support for this promising theory.  

   
Quote
You're an arrogant SOB, you know that, Dave?  From whence this audacity to dictate OUR roles in educating YOU in the absolute absence of any effort on your part?  See above.
Look, Incorygible.  I'm a businessman with a science/engineeering background and a financial contributor to causes, I'm politically involved, I'm an apologist for YEC, and I'm a little bit like an investigative reporter at the moment.  If you don't want to accept the role of "Evolution Apologist" and jump on the opportunity to make your theory look plausible to an outsider, then don't.  No one is making you.   The ape/human questions and the Creation/Evolution controversy are absolutely to vital to society.  I'm spending 4+ hours a day on this effort. You can't say I'm not putting in any effort.  Now, if you don't like your role, then you don't have to assume it.  On the other hand, if you want to stick around and not get mad, you might have some fun. Others have said they are having fun.  You can too.  By the way, I have encountered scientists who seem very resentful of businessmen in general because they feel that businessmen "use" them for their own purposes.  Do you feel this way?  The truth is that both businessmen and scientists are necessary.  Businessmen need scientists to invent and discover new things.  Scientists need businessmen to market their innovations.   And by the way, apologists and politicians are necessary too.  Your side has a famous apologist in Richard Dawkins.  Why shouldn't our side have some too?

   
Quote
It is a "huge undertaking" to understand volume upon volume, journal upon journal, paper upon paper of published, peer-reviewed science, Dave.  Takes decades of full-time devotion.  In light of that, your observation, your opinion of "burdens", and the roles you have set out are anything but "honest".
Again, scientists do much wonderful work.  Where they go wrong is when they write volume after volume of speculation about how the immune system might have evolved and similar things.  They would be much more productive if they hypothesized that it was designed and studied it from that perspective.

   
Quote
So you recognize the huge undertaking to become knowledgeable in this subject, but think you can have it for free.  I would have suspected you'd have come across the term "no free lunch" in your IDiot meanderings, Dave.  In this case, however, it actually applies.
I understand there is no free lunch.  I was born in poverty and have worked very hard to be where I am now.  No one asked you for a free lunch.  Some of you act as if I am asking you to give me a biology degree for free or something. Again, I am basically a YEC apologist and an investigative reporter asking for a convincing story.  If you don't want to give it, then you don't have to.  If I were in your shoes, though, I would want to try to give a convincing one.

   
Quote
No.  You are looking at one small region of the gene.  The deletion may have broken the gene.  It may not have.  Other mutations could have occurred before, and others since.  We've shown you the exact nature of the mutations that we see now.  We've pointed you in the direction of references where you can find out more.
Exactly.  So Faid was making an assumption when he told me that the deletion in his article is the cause of broken GULO.

AF Dave said ...        
Quote
3)  You are assuming that this "deletion" is in fact a deletion.  The word deletion implies that it was there at one time in history and now is not due to a mutation.  I think you base your idea that it is a deletion by comparing it to rat GULO.  A tempting comparison and I do see your logic, but how is this conclusive?  An interesting experiment in this regard would be to delete the "C" in question in the rat GULO, then see if rat Vitamin C production ceases.  Has this been done?  Is it even possible?  How about inserting a "C" into some ape GULO, then seeing if Vitamin C production commences?  I did read the Rat/GP/Trout experiment and it is interesting, but does this prove that the "C deletion" is definitely the cause of non-functionality?


Incorygible said ...        
Quote
Yes, Dave, it's all been done.  We can easily knock out vitamin C production by breaking rat GULO in any way you desire.  No functioning gene -> no functioning protein -> no vitamin C synthesis.  This is basic.  Look at the medical literature.  That Ha et al. (2004) paper I referenced earlier is titled "Functional rescue of vitamin C synthesis deficiency in human cells using adenoviral-based expression of murine L-gulono-gamma-lactone oxidase" (Genomics 83:483-492).  They took murine (rat/mouse) GULO, spliced it into human liver cells via a virus (we do this all the time, Dave), and those cells began synthesizing Vitamin C.  I've already told you this.


Incorygible, that's not the same thing ... read my quote again.  I asked if anyone has knocked out the "C" in rat GULO at the position indicated in Faid's article which I quoted.  You responded by saying "Yes, we spliced rat GULO into a human and it worked."  Hello?  That wasn't what I asked.  It's not the same thing.

   
Quote
If someone wanted to tell you how wrong you are about how to fly planes, and they didn't even know basic things about lift, stalls, air pressure, and when you tried to explain the basics they just kept telling you how wrong you were, wouldn't you be a little intrigued?
Yes.  But I wouldn't get mad.  I'd just think it was funny.  The fact that people get mad about this stuff is interesting to me.  Why do they?  Oh, I know all the superficial reasons ... I'm thick headed, etc.  But it seems like there must be a more basic reason for the frustration.

   
Quote
And besides, if it's not your goal to present positive evidence about the Creationist view, why did you waste several hundred words on your "Creator God Hypothesis" (which, let the record show, you have not yet supported with any positive evidence)? If you weren't going to support it, why did you even bring it up, and waste our time waiting under the misapprehension that you were going to try to support it?
Absolutely.  On that thread, not this one.  This thread is all about "Ape Questions" and seeing what your answers are to those questions.  I have given excellent positive evidence on my other thread for the existence of God, and will over time give much evidence for all the things I said I would.  I know some don't accept my evidence so far, but I cannot help that. All I can do is give it.

   
Quote
Dave, you're simply not equipped to evaluate the evidence in favor of evolution. That's been pointed out to you innumerable times. No one here is under the slightest obligation to educate you on that evidence.
I agree with you.  I am not equipped.  This is why I am giving evolutionary biologists the chance to speak for themselves and explain why their theory is plausible.  If they cannot do this, who can?  I understand that no one is under any obligations here.  There are certain roles, though, and I can tell you that I am certainly not going to assume the role of 'Evolution Apologist.'  So that leaves the job to either you guys or else no one at all. I think people here rightly want to try to answer these questions as best they can because they truly believe in their theory.  And it is important to them for others to understand and agree with this theory.  We all want people to agree with out theories.

   
Quote
Explain to me why "downward evolution" is predicted by Creationism. How does this follow from the idea that God created everything? Is his creation so defective that everything eventually breaks down and collapses?
It is predicted in Genesis and is known as the "Curse."  Yes.  Everything in this world has been cursed because of sin, and God will RE-create the world at some point in the future.  Of course, I cannot prove this last piece to you scientifically, but I can show you that the Bible is both reliable and supernaturally originated.  Then it is but a small step of faith to believe the unverifiable stuff.

   
Quote
2) To talk about a "seamless fossil record" versus ubiquitous gaps is a demonstration of  your ignorance of what the fossil record is. Fossils happen rarely and not all fossils have been found. What you don't believe in here is  called a "transitional fossil."
OK.  Fair enough.  Let's use your term.  Evolution predicted many transitional fossils and now that the evidence is coming in, there have been only a handful of equivocal ones.

   
Quote
The convergence for this deletion may not be unlikely, but primates share dozen mutations. And these mistakes in the broken GULO produce the same phylogeny built with other working genes. This cannot have happened by chance. Would you drop this argument?
Why would I drop the argument if you agree with me that the deletion is not unlikely?

   
Quote
And what does "upward evolution mean"?
The evidence shows that there is no such thing, but Evolutionists wish there were.  To me it means addition of wings where there were no wings before, addition of eyes where there were no eyes before, etc.  The reverse happens a lot, however.  Organisms lose function quite often and Creationists predict that this will continue until the time that the Creator RE-creates all things.

   
Quote
Even so, bacteria have developed the ability to digest nylon. They didn't have that ability in the past. It's new. We can identify the pre-existing genes that were co-opted to achieve this. Isn't this "upward" evolution by your definition? Does it disprove Creationism?
I do know there are a few mutations that could be construed as "upward" or "increased or new function."  Do you know of many like this?  To disprove Creationism, it would take a multitude of  mutations like this.  And by multitude, I mean thousands or even millions.

   
Quote
Your "ubiquitous gaps" are gradually disappearing. Isn't that evidence against Creationism?
To say that the gaps are disappearing is sort of like saying that you are well on your way to emptying Lake Superior because you have removed 10 buckets full of water.

   
Quote
Let's simplify. Is there any conceivable objective observation (or combination thereof) that could disprove Creationism? If so, please explain.
Yes.  There are many possible ways to disprove Creationism, and evolutionists have been hoping for years that just such evidences would come to light as more is known.  They just haven't yet.  The opposite is actually happening.

   
Quote
But how much has the Bible changed to reflect more recent observation, Dave? Has it changed much in the last thousand years? Science gets better all the time. Religion stays the same, getting left further and further behind every year.
It hasn't changed, unless you are talking about the equivocal "Apocrypha."  Or maybe you are referring to modern Bible translations?  Translations are not changes.  The translators typically work from the original Greek and Hebrew to make their translations.  I don't know about religion.  I'm not a religionist.  I'm interested in truthful science of which the Bible and a God Hypothesis are a legitimate part.

Renier said ...        
Quote
Afdave is showing off his amazing faith. Since I feel that he just waisted our time, asking to be educated and then revealing he is just here to preach, I feel we need to test Dave on the claim that he is indeed a Christian and not just someone who is fooling us.  Chimps and Humans -- This is interesting. Now the fundies are REALLY going to fume.


Renier, my friend, you're back!  You were the one (I think) that gave me the idea to start this thread.  Wasn't it you that said you used to be a YEC, but abandoned the position because of the Vitamin C issue?  Well, as I hope you have seen, there are many assumptions here and I think you were too quick to abandon your position.  I read your new article about Chimps and Humans, but it does not look as interesting as the Vitamin C issue.

***************************************************************

So there you have it.  We're on page 16 of this thread, and there has been some very good discussion.  After all of this, of the two possible scenarios that I mentioned ...
   
Quote
Scenario 1-The GULO gene could have broken independently in apes and in humans. The Inai article shows that it did indeed break independently in guinea pigs, so why should it not break independently in apes and humans?       OR ..

Scenario 2-The "broken" GULO gene was never a functional GULO gene in either apes or humans.  It always has had some unknown function and still does to this day.  Argystokes called this possibility "pseudo-GLO" and rightly asserted that we should be able to find this gene's homologue throughout the animal kingdom--even in animals that do have a functional GULO gene.

it seems that Scenario 1 is the most likely, although who knows what will turn up as more is known about "pseudo-genes."

I have confirmed my suspicion that Dr. Max's assumptions are not necessarily warranted, although I would not go so far as to say they are wild assumptions.

It is clear to me that the theory that apes and humans had a common ancestor, while it has some apparent support, is by no means a closed case, and there is plenty of evidence supporting Common Design Theory as well.  I don't think we can 'prove' either one of them.  And if I were in Renier's shoes, I certainly would not have abandoned the YEC position because of this issue.

So, as you probably expected would happen, my position remains that Apes are Apes, and Humans are Humans, and as far as anyone really knows for sure, it's always been that way.

Thanks for your participation!  I have nothing further to add on this thread.  If anyone wants to keep going, by all means, go ahead.  But I have completed what I set out to do.

I will now spend all my time presenting evidence for a Creator God, a Young Earth, the Global Flood, the accuracy of the Bible, etc. etc. on my other thread.

Thanks again.

AF Dave.
----------------------------------
Quote
How is PR a requirement for starting research?
PR raises money for doing research.

Quote
afdave, please point me to the post in which I claimed that that particular C deletion was the cause for the loss of the gene's function.

Otherwise, please retract your claim and all assumptions derived from it.

You probably told me five times to go look at your link which supposedly proves Dr. Max's assertions.  I did so, as you asked me to.  What else am I to conclude from that article?

If you really don't believe what I thought you believe, fine.  I'll retract my statement.
--------------------------------
Aftershave said ...
Quote
I'll just note that the sum total of AFDave's scientific knowledge and integrity would comfortably fit inside a thimble, with plenty of room left for his genitalia.


BWE's was funnier. He's still in first place.  But keep trying.  You might pull off a good one yet.
------------------------------------
Quote
letting your personal and petty anger through

I was? Hello??  McFly?  

Toejam-- Could you use some of that straight talkin' of yours and tell Mrs. Rilke what planet we're on ...
-----------------------------
Incorygible said ...  
Quote
Again, Dave, why do you think you know where scientists go wrong?  You've admitted you're not on their level in their respective fields.
I admit that I am not on their level, but there is a relatively small but rapidly growing group of scientists who are disillusioned with Darwinism ... Michael Denton, Michael Behe, Dr. John Baumgardner of Los Alamos to name just a few.  When top notch people like this stand up and say there's a problem, I at least investigate.  Now why is that so unreasonable?

Quote
After all, the current crop of scientists aren't doing anything worthwhile, and you seem to know how to correct that, given your science/engineering/religious background.  Why not cure cancer with your "design perspective"? As a politically active businessman who wishes to contribute to humanity and help the YEC cause, would there be anything better?
I have never said the current crop of scientists aren't doing anything worthwhile ... nothing of the sort.  I have consistently said they are doing many great things and I reap the benefits.  But their thinking on origins is highly questionable and the answer to this question has major implications on society.  And I agree that trying to cure cancer from a "design perspective" would be a very worthy goal.

Quote
I got interested in this whole affair (I used to not care, just do what I did and let other people believe whatever they wanted) when a YEC (in similar shoes to yours?) sent me a scary fire-and-brimstone e-mail because may name appeared on a university website for teaching a course in evolution.  
I know that some people who wear the YEC label do irresponsible things like this ... I am sorry for that, but I cannot stop them.  I can only do what I do and I for one do not say that you are 'evil' or that you should even quit teaching your views on evolution.  Go ahead and teach them.  Just don't shut out other views.  Honesty would dictate that your view is just that--a view.  The origin of life is not a thing you can 'prove.'  So just admit that and let others express their views as well.  That's all.

Quote
Faid has already responded to this and where the misunderstanding lies.  And even if he hadn't, I am sorry that I assumed you were asking a question that had some actual over-arching relevance to the discussion.  I assumed you had learned enough by now to realize that "the missing C" was not the deletion we have been talking about (not even close). But yes, I assumed to much, with the proverbial consequences -- you just wanted to go down yet another rabit hole leading to a meaningless detail and pedagogical semantics.
I was not intentionally leading you down a rabbit hole.  I was trying to summarize your collective position, then point out my view that it is inconclusive to me.

Quote
And I think you (of all people), might be a little offended by being accused of being in league with the devil and on a fast-track to ####.
Again, please don't get mad at me for the actions of others, and I will treat you with the same respect.

Quote
I don't care what they "believe", either.  Affirmation and consensus with the norm is not a high priority for me.  Did I not mention I'm in science?  We THRIVE on DISagreement, Dave.
OK.  Then you should be thriving.

Quote
"The convergence for this deletion may not be unlikely, but primates share dozen mutations. And these mistakes in the broken GULO produce the same phylogeny built with other working genes. This cannot have happened by chance. Would you drop this argument?"
Why would I drop the argument if you agree with me that the deletion is not unlikely?

Honestly, do you even read, Dave?  This reply, with the actual quote right above it, proves beyond a shadow of a doubt that you are illiterate, dumb as a brick, and/or disingenuous.
She says the convergence may not be unlikely.  She says that primates share dozen mutations.  And these mistakes in the broken GULO produce the same phylogeny built with other working genes. This cannot have happened by chance.  

I don't understand the second sentence, but why is it so unusual to share "dozen mutations"?  Guinea pigs and humans share a lot of mutations too, right?
--------------------------------
Quote
You do know that you are desicively swaying those of us on the fence away from your brand of creationism?
You are on the fence?  Excellent!  There's hope!
------------------------------------
have not had time to analyze Incorygible's latest response, but I will and then get back to you.

In the mean time, there is a good lesson on my "Prove Evolution to AF Dave" thread on the Bible's admonition that "Pride goeth before a fall."

It was nice knowing you Rilke ...
------------------------------------------
Eric said ...  
Quote
Dave, I really think you need to read, and understand (that means read it slowly and carefully and make sure you understand each paragraph before you go onto the next one) Douglas Theobald's superb article at Talk Origins setting forth the mountain of evidence supporting common descent with modification. If you honestly read and understand that one article, you will understand that common descent with modification is not an hypothesis in need of evidence; it's a fact in need of explanation.

Eric ... you seem to misunderstand the Creationist position (it's OK, sometimes I misunderstand your position as well) ... I actually have no problem at all with "Common Descent with Modification" and I have said so here several times.  You are correct that there are mountains of evidence that there was just one original "Ape kind" and one original "Dog kind" and one original "Cat kind" and one original "Human kind" and so on.  And it is quite true that all the hundreds of variations within these kinds we see today are the result of Common Descent with Modification--modification meaning random mutation and controlled random mixing during reproduction.  No argument there at all.  I understand Natural Selection quite well (and artificial selection too) and agree that it is a proven fact.  It is also a Creationist prediction.  Where we differ is in the evolutionist idea that everything shares one common ancestor, with my most interest in this regard being on the Ape/Human question.  We also disagree that random mutation and natural selection can produce anything like an eye where there was no eye before, or a flagellum, or what have you.  No one has been successful in showing how new features like this could have evolved by random mutation.  In almost all cases, random mutation makes things worse or neutral.  And in the few cases that they make things "better", it's not because a flagellum was added or an eye was added.  The changes are extremely minor changes.  This is because the information content required to make something as complex as a flagellum is so large (greater than 500 bits), that chance is ruled out.  And nothing simpler can be formed as a precursor, because it only would get selected for if it is complete and working.

AFD said ...  
Quote
She says the convergence may not be unlikely.  She says that primates share dozen mutations.  And these mistakes in the broken GULO produce the same phylogeny built with other working genes. This cannot have happened by chance.  

I don't understand the second sentence, but why is it so unusual to share "dozen mutations"?  Guinea pigs and humans share a lot of mutations too, right?

Oops ... sorry, Incorygyble (or Jeannot) ... I meant to say THIRD sentence, not second.  

What is Jeannot referring to when she says "And these mistakes in the broken GULO produce the same phylogeny built with other working genes. This cannot have happened by chance." ??  Is she switching back to apes and humans, or is she still talking about humans vs. guinea pigs?
-----------------------------------

Quote
Doesn't it puzzle you in the slightest that everybody here keeps asking you to provide evidence for your position, when I'm sure it seems obvious to you that you already have?


Uh ... no, it doesn't puzzle me.  I did enough reading about the mindset of evolutionists before coming here that I was well prepared for what I would encounter.

Quote
We also disagree that random mutation and natural selection can produce anything like an eye where there was no eye before, or a flagellum, or what have you.  No one has been successful in showing how new features like this could have evolved by random mutation.

Dave, it's been shown dozens of times. In many cases we know exactly which mutations in exactly which locations resulted in exactly which changes.

Yes, of course ... you're talking about those wonderful 'Alice in Wonderland' descriptions of how the immune system evolved and such.  Have you ever read those?  If you did, you would see they are complete and total speculation of the highest order.

Quote
The changes are extremely minor changes.  This is because the information content required to make something as complex as a flagellum is so large (greater than 500 bits), that chance is ruled out.  And nothing simpler can be formed as a precursor, because it only would get selected for if it is complete and working.

Dave, if you'd even the most cursory reading anywhere other than at AiG, you'd see that this argument (irreducible complexity) has been completely blown out of the water.
Yes, I've read all those articles that 'blow the arguments out of the water' at T.O.  They are quite lame.  

The most credible sounding one I've read yet is Dr. Max's article which is being discussed on this thread, but as it turns out, after much debating all around the mulberry bush, we are finally back to the following statement by Jeannot which proves my point and destroys Dr. Max's argument completely.  I'm going to put this in lights so that no one will miss it.

******************************************************************

Jeannot said ...
Quote
For the last time, you can't consider the loss of function alone as a valid evidence for common descent, because hundreds of mutations can break a gene.
</b>

******************************************************************

One more time for emphasis ...

[b]For the last time, you can't consider the loss of function alone as a valid evidence for common descent, because hundreds of mutations can break a gene.

Remember, this whole thing started because Renier said ... "I used to be a YEC, but the broken Vitamin C gene in primates caused me to abandon the YEC position."

OK.  What did Dr. Max say?  He said that an error in the GULO gene was copied from  the common ancestor of apes and humans to both humans and apes.  He compared this to a copyright case and said that this basically proves common descent of apes and humans.

Now Jeannot just said that "you can't consider the loss of function alone as a valid evidence for common descent, because hundreds of mutations can break a gene," telling me that neither Dr. Max nor anyone else knows which mutation broke the gene in humans or which mutation broke the gene in apes.  Dr. Max was saying that his argument was that the 'error was identical,' but his argument was really just that 'apes and humans both have broken GULO.'  OK.  So they both have broken GULO.  Big deal.  It could have broken independently, just as it did in guinea pigs.  What does this have to do with Dr. Max's copyright case?  Absolutely nothing.  And you cannot consider the loss of function alone as a valid evidence for common descent anyway, according to Jeannot.

So we see that whereas Faid complains all the time about AIG lying, the truth of the matter is that it is Talk Origins that is lying.  You guys have been taken in by many slick arguments ...

I have a cure for you ... www.dissentfromdarwin.org ... hundreds of good scientists are jumping ship ... you can too!
------------------------
Quote
Step by step, in good argument format, please support this statement of yours. [that T.O. is lying]
I will be quite happy to do so the moment that Faid and others give me their step by step argument that AIG is lying, because they made their assertion first.  On the other hand, if they feel this is too much trouble, if they will retract their statement, I will also retract mine.

In any case, I have a feeling that you will continue to use T.O. despite what I say about it, and I feel sure I will keep using AIG despite what you say ... so what does it really matter?

Quote
Man, how many times have we explained this?
You've explained the 'apes and humans are similar' argument many times, and I have also many times argued that 'apes and humans are similar' argues just as easily for Common Design as it does for Common Descent.  'Apes and Humans are similar' is all well and good, but it is not deterministic between the two views.

Renier, if you stick with me long enough, I will be systematically dismantling all the basic underpinnings of evolution and establishing the credibility of the YEC position.  

I have dismantled Dr. Max's argument, and I will continue to dismantle many more.

Young Earth Creationism is the only view which not only is consistent with all the evidence from many disciplines, but also the only view which answers mankind's biggest questions in life.

My hope for you and for all the good people here is that you will come to a knowledge of the truth ... and that it will transform your life as it has mine.
----------------------------------
Quote
And, I predict, for the (n+1)th time, he will not get around to giving us that "easy" explanation.

OK, Russell, for the (n+1)th time ... 95% similarity between apes and humans supports common design in the same way as it does in house building or car building, for example.  A Ford Aerostar is 95% (?) similiar to a Ford Fiesta (do they still make those?) and this is because they have a common designer.  You see?  Again, this is not rocket science and does not require a PhD (or even a biology degree).

Quote
Serious question Dave,
Did you actually retire from the Air Force or did you resign your commission sooner than that?
Went on reserve status when I got out in 1996, then resigned my commission this year.

Quote
"This is a revolution dammit, we're going to have to offend somebody!"-John Adams

A great example of a great Christian "tough guy" !!

*****************************************

You guys just can't get used to the fact that you lost the Portuguese thing, can you ...

Quote
I haven't read Dr Max's argument but if you think you have refuted the claim that the GULO gene does not support common descent you are sadly mistaken.
You haven't even read the article and yet you disagree with me when I say I have refuted it?

Whoa!   ... well, I was warned about this kind of stuff ...

Quote
why it's not which mutation broke the gene, but the remarkable simillarities in the accumulated mutations in the broken part between humans and primates that matter-
You guys cannot get your story straight.  You say it's the similarities in the broken part, Jeannot says "you can't consider the loss of function alone as a valid evidence for common descent, because hundreds of mutations can break a gene."

Come on guys. Face it.  Apes and humans have some striking similarities, I agree.  Apes and humans both have what appears to be a broken GULO gene.  So what?  This does not prove Common Descent.

Quote
I'll give you this: I'll say that this guy is either a liar, or a total ignoramus in genetics and, at the same time, an arrogant jerk who thinks he can argue about something he knows absolutely nothing about by simply pulling "arguments" out of his ####. Take your pick.
Great.  And I'll back off my "liar" claim for the T.O folks.  I will content myself to think they are just ignorant.
-------------------------
Quote
I think it's gotten to the point where Dave now thinks that if he admits a mistake on ANYTHING that his Christian arguments are all threatened.
Oh really?  How do you explain my very forthright and honest concession that I was wrong about the AIG-chimp-chromosome thing?

Arden, precisely the REVERSE of what you say is true.  

YOU are the one that will never admit defeat no matter how looney you look.
----------------------
Quote
All by itself, a broken GULO gene does not prove much of anything -- but it is one line of evidence.


Thank you, Norm.  Would you please explain this to your friends and to Dr. Max?  They don't seem to get this simple point.

As for kinds, we will be getting into them shortly.

Quote
Ah, I missed that. Sorry. And I'm glad you admitted it.

So, now, in an attempt to prove to us that you're not 'looney', are you now willing to admit you were wrong on your linguistic statements, the founding fathers all being Christians, a Young Earth, Noah's flood, and scientists all 'jumping ship' on evolution? 'Cause none of those things are true, either...


No.  I won the Portuguese thing thanks to Rilke's Wikipedia article, my Medieval Encyclopedia and your own admission.  You can go argue that one against me with Rilke until you are blue in the face if you want.  But you'll be talking to the wind.

As for the rest, you'll have to earn victory, point by point.  If you win a point, I will concede.  I hope you will be so honorable as well.
-----------------------------
Quote
DDDDDDDDDAAAAAAAAAAAVVVVVVVEEEEEEEEE!!!!!!!!

AAAAAAARRRRRRREEEEEE
YYYYYOOOOOUUUU
TTTTTTAAAAAAKIKKKIIIINNNNGG
MMMMMYYYYYYY
BBBBEEEEEEETTTTTT
???

When do we start?
NNNNNNNNNNNNOOOOOOOOOOO!  I won already ... now be a gentleman and go help Rilke crawl out from under that big branch I sawed off.  I think she hit her head when she fell because she's hallucinating now.

Quote
Surely, davy, surely after pages and pages of discussion on this, you're not going to pretend that Max's only evidence is "a broken GULO gene".
I'm sure he has many more reasons why he thinks he is related to chimps, but the item of discussion on this thread most recently is THIS piece of evidence.  And let me say again ... I agree, it's a piece of evidence.  But it argues equally well for both Common Descent and Common Design.  Remember the Aerostar and the Fiesta?

Quote
But just for the record, it's not just one or two "holdouts" - so far as I can tell no one here other than you thinks you "won" that little dust-up.
most of them probably do agree with me, but they wouldn't dare admit it and betray "the team."

Quote
For you to be correct I would have had to have said "I haven't read Dr Max's argument but if you think you have refuted his argument/article you are sadly mistaken." whereas I actually said "I haven't read Dr Max's argument but if you think you have refuted the claim that the GULO gene does not support common descent you are sadly mistaken." Do you see the subtle but important difference.
Now that you point it out, yes.  I'll concede there was a subtle (very subtle) difference in the two statements.

Tom Ames ...  
Quote
The GULO pseudogene is evidence for the common ancestry and recent divergence of humans and the other great apes. It is not "proof of" same, and not considered as such by careful scientists.

You're engaging in an intellectually dishonest rhetorical tactic that Phil Johnson likes to use. He specializes in nibbling at the margins of specific pieces of evidence (never looking at the totality) and then pretending that he's "disproven" something. Or when it turns out that the evidence is correct, he diminishes its importance by pointing out that it's only one piece of evidence.

Pointing out that the GULO story does not by itself "prove" the ancestry of humans is a red herring: no-one claims that it is sufficient evidence. And you can get any biologist to "concede" this. But so what? It strongly supports a particular hypothesis. And thousands of other observations do too.


Thank you Tom, for agreeing with me in your first paragraph.  As for your second paragraph, if you will read this whole thread, I have looked at the totality of the Ape/Human ancestor question on two separate occasions.  To review briefly, the problems are (1) Lack of 'Hominid Civilizations' existing today, (2) Completely unconvincing fossil record, and (3) Major non-physical differences between apes and humans.  I am not engaging in intellectual dishonesty.  I focused heavily on the GULO issue because several people kept throwing it in my face in several different threads.  I simply took the challenge ...

And won!

Now let's see how intellectually honest all of you are ...
--------------------------------
Quote
Dave, I totally annihilated that claim of yours. There were other tool using primates, and our first human ancestors didn't live much differently than they did.


Did you ever read those posts?[/quote] Of course I read your post.  I always read your posts.  You, Chris, Jeannot, Tom, Incorygible and several others say very coherent things and you don't get into the goofy name calling which just makes people look vacuous.  I can tell also that you are very sincere in what you believe.  I respect what you have to say even though I disagree with your conclusions.

I know you responded to my claim of 'no hominid civilizations' but I don't agree that some bones and cave writing is evidence for this.  My contention is that if apes and humans have a common ancestor, there should be lots of 'beetle brow civilizations' all over the earth with half ape-men who grunt a lot and have a simple language and are at some stage between chimps and humans.  These 'people' should be living today if evolution were true.

(Rilke-- I'm glad to see you believe in Jesus now ... maybe you could tell BWE about Him)
--------------------------------------------


AND THAT'S A WRAP ???

Date: 2006/05/22 21:27:11, Link
Author: BWE
Done, I lost the formatting though. I shoulda seen it coming but I guess I was busy.

I must say, I was surprised. His other threads he get's more upset toward the end but his logic is absolutely consistent.

It isn't the same when I read it that way.

Date: 2006/05/23 04:21:47, Link
Author: BWE
One good book on Charlemaigne is by a guy named- No Joke- Notker the Stammerer. He was like a scribe or something in his court.

Latin was a deal for Charl.... He couldn'r read himself but he had memorized verses of the bible. He used to trap priests that couldn't do the right Latin by asking for certain benedictions. He was really #### on those priests. Parts of Gaul spoke latin but the burgundians and longobars and other germanics who had sacked rome and etc (the franks and Charlemaigne too) spoke germanic. However, he killed all the germanics east of the rhine or whatever river it was who wouldn't convert to christ- (tens of thousands of them, and y0ou wonder why the germans were skeptical of roman catholocism :) So I think the became more homogeneous after that.

By the time of Song of Roland, (150-200 years later) A romance language seems firmly embedded in gaul. I think charles the great and his empire had quite a bit to do with this. That last detail I am quite fuzzy on.

Does that make it better or worse? Charlemaigne was 800-ish CE to like 880ish CE (he got pretty old).

Date: 2006/05/23 05:05:42, Link
Author: BWE
Wow Dave,

It is hard for me to let this one go. Maybe I have a personal shortcoming here. (I try to give you one quoteable phrase with every post)

You just went back around to the beginning on the GULO gene. It broke after the fall because god cursed - everything?
So it broke identically in different creatures. Creatures of different "kinds"? At the same time? How many years ago?

On the Portuguese thing, like I said before, the only reason people argued this point is because you are making so many claims that show such an amazing lack of understanding that it was easy to jump on you for making an overly simplified claim. All your claims are overly simplified. As was the Portuguese thing. It turns out I was giving you too much credit. Apparently your argument was based on a small, incomplete bit of historical political circumstantial evidence. When folks here pointed that out, you did what you always do and gleefully shouted "game, set, match!" Rather than realize that there is a lot more subtlety to the issue than you gave it credit for. You made a bet, I took it, and you ignored me and claimed victory. If you are so sure, then have the debate with me. I'll start a thread for it. Remember the stakes. Otherwise, shut up and quit claiming victory.

I have to go back to my original point. You really need some background. Your understanding of natural processes is so fantastically lacking that genetics is a very poor place for you to start. You need to start with geologic time.

Plate techtonics, human anthropology and archaeology, carbon cycle, water cycle, ecosystems, &c.

Darwin wasn't working in a vacuum. And as time has advanced and the body of scientific knowledge has progressed, all of the evidence -all, you hardly ever get to use that word- has fallen in line with predictions of evolution. Just the same as all of the evidence has fallen (pun intended) in line with gravity. There are tweaks here and there but not problems with the principle.

Genetics too, isn't in being studied in a vacuum. The protiens and so on that perform specific functions are doing so in a world where these functions are adaptations to geography, climate &c. Every time. So why did god put citrus in the garden? Or was that the "fruit"? Did god put it there to provide the vit. c we would need once he broke the gene? Wierd that he would break the gene as punishment. I mean, ... oh nevermind.

Better go change, your christianity is on backward.

Date: 2006/05/23 05:16:29, Link
Author: BWE
And commies, pinkos, liberals, blacks, browns, uppity women, Labor Unions, volvos, perrier, and the educated intelligent class.

Date: 2006/05/23 06:02:03, Link
Author: BWE
Quote
Following this, we will begin looking at specific claims of the Bible, with the first being the Age of the Earth.  We will follow this with a lengthy discussion of evidence for the Global Flood of Noah, followed by other Biblical claims such as the Changing of the Languages, and a discussion of Biblical 'kinds.'  We will also examine the Documentary Hypothesis and discuss the 'Tablet Theory' of Genesis authorship and discuss the origin of the 7 day week (Yes, Faid, I know you think you answered this already, but you don't know my arguments yet).  Our goal is to provide solid evidence for the truth of Genesis 1-11.  


HAHAHAHAHAHA!!!

god it hurts to laugh so hard.

HAHAHAHAHAHAHA.

whew

HAHAHAHAHAHAH!!!!

Ohh man,

HAHAHAHAHAHAHAHA!!!

Davey, I'm glad we're going to start with the age of the earth. I predict that we will end with it too.

HAHAHAHAHAHAHAHAHA!!!!!!

Why don't we skip gradeschool and go straight to grad school again: Explain radioactive halflife davey. How is it consistent with a young earth?

HAHAHAHAHAHAHAHA!!!! :D  :D  :D  :D  :D

Date: 2006/05/23 06:35:55, Link
Author: BWE
AFDave will also have a thorough treatment of the linguistic similarities of Portuguese and French. -it's like they even look like they came from the same language, see? I was right.

And he will show why plate tectonics didn't happen. It just looks that way.

and, owww! jesus, you'll never guess where that flying monkey came from!

Date: 2006/05/23 06:49:10, Link
Author: BWE
Given the dates and the french thing, I was thinking "Song of Roland" (You know: Roland is fierce and Oliver is wise etc.) but it turns out I was on the wrong track, he was using Don Quixote as his history. And I bet we could have some fun with D/2's interpretation of the hero. Ouch. Hi Ho Rocinante! let us save this damsel from her cruel assailant!

Or is it E.B. White's version of the questing knight? I forget his name. The one that keeps losing his glasses and his faceplate keeps falling.... Pellinore, that's it.

*edit: I forgot the punchline-: Any way you slice it, it's fiction.

Date: 2006/05/23 07:12:41, Link
Author: BWE
GoP:
Although you are orders of magnitude smarter than T-diddy, you are drawing unfounded inferences from the article you posted that summarized some key findings of a larger piece of research. And, well, you are both toward the left of the curve x*2=y

Quote
Multiracial youngsters also were significantly more likely to have used marijuana and to have become drunk or high on drugs than white or Asian-Americans. There was little difference in these behaviors between multiracial and black youth.

When it came to violent behaviors such as carrying a weapon, being in a fight and threatening to stab someone, multiracial youth again were significantly more likely to report having engaged in these activities than were whites or Asian-Americans. Fewer differences were found between multiracial and black youths, although the multiracial adolescents reported significantly higher rates of hurting someone badly in a fight (39 percent) and having carried a gun (46 percent).


Quote
Among the students who identified themselves as multiracial, there were 25 different combinations of racial or ethnic backgrounds including 10 combinations of three racial backgrounds and five combinations of four backgrounds. About 80 percent of the multiracial students included some background.

"When it comes to multiracial youngsters, you have to take into account the experiences they are having with discrimination," Catalano said. "Discrimination felt by these children no doubt contributed to involvement in problem behaviors. Formation of identity is more difficult for multiracial children who have to figure out where they fit in and belong."

Harachi noted that while multiracial children are at higher risk for substance abuse and violent behavior, in most cases the majority of the multiracial youth were not involved in these problems.


This is not an argument against the mixing of the races. This is an identification of where mixed races tend to fit in a socio-cultural and socio-economic framework. It is also not an argument against gay marriage.

I was asking a serious question back there. So what? What if ten gay men are married to a goat and society allows it? What does it do to a traditional marriage?

And I was referring back to a point where T-diddy used the word collapse as in society will collapse or is collapsing. I want to know what that looks like. What bad things are happening and what does the end result look like?

Date: 2006/05/23 07:15:44, Link
Author: BWE
First you need to get through tectonics. Then we can start with evolution.

Date: 2006/05/23 07:30:04, Link
Author: BWE
Well, 6000 years. He is certainly rejecting it at some level.

Date: 2006/05/23 10:11:54, Link
Author: BWE
Astonishingly GoP, I agree. The 14th ammendment thing was OT.

And I appreciate your honesty on the following:
Quote
My point was, "If significant child-rearing problems can arise from relationships that are broadly accepted in society and don't stir up mixed sexual signals, then what about relationships that are not socially acceptable, and that do muddy the waters of sexual identity?" We all know how important sex is to the adolescent mind. The teenaged years are a tough time, and children need role models who have successfully navigated those turbulent waters. Children also need fathers and mothers, and gay marriage is missing one of those. If someone could provide a philosophical, legal, or historical justification for the contention that marriage is a fundamental right, I might be able to look past these difficulties and rubber-stamp alternative unions. But no one has.


That is the only coherent argument against gay marriage that I can see. But it would have to be accurate for it to work. I'm not saying it is inaccurate but the mixed race issue is inherently different. That is a socio-cultural and socio-economic issue relating to cultural biases on race, not sexual orientation. But, if that is what we have to work with then lets try this:

If mixed race were considered "normal" or "OK" and not a noticable distinction, would those children still have the same problem? It seems to me, if race identity is a factor, then it would be society's attitude toward race that would be causing the problem.

Same for sexuality. If no one cares about your sexual preference, then it ceases to be a problem for everyone, right?

It sounds to me like you don't want kids to have the choice of being gay.

Bottom line, I don't care what my neighbor does as long as he isn't predatory. And that has to do with hate, fear, guilt, repression and a host of other things that aren't related to sexual orientation.

It sounds like you do care what your neighbor does. Maybe your neighbor feels bad because you don't like it so he bottles it up and it comes out sideways in bad ways? What do you think of that?

If you aren't afraid of recrimination, it seems to me like you are more likely to discuss the way you feel with others and people can help you when you are close to the boundaries.

And GoP, the boundaries are where we are when we might hurt people.

A well-adjusted gay man who can talk about how he feels is a lot less likely I bet to hurt people than a Christian man who can't talk about the fantasies he is harboring and no one comes to help.

I guess that makes me liberal eh?

I wonder if anyone has ever done a study of church attendance records of child molesters? My cynical mind suspects that it is higher than the national average.

Date: 2006/05/23 10:17:07, Link
Author: BWE
at least we can increase the level of cognative dissonance to an uncomfortable level. If you can't change 'em, marginalize 'em.

Date: 2006/05/23 11:10:51, Link
Author: BWE
Quote (Ladlergo @ May 23 2006,15:45)
Quote (The Ghost of Paley @ May 23 2006,16:32)

The funny thing is, I really don't care what my neighbor does. And if I could get some legal guarantee (a constitutional amendment, perhaps?) that gay marriage today wouldn't lead to affirmative action tomorrow, or that I could live free from the inevitable fruit of such unions (angry, disturbed children, for example), then I might be more willing to compromise. But T-daddy and I can see where this policy will lead. Then again, we're not blinded by the incense.

  I guess we'll have to see what happens in England and Massachusetts.

All children go through a time when they're angry and disturbed.  It's called adolescence.  How are the children of gay or bisexual parents any different?  And don't pull the bullshit of needing both a father and a mother.  Psych studies say you're wrong (and if you're going to say they're flawed, say how they're flawed).

And Massachusetts has the lowest divorce rate in the US.  Just FYI.

And canada.

And these studies would seem to get to the heart of the matter. Can anyone point to them? My suspicions are strong but I see that so are GoP's and we appear to have conflicting suspicions. Also that could put the whole thing to rest as far as this particular thread goes. We could critique the studies' methods and conclusions and at least know what we are disagreeing about.

GoP, it was nice of you to bail out poor T-diddy, he was really falling apart there. You're like a big brother who tries to let your little bro take care of himself but steps in when little bro falls apart.

Like Hector did for Paris.

Date: 2006/05/23 11:13:58, Link
Author: BWE
Don Quixote.

Date: 2006/05/23 11:39:50, Link
Author: BWE
I bet that you won't be able to tease out economic and socio-economic factors.

Also, that is a pretty weak argument on another front:
The way someone else raises their kids isn't really your business. Now I would prefer that christians like Davey wouldn't raise kids because that kind of person creates a society that I don't like and that is dangerous in ways that are tangible to me.

I can't imagine that children of loving parents could be any worse off than children of parents who aren't socialized well enough to be loving. Or are you arguing that Gay people don't really love?

Date: 2006/05/23 11:53:30, Link
Author: BWE
OK, 1/2 a Dave,

You are frustrating to be sure. Your Bible theories are old hat and you are not the first to raise them. ToE is important for science. Christistianity is not. But if you are really serious about learning, you need to start with the age of the Earth. The genome doesn't make sense except in light of goelogic time. If you can prove that the Earth is less than, say, a few billion years old, then you will have disproved evolution and all its trappings anyway.

Before you do that though, you should explain plate tectonics (continental drift) so that we can assess your current understanding and start from wherever you really are.

I would ask that you begin by accepting that you are generally delusional but I suppose that is too much to ask.

Date: 2006/05/23 20:27:25, Link
Author: BWE
Thordaddy,

You know I have always had the utmost respect for your positions and debate skills but this time I think I have to hand it to EricMurphy, the Irishman.

Listen, you're down but you're not out. Try bringing up Hitler. Gosh I don't know, you're the idea guy. Just make sure it's the ol' one-two. Don't let 'em put cha down just 'cause he's got cha on the ropes.

We'll keep those fags out of Venezuela yet. Just try and marry a goat you fags. Go ahead, try and take marriage away from me. You'll see my buddy Thordaddy here'll defend it with a left hook that'll sneak up on ya and put cher lights out ya fags. Yeah.

Date: 2006/05/23 21:18:41, Link
Author: BWE
I may be going to #### in a bucket, but at least I'm enjoying the ride. :D

Date: 2006/05/23 21:35:39, Link
Author: BWE
Skeptic,

You've just hit the nail on the head. Your statements are exactly in line. Here you are, an expert, and here these guys are, obviously NOT experts like you, and when you try to point out the obvious flaws in their holy evolution god, they snarl and hiss and show their claws and claim to be able to educate you, you the expert, if you'd just stop pointing out the darn flaws in their holy see of darwinian literature. Now, I'm not a scientist like you but I can see the level of merit in your argument. And like you, I'd just like to get them to open their minds and figure out a way to handle guys like you. If they had an effective way of communicating with guys like you then maybe something could happen.
???

Date: 2006/05/24 05:01:48, Link
Author: BWE
Dave, it would be helpful if you start here.

This is an age appropriate overview of plate tectonics. :)  There are certainly nuances that this overview leaves out but from a specifically geological perspective, it summarizes core knowledge nicely.

Date: 2006/05/24 05:53:57, Link
Author: BWE
Davey davey davey davey,

Pretty much every single biologist, geologist, oceanographer, meteorologist, geneticist, and any other -ist will believe in god/creationism if you can prove that the earth is less than 4 billion years. I'd start with that basic info I posted in the new thread for your young earth evidence.

I am happy with my current religion but hey, if yours turns out to be right then all my hard work will have paid off. I will spend eternity with all the folks I like.  :)

Date: 2006/05/24 18:47:37, Link
Author: BWE
Skeptic,

You are absolutely on track. These guys are all working off the "law" of Evolution much the same way physicists worked off the "Law" of gravity. If only they would just wake up and realize that there is a frameshift in understanding just over the event horizon they would be searching in 5 or more dimentians to find the causes of genetic degenetic-generation and malthusian saltation occurences instead of claiming that random mutation and selective pressure exerted by changing ecosystems, competition for resources and isolated niches with available food and places to raise young in relative safety are mechanisms that can generate upward genetic mobility and  a stratified genetically and specieally grouped biosphere that owes nothing to interactions with non-euclidean and euclidian universes that might intersect in non-dimentional singularities with the specific genomic anomalies exhibited by the various kingdoms and phylums and even down to the species level and below that only lose functionality rather than incorporate new variations and increased genetic information that is implied and implicated by neo-darwinian mysticism and neo-darwinists refusal to think outside of that particular box.

Date: 2006/05/24 19:18:11, Link
Author: BWE
Sir T,
It is precicely because you have studied that you are unable to see the obvious facts that Skeptic has laid at your feet raising the anadorned observations that can stand when all has fallen into molecules, quarks and jesons. You were channelled into a nomenclature that accepted no alternative explanations than ones with paltry experimental substantiation and confirmation that only offer corroboration and validation of the initial questions that were isolated in a laboratory excluding the most obvious affirmative evidence for the deceptively simple alternatives and fractal evidence for the weaknesses with modern evolutionary theory and neo-darwinian whitewashing.

What do you say to that?

Date: 2006/05/24 19:34:38, Link
Author: BWE
If there were holes in the fossil record, wouldn't evolution predict that they would be filled?
Jeeze. It's pretty basic.

Date: 2006/05/24 19:37:27, Link
Author: BWE
I got lost for a bit. Did he mention Plate tectonics?

Date: 2006/05/25 05:04:04, Link
Author: BWE
Quote (Faid @ May 25 2006,04:14)
BWE,
keep your creationist paws off sceptic.
The man is NOT a creo: He clearly stated that in the beginning. He's not of your ignorant kind (with its tell-tale incomprehensible writing): He has studied Biochemistry. He's a scientist, for crying out loud, just a deluded one.
The reason he uses creationist terms like "Darwinism" and creo arguments like the fossil record does not show he's on your side: It just shows how your indoctrination has reached far into the scientific community. And that's why we get more and more respectable scientists in relevant fields submit to the ID propaganda every day.
Sceptic still has a chance to escape their faith. He just has to learn a few truths. After all, that is what is here for; and he's come to the rite place.
Leave him alone, and take your deluded teachings elsewhere. People more educated in these issues -like Thordaddy- would be more willing to discuss with you; but leave the cubs alone.
:angry:

Faid,

It is not me nor is it skeptic who is delusionally propogating the myths of wholesale chaotic structure a la James Gleick and attributing them to the nonlinear aspects of the origins of species in the context of assuming change took infathomable amounts of time to achieve a non-static state that neo-darinians assign to current living structures, all the while ignoring the overwhelming evidence available to those who simply look elsewhere for the causes and consequences of the structures which we witness when we merely remove the evolutionary blinders so disiningenuously applied by institutions of higher learning in America and elsewhere in the world in the transparent hope that Darwinian dogma could become the prevailing worldview and that intelligent debate becomes stifled under the oppressive weight of fancy facts and figures invoked under the moniker of science and validated through palty "experimental" data and "verified" predictions.

So don't tell me. Try looking in the mirror.

Date: 2006/05/25 05:33:58, Link
Author: BWE
Dave I am beginning to see your point. I had a dream last night and in it, a diembodied voice came to me and chastised me for my behavior.

I woke this morning and had what might be called an epiphany. I tried to describe it with words but I think i fell short. In the best way I can describe it,

The universe is too great to be described by the name universe. If it could be named so simply, it would not be the universe. Heaven and Earth began from the nameless, but the multitudes of things around us were created by names. We desire to understand the world by giving names to the things we see,but these things are only the effects of something subtle. When we see beyond the desire to use names, we can sense the nameless cause of these effects.

The cause and the effects are aspects of the same, one thing. They are both mysterious and profound. At their most mysterious and profound point lies the "Gate of the Great Truth".

Am I close to your concept?

Date: 2006/05/25 05:42:19, Link
Author: BWE
Faid is most certainly helping to prove my point by spouting off dogmatic plattitudes for darwinian appologists the world around who insist on covering the issue of science with a blanket of obfuscatory experiments, hypotheses, predictions and scientific journal entries in an attempt to bury dissenting opinion beneath a deluge of facts and figures that the darwinian appologist will advise those who have not eaten the pomegranate seeds of evolutionary dogma as the darwinian persephones did to peruse and thoroughly understand before they bring evidence to bear against the opressive regime of darwinian neo-culture.

* last sentence edited- Darn cut and past from word

Date: 2006/05/25 09:03:51, Link
Author: BWE
My interest in Davey is Waning
Since I have inpected the draining

Oatmeal mush from his cranial location
Slowly draining since indoctrination
In self-evident truths of creation
And intellectual constipation

And his words that he hopes will be staining
Young minds punished like caning
And he goes on a rage campaigning
For truth or a lie or a chaining

Of science with shackles of shaming.

Ok, we'll improve with the next one.

Davey, did you read my last post? I had a revelation!
Care to comment?

Date: 2006/05/25 09:07:42, Link
Author: BWE
Sorry, My revelation in verse:


God and heaven both unfold
While you yourself are being sold
By preachers round a water hole
To those who want to gain control

Over body mind heart and soul
In fear that they are growing old
Their bodies that will decompose
So pave the fears with bricks of gold

And keep you in a stranglehold
Of fear that you can only go
To pastures sung about of woe
Sheep for shepherd’s crook to mold

Body mind heart and soul
The joys that we can only know
Apart from any friend or foe
We learned about them long ago

Where our thoughts can overflow
From silver cups and drinking bowls
And timeless loves that we stow
In little boxes wrapped in bows

Enjoying time where we forego
Fear of pleasures down below
Chains of daisies that we hold
As we dance we know it’s so
The hours our ours to see no more

Date: 2006/05/25 09:17:15, Link
Author: BWE
That should read  
Quote
I love it so!
;)

Date: 2006/05/25 09:44:13, Link
Author: BWE
People, people,

Aren't we forgetting the main thing here? T-diddy is an idiot. Really. C'mon. Yes gay marriage can be debated by rational people and the debate can be heated but this isn't about that. It's about something far more sublime: a guy who can honestly talk about a liberal agenda as if it were a massive, unified thing and somehow turn that into an argument against evolution. This guy is really far out there and puts himself here as sport for the creative side of the posters here. Save real debate for real people. Wow, maybe that will be my little tagline that some people put at the bottom of their posts in a different color:

Save real debate for real people. :)

Date: 2006/05/25 10:07:59, Link
Author: BWE
jeannot says:
Quote
Inclusive fitness is a better predictor than individual fitness. Gene combinations are borken by sexual reproduction. And between two sexual generations, the fitness of any gene and the fitness of its bearer are indistinguishable (a perfect example is parthenogenesis in aphids during summer).
The reproductive rate of individuals can't account for observations like segregation distortion on chromosmes, male sterility and cytoplasmic incompatibilities caused by organelles, sterile castes in social insects (Darwin's big concern), etc.

Borken?

Saying that gene combinations are broken by sexual reproduction is typical darwinist eriudition and utterly glosses over the critical fact that gene combinations are recombined through fertilization and the new combined genes have the potential to be any number of homologous amalgamations of either deliterious or benificial or even neutral and non-functioning progeny capable of expressing themselves in a variety of ways.

Date: 2006/05/25 10:22:14, Link
Author: BWE
Quote
A Memorable Fancy.
An Angel came to me and said: 'O pitiable foolish young man! O horrible! O dreadful state! consider the hot burning dungeon thou art preparing for thyself to all eternity, to which thou art going in such career.'
I said: 'perhaps you will be willing to shew me my eternal lot & we will contemplate together upon it and see whether your lot or mine is most desirable.'
So he took me thro' a stable & thro' a church & down into the church vault at the end of which was a mill: thro' the mill we went, and came to a cave: down the winding cavern we groped our tedious way till a void boundless as a nether sky appear'd beneath us & we held by the roots of trees and hung over this immensity; but I said, 'if you please we will commit ourselves to this void, and see whether providence is here also, if you will not, I will?' but he answer'd: 'do not presume, O young-man, but as we here remain, behold thy lot which will soon appear when the darkness passes away.'
So I remain'd with him, sitting in the twisted root of an oak; he was suspended in a fungus, which hung with the head downward into the deep.
By degrees we beheld the infinite Abyss, fiery as the smoke of a burning city; beneath us at an immense distance, was the sun, black but shining; round it were fiery tracks on which revolv'd vast spiders, crawling after their prey; which flew, or rather swum, in the infinite deep, in the most terrific shapes of animals sprung from corruption; & the air was full of them, & seem'd composed of them: these are Devils, and are called Powers of the air. I now asked my companion which was my eternal lot? he said, 'between the black & white spiders.'
But now, from between the black & white spiders, a cloud and fire burst and rolled thro' the deep black'ning all beneath, so that the nether deep grew black as a sea, & rolled with a terrible noise; beneath us was nothing now to be seen but a black tempest, till looking east between the clouds & the waves, we saw a cataract of blood mixed with fire, and not many stones' throw from us appear'd and sunk again the scaly fold of a monstrous serpent; at last, to the east, distant about three degrees appear'd a fiery crest above the waves; slowly it reared like a ridge of golden rocks, till we discover'd two globes of crimson fire, from which the sea fled away in clouds of smoke; and now we saw, it was the head of Leviathan; his forehead was divided into streaks of green & purple like those on a tyger's forehead: soon we saw his mouth & red gills hang just above the raging foam tinging the black deep with beams of blood, advancing toward us with all the fury of a spiritual existence.
My friend the Angel climb'd up from his station into the mill; I remain'd alone, & then this appearance was no more, but I found myself sitting on a pleasant bank beside a river by moonlight, hearing a harper who sung to the harp; & his theme was: 'The man who never alters his opinion is like standing water, & breeds reptiles of the mind.'
But I arose, and sought for the mill, & there I found my Angel, who surprised, asked me how I escaped?
I answer'd: ' All that we saw was owing to your metaphysics; for when you ran away, I found myself on a bank by moonlight hearing a harper, But now we have seen my eternal lot, shall I shew you yours?' he laugh'd at my proposal; but I by force suddenly caught him in my arms, & flew westerly thro' the night, till we were elevated above the earth's shadow; then I flung myself with him directly into the body of the sun; here I clothed myself in white, & taking in my hand Swedenborg's, volumes sunk from the glorious clime, and passed all the planets till we came to saturn: here I staid to rest & then leap'd into the void, between saturn & the fixed stars.
'Here,' said I, 'is your lot, in this space, if space it may be call'd.' Soon we saw the stable and the church, & I took him to the altar and open'd the Bible, and lo! it was a deep pit, into which I descended driving the Angel before me, soon we saw seven houses of brick; one we enter'd; in it were a number of monkeys, baboons, & all of that species, chain'd by the middle, grinning and snatching at one another, but witheld by the shortness of their chains: however, I saw that they sometimes grew numerous, and then the weak were caught by the strong, and with a grinning aspect, first coupled with, & then devour'd, by plucking off first one limb and then another till the body was left a helpless trunk; this after grinning & kissing it with seeming fondness they devour'd too; and here & there I saw one savourily picking the flesh off of his own tail; as the stench terribly annoy'd us both, we went into the mill, & I in my hand brought the skeleton of a body, which in the mill was Aristotle's Analytics.
So the Angel said: 'thy phantasy has imposed upon me, & thou oughtest to be ashamed.'
I answer'd: 'we impose on one another, & it is but lost time to converse with you whose works are only Analytics.'

-william blake

Date: 2006/05/25 11:36:01, Link
Author: BWE
Amazingly, that last post is relevant to this discussion. :)

Date: 2006/05/25 11:40:27, Link
Author: BWE
Quote
We always suspected so anyway, but it's interesting that you've shown so little interest in disabusing us of the notion.


It's just that he is "disinclined to acquiesce"

10 points to the one who recognizes that quote.

PS, I'm kinda proud of that last poem. Rather lyrical. I will set it to music I think.

Date: 2006/05/25 11:45:23, Link
Author: BWE
Quote (Ladlergo @ May 25 2006,15:19)
Quote (afdave @ May 25 2006,13:06)
ONE HALF OF ONE LOUSY PERCENTAGE POINT???

Wow!  I was only off by a factor of 2!  Do I win a consolation prize?

Dave, what's the genetic similarity between humans and mice?  What's the genetic similarity between humans and fruit flies?  Both of these answers can be found in five minutes on Google.

humans and grass?

Date: 2006/05/25 13:41:34, Link
Author: BWE
Davey,

You're a muse! All things according to the creator's plan. You needed to be so insanely ridiculously stupid to spur us on to poetic inspiration.

Thank you

Date: 2006/05/25 13:45:47, Link
Author: BWE
T-diddy,
You are an idiot.

PuckSR is not in jeopardy for his opinions because he explains them and defends them in coherent and rational ways. What you are witnessing is two different points of view being discussed by sane people. That is how sane people do it. Disturbing isn't it?

Date: 2006/05/25 13:53:30, Link
Author: BWE
link?

Date: 2006/05/25 14:15:49, Link
Author: BWE
What post did the exchange happen on?

Date: 2006/05/26 05:23:34, Link
Author: BWE
High functioning? I don't know. That's prety hard to say. I certainly wouldn't want to drive that way.

Thanks for the quotes and the link.

It isn't like making fun of what we traditionally call handicapped. It's more like making fun of a less dangerous ted kaczinski.read it here, it sounds a lot like t-diddy with brains or even Larry. This isn't an attempt to poke fun. It is a disturbing similarity.

Date: 2006/05/26 09:38:24, Link
Author: BWE
I'm beginning to notice that we have developed roles in this "debate". I'm starting to think it's getting to be about time to jump in here and fulfil the duties of my role. Hmmm. What do you suppose I might be about to say?

GoP?
1/2 a Dave?
T-diddy?

Date: 2006/05/26 10:38:16, Link
Author: BWE
Quote
Neutral theory isn't exclusive of natural selection, at least not the way I read it.  The question that still haunts me is this apparent confusion between traits and genes.  Traits must almost assuredly be made up of many genes and the expression of each may or may not be dependant upon the other.


Skeptic,
You are coherently and patiently describing logic to a group of people whose ability to use deductive reasoning is hobbled by a belief system that is as incapable of expressing platonic ideals as a simian is of expressing aristotelian empiricism (which the scientists love to do) while they retort with situational anlalyses to explain various phenomena without using any reflective techniques or open ended lines of questioning like you might if you began with no assumed prerequisites for the development of various manefestations of life as they actually occur and your approach is falling on ears that have been numbed with the constant mantra of test and verify to the point where creative thought that could challenge collective assumptions gets subsumed in a whirl of publications, grant proposals, experimental data, and other forms of evidence that do not in any way allow for information that falls outside this system to enter into the system that creates neww scientists, perpetuating the culture of evidenciary assumptions and inability to use pure logic to arrive at even the most obvious truth in respect to scientific pursuits.

Hmpf. :angry:

Date: 2006/05/26 11:29:10, Link
Author: BWE
Quote
This is the exact definition for the gay "marriage" advocates.  They ACKNOWLEDGE NO OPPOSITION to gay "marriage."  All opposing views, no matter how seemingly legitimate, are illegitimate, PERIOD.  Just peruse Occam's, Murphy's, Elliot's or BWE's posts to see what is clearly obvious?  And see if one advocate will deny my clear statement that they ACKNOWLEDGE NO OPPOSITION to gay "marriage."


Boy, you've really got me there T-diddy. Perusing my posts, while obviously enlightening in many ways, puts me square in the middle of that definition. I certainly do not have opposition to gay marriage. I suspect that, in your symantically challenged way, you might mean something a little bit different. So, is this news? If being a liberal means not taking a position which firmly defines the person holding it as an a$$hole, then, well, I try to be liberal. But I suspect you mean liberal in the sense of that quote I posted a while back in this thread. It was Ted Kaczinski.

 
Quote
Secondly, the only reason "liberals" are able to claim "racism" when the discussion of interracial marriage takes place is because they retain a narcissistic view of politics.  The personal is political.  Most "liberals" (especially the ones on this forum) have no real experience with real racism yet they pontificate like they were blacks in the 1960's or homosexuals in the 21st century.  Likewise, most real traditionalists have little experience with real racism because oppressing blacks or homosexuals is really only something "liberals" are always ranting about.  
Well, not quite. When someone claims that something is racist, they are usually making a claim that could be semi-objectively verified. Courts do this sometimes. You should read Brown v Board of Education. And I personally find it distasteful to interrupt someone's will to be wierd unless it is quite likely to cause personal injury to others.

You fit that second category. I'll tell you how sometime. Maybe we can go get a few drinks, go to a porno theatre, and, well, talk about it. :)

Date: 2006/05/26 12:17:05, Link
Author: BWE
Quote (skeptic @ May 26 2006,16:24)
Actually, BWE, you're on to something there.  About three years ago in an issue of The Scientist, I came across a letter to the editor discussing evolution and a Berkley biology professor stated that he would never write a letter of recommendation for graduate school for an undergrad who did not fully accept the modern synthesis.  His reasoning, I'm paraphrasing, was that it indicated that the student was irrational.  This set off a mini-firestorn that lasted a number of issues but it certainly was upsetting and close-minded.

Of course I'm on to something. It couldn't be more plain. Am I not clear enough?

Date: 2006/05/26 16:40:31, Link
Author: BWE
#### it Stevestory, haven't you been paying attention?

Date: 2006/05/28 11:50:03, Link
Author: BWE
Quote
afdave
Posted: May 27 2006,14:01  
Puck--  

I'm not so concerned with the labels we use for the discussion.  I'm happy to accomodate people in that regard.

My interest lies in the substance.
      Report this post to a moderator
Quote

k.e
Posted: May 27 2006,14:24  
Substance? .....abuse


HAHAHAHAHA!
Dave, you are stupid. Really really stupid. And i mean that in the most insulting, derogatory, disparaging, offensive, belittling, uncomplimentary way possible. Not only are you stupid, but your religious ideas are stupid. The supreme gods of stupidity bow before your relentless onslaught. It's stupider than if the worlds top 10 million psychic mediums all sat criss-cross applesauce at the north pole during the most powerful aurora in history and channelled stupidity from its cosmic wellspring. You can twist mere thoughtlessness and ignorance into the poetic stupidity. Indeed, you have no choice. You are driven to do so by the muses that insire you. The same muses that inspired rodney dangerfield, Dan quayle, GWB, the later chevy chase, Montel Williams, Nixon's decision to tape white house conversations, General Custer- what's a few injuns mean to me?, the Edsel, New Coke, the Charge of the Light Brigade and of course, Dr. Dino.

Your stupidity defies physical laws governing the upper limits of stupidity. Your posts compound the stupidity of your previous posts (A fact considered impossible by the late Stupidologist, Alfred E. Neuman).

Your lack of any other quality besides stupidity throws many parts of quantum theory into a state of flux. You refute the notion of zen as the sound of one hand clapping. If you could see your own stupidity, a quantum vortex would appear due to the exponential stupidity that would be generated and the universe would revert to its singular state out of shame. You have no redeming qualities that do not fully incorporate your stupidity as their core feature.

In short, you are an idiot.

That quality is duly entered into the record.

Date: 2006/05/28 12:57:35, Link
Author: BWE
Quote (deadman_932 @ May 28 2006,17:14)
Dear DaveTard2: I came back to read what other people thought of your stupid idea and have a laugh, ...

... beyond your mere dishonesty, willingness to dissemble, avoid, divert, shift the goalposts and use every fallacy known to man, you're stupid.

I cannot believe how incredibly stupid you are. I mean rock-hard stupid. Dehydrated-rock-hard stupid, depleted uranium stupid. Stupid... so stupid it goes way beyond the stupid we know into a whole different dimension of stupid. You are trans-stupid stupid,  meta-stupid... supra-stupid.

You're stupid collapsed on itself, Dave-- so far that even the single neuron you had popped ITSELF out of existence. Stupid gotten so dense that no intellect can escape. Singularity stupid.You broadcast more stupid in one second than our entire galaxy emits in a year. Quasar stupid.You're like some primordial fragment from the original big bang of stupid. Some pure essence of a stupid uncontaminated by any recognizable intelligence. Ur-stupid, antediluvian, pre-eukaryotic stupid.

It is my sincere hope that your children grow up to be smarter than you are, DaveTard, and see that you're an idiot, as any moderately intelligent person would. Whether they give you pity or scorn is not my concern.

Talk about taking the ball and running with it  :p

-And 1/2 a dave,

You know deep down that your ideas are so stupid that they merit a new lexicon just to describe them. Unfortunately, you are as stupid as your ideas so you are unable to change.

I'm sorry, but it only takes a little brain to understand that you are regurgitating others' ideas and that you do not have ideas yourself. Amoeba understand your arguments better than you do. I take that back, I'm not sorry.

You were so gleeful when you heard me say thta I'd be a creo if you could prove the Earth was less than 4 b. years old. You didn't do it. And do you know why? Because you are so stupid that you sit on your tv and watch your couch. Because your stupid is higher than a mountain, deeper than water, denser than  an element with an atomic weight of infinity. Your stupid is the kind of stupid that wannabees dream about. Your stupid is a combination of Catalan, Vulgar Latin, and stupid. With stupid making up the majority.

Date: 2006/05/28 13:10:17, Link
Author: BWE
It's a wonder god couldn't figure out anything better than clay tablets.

Wonder what language? oh yeah, 1 part vulgar latin, 1 part pig latin, 1 part dubby bubby and 99,999,999,999,999,999,997 parts stupid. Davey, want to argue that french had anything to do with it?

1/2 a Dave is the human equivelent of zero?
:)

Date: 2006/05/28 14:45:38, Link
Author: BWE
But Davey Dickhead, He did answer you. Now, how about plate tectonics. Evidence for a Young Earth? The human/ writing thing was simply too dumb for a real response. Let's try tectonics. You have a pretty good understanding you say. What is it?

You see, I thought I had a good understanding but now I'm not sure. And I did offer to become a brainwashed fundie like you if you could provide evidence of a young earth. You are aware that you haven't yet provided a single piece of evidence for any of your claims, right?

The time for taking you seriously passed long, long ago, before your mother or your grandfather were born. Before the mountains began to rise on the western shored of the continents that became the Americas. Before the pterydactyl first started its first flight millions and ,millions of years ago.

(this just came to me but I have no doubt it was divinely inspired) Here's what really happened:

Long, long ago, before your mother or your grandfather was born, when Mother Earth and Father Sky were still children, they played games in the dark room of night.  As they played, the door to the room opened just a crack.  A small piece of light entered the room.  Father Sky jumped on it and covered it with his hands.  Mother Earth moved closer to see the wonder but Father Sky turned his back to her in jealousy.  Mother Earth waited to see what he would do with it.

Father Sky hunched over his new plaything, molding it and shaping it with his hands.  Mother Earth moved closer to see what he had done.  Father Sky brought his hands up to his chest and threw them up into the darkness as if he was releasing a sparrow.  A blinding flash filled the room.  

As the two watched, the heavens sprang forth.  The children squealed in delight.  Father Sky went out to play in his new creation, ignoring Mother Earth as he rushed.  He hurled stars into planets and took delight in the fiery chaos.

Mother Earth, watching from a distance, soon grew tired of this violent game.  She quietly left her place and hid herself in the form of a small planet far from where Father Sky was playing. She began sculpting the raw materials of the world she created into animal and plant forms.  Presently, she made a game where her forms would grow and change into other forms.  She shared her love of beauty, joy and contentment with her creations.  

Eventually, she made a creature wild and beautiful covered with hair and walking on two feet.  She called the creature Haman.  She created men and women and gave them the gift of speech so she could talk to them.  

The creatures learned to see the beauty she had created in the sunrises and sunsets.  They learned to laugh when the icy water from a waterfall fell over their heads and shoulders. And when they got old or fell prey to an accident, they were not afraid because their bodies returned to Mother Earth and she reshaped their bodies into new bodies.  And they took delight in the wildness of her creation.  Mother Earth was happy.

Father Sky went into a rage when he discovered Mother Earth had gone off without telling him and he started searching the universe for her.  When he finally discovered her trick, he hid on the planet’s moon and watched her.  He grew fascinated with her creations and learned to make wild things himself.  He spent a good deal of time watching her hamans.  Their rituals, games and diversions, intrigued him but he didn’t know what beauty was, so he didn’t understand most of what they were doing.  

He decided to punish Mother Earth for hiding from him so he changed her into the planet forever.  Then he made his own creations that he called Ooman (because he liked it better than Haman).  They were like Mother Earth’s hamans but that they had no hair on their entire bodies and they were cunning.  They liked to mold and shape the surface of their planet to fit their desires.  They built houses to escape the wind and the rain.  They diverted water from the rivers to water their crops.  And Father Sky was pleased.  Ooman was also cruel.  He hunted the hamans and made war on them.  Father sky gave them the gift of fire to help his ooman.  Ooman used the fire to burn the forests and chase the humans off the land.  They made weapons out of the trees and rocks that mother Earth had made and killed the hamans mercilessly. The Hamans went to Mother Earth and asked for her help.  She created a giant upheaval in the planet’s crust, which killed many of Father Sky’s ooman and created caves and other hiding places for her hamans to escape the hunters.  

Now ooman was clever and cunning and cruel for the most part, but one young man among them was not as cruel as the rest.  He didn’t enjoy killing.  He killed only what he could eat and no more.  He rarely hunted hamans and only went when others in his tribe forced him to go.  Mother Earth had a plan.

She went to this ooman in the disguise of a young woman in his tribe.  She taught him the language of the hamans and convinced him that he should go and meet them.  

Father Sky, realizing what she was up to, decided to rid the world of the hamans once and for all.   He gathered all the oomans together and made them go and chase all the hamans to the edge of a great cliff overlooking the sea where they would either be slaughtered or be pushed to their deaths.  Because he started in secret, Mother Earth only had time to hide one of her hamans, a young girl, in a cave before the rest of her people were driven to the edge of the cliff.

Because the hamans were not afraid of death, they simply threw themselves over the edge of the cliff to escape the onslaught of the oomans.  Mother Earth wept in pity and sorrow as she saw her wonderful creation being destroyed by the oomans.  But before any of them hit the water below, she changed them into dolphins and they swam away into the ocean where they still play and enjoy the beauty of Mother Earth today.  

The oomans, bewildered by the magic of Mother Earth, went up to the edge of the cliff to peer at the wonder below.  But the weight of so many made the cliff grow unstable and it collapsed into the sea taking every ooman with it.  Except one.  The one Mother Earth had taught the language of the hamans to, could not bear the thought of driving them into the sea so he stayed back.  He was standing near the mouth of the cave where the young girl was hiding.  When everything was over, she came out from her hiding place and was surprised to see him.  Mother Earth cast a spell on them and they fell in love.  Their children were cunning and clever, but they also loved beauty and play.  She decided the children should be called Human.  Ever since, humans have looked out to the oceans and appreciated the wildness of nature.

Date: 2006/05/28 15:53:32, Link
Author: BWE
He's just good, clean fun.

Ved- your avatar slows up the page load. :(

He is inspirational is some kind of a wierd way. (But, a quick glance at my "blog" would show that I have a wierd sense of inspiration.)

Date: 2006/05/28 19:11:30, Link
Author: BWE
Beer Volcano. I understand why you  might think that sort of a thing. There is a lot of press out there pointing out the poor quality of modeling technology and poor results it gives.

I should qualify my statement by saying that I couldn't build a high-tech model that could work in 3-d and all to save my life. But,

I use data from models all the time. It is only marginally less valuable than real data from sampling stations. We model water temperature, populations, salinity and a host of other things. I suppose that the data might be just lucky but we've been relying on it for quite some time. When you are isolating a specific element of a chaotic system, like ozone in the stratosphere, I would bet that the models are basically correct. Not to be too hot on models but they do come with error percentages and dates that you can carry data out to and etc. I've never seen an error that wasn't accounted for before the model ran. In other words, the models are pretty good at even predicting their errors. Bottom line, They work. If they don't, you know before you run the model. The more factors in the model (complexity) the more errors. But in things like ozone levels in a specific temperature and density setting are modelable. ???

Anyone care to give us an update on fractal modeling technology?

Date: 2006/05/30 10:15:14, Link
Author: BWE
Quote
Let's review what we have done so far ...

SUMMARY OF AF DAVE'S YEC EVIDENCE PRESENTED SO FAR

(A)  YEC proposes a Super-Intelligent Creator God.  Evidence:  
   (1) Finely tuned cosmos--Hoyle, Penrose, etc.
   (2) Biological machines--Dawkins, Alberts, Denton, Behe
   (3) Universal Moral Code--C.S. Lewis in Mere Christianity
   (4) Laws of Relativity--Show plausibility of Biblical Theism claims


Dave dave dave, Didn't you read my story? Father sky molded a piece of light into the universe. Believe me when I tell you.

Mother Earth molded life out of her body.

The moral code we have now is a combination of Yin and Yang. Hamans and Oomans. Jeeze. Can't you read either?

Pop Quiz: Why do humans look out to the sea Dave?

Relativity? Relative to the dark room of night, that's what.
Man they make dumber and dumber religions all the time. Where do you get your info? Wherever it is, it's a bad source.

Date: 2006/05/30 10:55:01, Link
Author: BWE
Quote (beervolcano @ May 29 2006,12:36)
Fractatious,

Just link directly to the article. If someone has an institutional subscription, then they'll see it. If not, they'll be prompted to give their password anyway.

BWE,

I think there is a possibility of their leaving some stuff out.
My experience with computer modelling is more of the DFT, molecular mechanics, and Gaussian type ab initio stuff. In most of these cases it's garbage in-garbage out. What comes out is very dependent on what goes in. It can either be very accurate or very inaccurate. And when there's nothing experimental to check by, then you really don't know what you've got.

It's getting better, though.

Can I ask you if you know whether these ozone models predict utter catastrophe?

I don't know what they predict if CFC use had continued to grow. But, my curiosity piqued, I emailed a guy I know in New Zealand who works for the Environment Ministry who (I thought) deals with ozone specifically. Turns out he deals with UV indexes but he did, well, I'll just paste in a bit of his email:
Quote


...and they are probably a 21 year old physics student with a bone to pick...
The models for stratosperic ozone concentrations...
give us the essentially the same data as our satellites... Basically, they always have...

the abstracts, but you could find a good summary of that early science HERE.
[ http://www.ciesin.org/docs/011-466/011-466.html ]

and it's no joke. The sunburns are surreal.



And I went to the site and found a good resource too:the main ozone page.

It honestly never occurred to me that the science might be weak. I suspect now that it isn't. Nothing is ever certain but this seems close enough to use certainty as a working principle. I probably won't do any advanced research though so, I am of no further use in the material part of this investigation. You might be able to get some lighthearted quips from me though. We'll see.

Date: 2006/05/30 19:14:09, Link
Author: BWE
Ericmurphy,

You are being far far far more accomodating than this guy deserves. You gave him a shot. He missed. Now you get to hurl insults the way his god hurls thunderbolts or rewards human sacrifice. So hurl away buddy, it's all good fun now.

God Dog Odg Ogd Dgo Gdo dam mad dog god. Read a few of the posts on my blog. It might lighten your mood.

http://Brainwashedgod.blogspot.com

It helps me anyway.

Date: 2006/05/31 04:43:24, Link
Author: BWE
I would just like to point out that, as soon as I discovered what he was about, er, my first post, I immediately made sport of him:  
Quote
Posted: May 17 2006,10:36  
Well well well. The time has come.

Dave, you are an idiot. Your vacant mind is incapable of synthesizing information into understanding.

I sincerely hope that your children do not end up as misguided as you. Not for them but for me.

Your head is crammed securely up your ass and you have nothing valuable to say. Your god is a pathetic little provincial bigman who can't even say boo to my god because my god is so much stronger and braver than your god. And my god makes better things than your god.

Also, I can run faster, jump higher and screw better than you can.

Your friends don't really like you; they are just pretending.

:)

I for one, got some small amount of perverse pleasure out of him. I wrote a poem or two, a childrens' short story, worked up some pretty good random insults and learned a thing or three about languages, (unfortunately not portuguese which I am interested in a little-maybe a new thread someday?)

You can learn something by reading the thread called "anatomy of a creo argument" or something like that. I cut and pasted all his responses from one of his threads so you can look at them in a linnear fashion. They make more sense that way. Relatively speaking. It gives you some perspective anyway. (it is long but don't say you don't have time to read it, your posts take longer to write)
[Anatomy thread here]

The thing is, he can't be taught and he doesn't earn respect so he is fair game. See here.

Date: 2006/05/31 04:50:26, Link
Author: BWE
Fractacious,

Have you been there? I had to take quite a bit of the email out since it was of a personal nature. (He was talking about nude beaches:) ). Can you really burn badly in 15 minutes on a high UV day? Is that consistent with your experience?

Ouch. I'll make sure to bring my sunscreen. I've been trying to make a work trip out of NZ for the last 5 years but so far, no luck. It could happen though.

Date: 2006/05/31 04:59:41, Link
Author: BWE
The jury is still out on the relative merits of the existence and dissappearance of transitional forms in the fossil record. How could it be otherwise? The nomenclatural rules preclude and concrete conclusions.

You are so closed minded.

Date: 2006/05/31 05:27:25, Link
Author: BWE
Quote
Bill Carter said...

   THat is a good point Larry, do I exist? Yes you Do! No I don't. I can read what you are typing so I know you are real. You have a beautiful mind Larry, but you need help. Help? #### you, I'll give you help you #######. Go ahead Larry, hit me. Fight with me. How does it feel Larry? Does it hurt to hit me? Where does it hurt? Right where you hit me? Oh.

   Go to ####, I fell and bumped myself there. Now quit tormenting me. Leave me alone. How can you laugh when Judge Jones is a hypocrite? How can you mock me? #### you, #### you #### you.
   Sunday, May 28, 2006 5:05:54 PM


On the Ed brayton shennanigans thread

Date: 2006/05/31 09:46:35, Link
Author: BWE
See, now that's why it's fun. Right there.

[Applause]......

[/applause]

Date: 2006/05/31 15:24:15, Link
Author: BWE
This from a link off that page:

During a 20-day cruise last month, researchers used trawling nets and scuba divers to explore down to 3 miles beneath the ocean surface. Previous studies of small ocean creatures focused only on the top half-mile or so.

Now that, says I, is a bad assed scuba diver.
Mr IckyIchthyes? Could you do it?


link ;)

Date: 2006/05/31 15:31:05, Link
Author: BWE
mammon dna

Don't quit skeptic. I'm with you all the way. Whatever I can offewr I will.

Date: 2006/05/31 18:36:20, Link
Author: BWE
Ghost,
Sonofabitch. Your math doesn't work for me. I tried to figure out how to calculate an orbit or tidal force and you lost me. But that isn't what I am writing to say here.

What I am writing to say here is that I just did a web search of places you've posted and I've got to say, there are one or two places you've slipped up (just a little) but you've got me beat hands down. You would be surprised I think, to know the face behind some of these masks. I know I would be surprised to know yours. Now I know why. Fun, fun, fun. And you get to keep on drivin' the T-bird.

Good luck and may the force be with you.

I really want to see your scale free hub thing next. Try to skip some of the math though. Just, well, it's your show. Do what feels good.

Peace out.

Date: 2006/06/05 19:32:06, Link
Author: BWE
Every single engineer I know (maybe 10?) likes to argue. Alot. They make an off the cuff statement that turns out not to be right but they, to a man, will just claim it as fact and get angry.

Don't know if that helps.

Date: 2006/06/05 21:54:26, Link
Author: BWE
But eventually you get tired. You have to have a string of Colberts and Lettermans and whatnot to keep the fire hot.

I have to admit, AFDave outlasted me. It's just boring now. Maybe I'm getting soft? Who knows. Skeptic was entertaining but I just ran out of things to say.  ???

Date: 2006/06/06 15:46:23, Link
Author: BWE
Thordaddy, I had a change of heart. I'm your brother in arms now.

Yee Haw! Ride 'em cowboy! Da da dum da da dum da da da dah dum.

Science my hooey. Butter up, Fill 'er up. And you'd look sweet upon the seat of a bicycle built for two !!!
:O  :p  ;)  ???  :D  :(  :)  :angry:  :D :O  :O

Date: 2006/06/06 15:48:54, Link
Author: BWE
Bottoms up  ;)

Date: 2006/06/06 15:55:46, Link
Author: BWE
Arrrgghh. Rum. forgot one.

Date: 2006/06/06 16:49:35, Link
Author: BWE
I am agnostic in terms of god-in the apatheistic sense ;)  . But I had to vote buddist. Um, I guess because I am buddist to some degree. But you are aware that has next to nothing to do with god, right?

Date: 2006/06/06 17:09:03, Link
Author: BWE
Quote
rapier wit

um. yeah. you're right. I'll be back.

Date: 2006/06/07 17:02:03, Link
Author: BWE
found it. this from larry's blog:
Quote
The Ghost of Paley said...

   Hi. Just wanted to say that I've been posting on P's Thumb for a while and have not experienced any attempts at censorship. This is despite the fact that I've argued scientific and political positions that conflict with the P.T. world view. In my opinion, P's Thumb gave you plenty of freedom to state your case....and you abused that freedom. You flooded many threads with extremely long, repetitive posts; you posted under multiple identities in clear violation of the board rules; and you even attempted to sabotage some threads. Every blog has a right to set its own rules and Wes's actions were reasonable. Larry, as a Holocaust denier you should know the precarious state that liberty's in....why try to trash up a blog that gives both sides a hearing? If you feel that you're being suppressed, go after the governments and bullies that actually threaten our right to free speech. Picking on Wes is stupid, immoral, and counterproductive.
   Wednesday, May 10, 2006 4:09:30 PM


I suppose he got his name from this page near the bottom.but I'm not sure why I am blowing his cover. Maybe I'm wrong. Who knows?

Date: 2006/06/09 11:18:50, Link
Author: BWE
The Government already does do a significant amount of science. It has to to be able to make good policy. We can't allocate BLM or Forest service land without EIS's. Same with fishing treaties and policy, military concerns, economics, weather forcasting, you name it.

If you mean a subset including things like how to make human-animal hybrids, or maybe how to design zombie mind control drugs, that's what tv is. Or rather, does.

What about thin film Photovoltaic research? Should the gov't sponsor? Only if we value modern society :) (so now my politics come out)

Date: 2006/06/11 11:36:24, Link
Author: BWE
You gotta admit, he has gotten some interesting feedback.

Date: 2006/06/12 06:40:55, Link
Author: BWE
Quote (afdave @ June 12 2006,10:53)
Faid...  
Quote
Let's all agree that, when you said "Portuguese did not exist untill some french knights had an influence on Spanish", you actually meant "Portuguese existed all right, but it was somewhat influenced from Spanish in the middle Ages, and also from French sometime- maybe the 18th Century". Then we can all be happy.
Tell you what- let's call it a draw.
No.  No way.  We don't agree and that's not what I meant and I won't call it a draw.

I meant exactly what I said ... It is an accurate GENERALIZATION to say that 'Portuguese is a mixture of Spanish and French'

End of story.

And yes, you are being trollish.  How do you say 'troll' in Greek?

Davey. That is not what you said at all. You made a bet that you could prove it. I accepted. you quickly retreated and started saying you won-without the debate. I guess that since you wouldn't even debate, I actually won.

If the bet is still on then we need to have the debate. And you didn't say generalization but I am willing to go with that. So, if you have finally decided to have that debate, I'll start a t5hread on my blog, you can do it on your blog, we can do it here or wherever you want. But you can't declare victory without having the duel. Bad form. Especially for a missionary's son.

Date: 2006/06/12 07:33:42, Link
Author: BWE
Davey, why do you ignore the point that I accepted your bet and you never paid up?

Or do you still think that you could win?

Date: 2006/06/12 10:23:02, Link
Author: BWE
Hi Davey, I see you logged in. Does that last comment mean you are taking up your bet?

Date: 2006/06/12 18:22:54, Link
Author: BWE
Dave,

It occurred to me that maybe you are unaware of the level at which you are not being respected. Let me help,

You have not yet produced 1 single argument. Not 1. You offered to bet anyone some fantastical thing if they could prove you wrong. I took the bet and you declared victory before a single sentence had been written. So I conclude that, since ytou were unable to even respond to the fact that I accepted your bet, that I won.

But I will up the ante.

I will bet you (the same terms, winner gets to make a post on the others' blog) that I can prove you wrong in a one on one debate on any topic at all relating to a young earth hypothesis.

Either you can, or you can't, back up what you say. You have been able to dilute your message through a variety of posters but we both know that you are really just afraid of your homo-erotic satanic fantasies.

So, Davey dickhead, if you refuse this challenge, you will be admitting your ignorance. Take it or leave.

Date: 2006/06/13 08:43:17, Link
Author: BWE
Hi Davey,

I see you are ignoring me still. You know you can't claim victory in the portuguese thing until you debate it with me. I took your bet and you never ponied up.

Also,

Want to have a one on one debate over the age of the earth?

I will present an argument and list my evidence. You can  present your evidence after or first. Makes no difference to me. Then we will address each post one at a time and establish a clear position. I really would change my mind if you presented any evidence that could challenge the evidence I am aware of.

Just to give you a heads up, my argument would hinge on techtonics, speed of light, and the fossil record.

I know you have touched on two of these but I think in a one on one you won't do so well.

Are you chicken?

Like I said, if you can demontrate that the earth is likely less than 4 billion years old, I will go to a service at the church of your choice. And do my best to convert.

What an opportunity Davey. A chance to convert me.

How bout it?

Date: 2006/06/13 08:51:25, Link
Author: BWE
Davey???

Date: 2006/06/13 11:06:47, Link
Author: BWE
Quote (incorygible @ June 13 2006,15:41)
Dave, that you imply (then amusingly deny) a conspiracy amongst scientists (not to mention ATBC forum-goers) reveals that you have given very little thought to where people stand on things and why they stand there.

You view this as a war, wherein you are the sword and shield of God, and we are either the assembled host of the devil (or at the least the guerilla fighters of a fallen world).  Have you not noticed that you are tilting at windmills?

One has only to look at your laughable summaries to see your ridiculous ideas are, in fact, being attacked on all sides, but that does not a war make, Dave.  Instead, if you could step back for a second, you would see that you have launched your assault, not on a collective enemy, but on myriad separate fields of knowledge.  The reason you don't hit any real target, but claim to have landed every shot, is that you have made everything a target. You don't see that you are in a forum where you don't get to make up the rules of logic and evidence.  You don't see that you are arguing against a very diverse group, each member of which has an individual field of expertise that can easily and singlehandedly dispatch your young-earth, anti-evolution 'arguments' in any rational, open mind.

The war is in your head, Dave.  There is no conspiracy.  Nothing resembling lock-step.  You scream at the top of your lungs (or at least in excessive boldface and caps-lock), "The truth is X, and the Bible tells us so!"  Your shouts are subsequently met by a thousand puzzled or annoyed or indifferent or mirthful glances, and a resounding reply of, "Eh?  Not from where I'm standing!"

Have you considered where each of us is actually standing, Dave?  I myself am standing perhaps right at the heart of your windmill, doing research in evolutionary biology (i.e., I can "stick to biology"; it's far more than enough).  You've identified others standing elsewhere, with expertise in geology, physics, cosmology, radiometric dating, paleontology, genetics, medicine, linguistics, psychology, anthropology...  And let's not forget, most recently, PuckSR, standing in close to the same place you are (i.e., the revealed truth of the Bible), also replied in kind: not from where we're standing, Dave. Yes, we're practically everywhere.  In your delusional mind, that probably sounds insidious.  It's not.

Meanwhile, you and the sources you cite are invariably standing in the exact same unenviable place, making the exact same arguments with the exact same motives.  We've heard 'em before, and even when we answer in unison, it's from a million different voices in a million different places.  No conspiracy neccessary.

Obviously, someone is standing in the wrong place, and it's pretty easy to see who -- they're all piled on top of each other in a singularity of ignorance, arrogance and dishonesty, vainly trying to deny the validity (or very existence) of any position but their own.

Beautiful. Well said indeed. It's funny, I am willing to step well outside of my expertise to debate davey because they are simpler arguments and thus easier to understand. I would like to draw a phylogenic tree and explain it but I think it is just too much for poor Davey. Being an engineer *snigger* I figured we could stick to basically physical concepts.

But you are right of course. Any individual discipline crushes and then sweeps up every single thing he believes about god.

It must be terrifying to realize that you have based your very existence on a fabulous lie.

Date: 2006/06/15 11:50:43, Link
Author: BWE
Quote
It just seems to me (correct me if I'm wrong), that the first line of attack is "no scientist doubts the ToE", and if a scientist is brought forward who may have won a Nobel prize, or even just be a degreed and qualified researcher, you say "okay, no LEGITIMATE scientist doubts the ToE".  Instead of a debate, it's a smear.  You "win" the debate simply by tarring the opponent personally and everything they've ever done.  


The reason that it seems that way is because of the way evidence and experiments work. Let's frame it in terms of religion: A christian says "you have to believe in god". "The bible says our god is the right god so that is why you should believe."

There is not one good argument that goes beyond that. I have read augustine, aquinas, pascal, and etc. and they all, with out one single exception, begin their arguments/treatises with the assumption that the bible is accurate to some degree.

Buddists claim that there is a spiritual experience that their methods can help you achieve. They ask you to perform the experiment yourself. In fact, they even go so far as to say that you can't get it without that.

That is overly simplified I know. Christians might claim spiritual experiences too but they attribute them to god with zero evidence. Buddist make claims of reincarnation which is entirely untestable. But, in the overview, Buddist thought makes verifiable claims and christian thought makes unverifiable claims.

When a scientist makes a claim, it is definitionally verifiable. When scientist B performs the experiment and gets different results, the experiment has at least cast doubt on the original assertion.

More scientists will then try to reproduce the original or the secondary results until there is enough data to make a new claim or to prove/ disprove the original claim.

So, if someone walks in and says "It ain't so". A lot of people ask why. If that person cant put up, they lose credibility.

With no exceptions to date, the idea that evolution is the mechanism for speciation and that the mechanism for evolution is some combination of random mutation and natural selection has not been challenged succsessfully.

And to top it off, most of the challengers who step outside the normal channels of peer revue make asses of themselves and get caught lying/fabricating/obfuscating/indoctrinating. I challenge you to find even one peer revued study that attempts to demonstrate that evolution is not the mechanism for speciation that hasn't been thoroughly discredited for bad science/deliberate falsehood/bad design of experiment.

I could save you time and let you know that you won't find any but please, if such a thing escaped my notice (and the notice of the editors of every news outlet in the world- it would be front page stuff you know) I would be very interested to see it.

I was fortunate enough not to have been dealt the vicious hand of religion when I was a child so I don't have to overcome the wasting damage it inflicts on so many. If you follow the evidence without preconcieved notions it is a lot easier to allow that your understanding of science is only as good as the best science available. It might need to change.

You see, if we found a rabbit in the precambrian strata or if god came down and performed some real kind of miracle that we could see, I at least, and I suspect most of the folks who post here would immediately assimilate the new data into their understanding of whatever. But ALL of the evidence points the other way. We keep trying new things and it keeps pointing the same way. ALWAYS. That is a word you should never use, right? But so far...

Date: 2006/06/16 07:31:02, Link
Author: BWE
You guys should really read my blog. This is all old news.

One guy who talked to god

jesus talks :)

Date: 2006/06/16 09:49:45, Link
Author: BWE
Aargh. There is a study that I used in college, (quite a ways back-mid 80's?) that compared some core samples from north sea sediments to core samples from the indian ocean. There was a layer of volcanic ash at 20ish m years old that they were using to figure out C14 contamination sources. The article is probably out of date but the methodology was fantastic. It explained the concept of verifying dating techniques really well. It also did a good job of illustrating the scientific method since they were working on methodology rather than trying to figure whether the earth was really 4.5 b years old or 6000 or whatever.

I can't find it. Does anyone know what I am thinking of? Maybe I have the subject wrong or something.

Date: 2006/06/16 10:09:20, Link
Author: BWE
Darn Dave,

Maybe that is a good point. What you aren't getting is how much c14 you are measuring. At 10,000 years the original carbon has lost x amount maybe 3 or 4 half lives. Beyond 50k years, you are measuring such a small quantity that a very small contaminant can dramatically skew the results. That same small contaminant, while it may skew the results at 10000 years, skews it a very small amount. So it might throw it off by 1-5000 years. That same amount at 100,000 years might throw it off by 100,000 years. Does that make sense?

Here's a little analogy:

Fold a piece of ordinary notebook paper in half. 1 square centimeter is x percent of your surface area. Does 1 sq. cm affect your total by alot? Could you still be generally accurate +- that 1 sq cm? Now fold your half sheet in half. Same test. That 1 sq. cm is a little more substantial. By the way, it really does help to actually fold a piece of paper.

Now, fold it in half as many times as you can and count the number of folds. Should be 7 or 8. That is the paper's half life.  :)  Now, how much in percent does your one sq. cm throw off your surface area estimation?

Date: 2006/06/16 10:14:58, Link
Author: BWE
That is certainly my motivation.

Date: 2006/06/17 17:38:26, Link
Author: BWE
Davey, I used to be one of your favorites. WHat happened?

You just aren't allowed to say anything about the portuguese / french thing till you debate me on the topic. I took your bet and you never paid up.

People,

Can I get a little help here? Did I not take his bet? Did he not make the bet? Did he not utterly ignore the fact that I took the bet? Did he not declare victory without the debate?

Please, post this at the end of future posts:

Quote
Dave, you are aware that you never debated BWE even though you made a bet, he took the bet and we all witnessed it. Right? You are claiming victory in a debate you never had. You made a bet and then failed to live up to your end.

Date: 2006/06/17 19:01:50, Link
Author: BWE
Quote

Quote
Dave, you are aware that you never debated BWE even though you made a bet, he took the bet and we all witnessed it. Right? You are claiming victory in a debate you never had. You made a bet and then failed to live up to your end.


Please don't forget.

Date: 2006/06/18 08:58:45, Link
Author: BWE
The sad thing is Dave is not even close to the first person to arrive at any of his ideas. He is the older kid from the Squid and The Whale.

Davey, what's wrong, am I scaring you? Did you get my folding paper analogy to C14?

Moron.

Date: 2006/06/18 09:11:59, Link
Author: BWE
Davey,

You made a bet that you could prove portuguese is a mixture of Spanish and french.

I took your bet. This is the place for you to put up or just let me write a post on your blog.

I will attempt to show you why, not just that you are wrong. but that your statement was stupid and wrong thinking.

Ball's in your court. :)

Date: 2006/06/18 11:30:38, Link
Author: BWE
afdave
Quote
Posted: May 18 2006,22:21    

...Yes.  I knew about the planet thing.  I actually speak quite a bit of Spanish and Portuguese (which of course is Spanish and French mixed).

afdave
Quote
Here's the specific statement that I am defending:

1)  AF Dave says that Spanish and Portuguese were essentially the same language until 1143 AD when Portugal broke away from Spanish control under a French nobleman by the name of Henry of Burgundy.  From this point on, the languages diverged into the modern situation.  The primary influence on the linguistic divergence was the French language.

2)  Rilke and Toejam say I am wrong

How much are you willing to bet?  



afdave  
Quote

Posted: May 19 2006,08:37  
Rilke--

You keep saying I'm wrong, but you haven't put your money where your mouth is.  Just tell me how much money it's going to be ...

$500 says I can prove my statement (my later, more specific statement).  Are you willing to put up $500 and prove me wrong?

You know the wager ... it's as clear as a bell ...

Now are you going to back up your claim?  Or are you going to retract it and apologize?  Or shall I embarrass you publicly in front of all your friends?

Your choice, sweetie.

BWE  
Quote

Posted: May 19 2006,14:22  
Davey-dog. You are an idiot. Define Spanish. Be careful, that's a trick question. Next Define spanish around the time of song of roland.  

I'll take your bet. But the stakes are different. If I win, I get to write a post on your blog, if you win, you get to write a post for my blog. and one more thing, please answer some age of the earth questions.


Just because I think you are stupid, I am not going to do any preliminary research.

And I am making some assumptions about your claim:

1) the portuguese language substantially changed beginning in the year 1143.

2) The Spanish you are referring to is Castilian

3) The french language and the Castillian language are the major components of modern Portuguese.

4) the dialect of Portuguese you are referring to is the one spoken in Lisbon.

5) That you are making an all or nothing claim similar to  your others (there are no gray areas)
link

Date: 2006/06/18 17:23:37, Link
Author: BWE
Davey, follow this link. :)

Date: 2006/06/18 18:32:39, Link
Author: BWE
As in apache, navajo, comanche et al?

I missed that one. I'm not doing as much reading as I could.

I would love to see his evidence. I am 1/8 Nez Perce (Idaho tribe) and that side of my family takes their history pretty seriously. Apparently we Nez Perce built a pretty complicated culture off a plains style rulebook. Hearing my grandpa talking about it you would think they invented the wheel or thew shovel or something. He's dead now but this would vindicate a lot of the things he said.

Date: 2006/06/18 18:52:08, Link
Author: BWE
Davey, read this :)

Date: 2006/06/18 19:15:08, Link
Author: BWE
Davey,
We've all been too hard on you. read this. You'll feel better.

Date: 2006/06/19 05:40:12, Link
Author: BWE
Davey,

I do appologize for my last comment on your blog: "When you are having gay sex with goats do you think about heaven?"

I figured you would delete it but I thought it might get you to start the conversation back up. Founders? Remember? You had given up after asking that I buy a book. I did buy it remember?

Anyway, I hope we can put that messy episode behind us. We are all friends here, right?

Oh yeah, this link is helpful. You should follow it Dave.

Date: 2006/06/19 06:00:13, Link
Author: BWE
I've been trying to spin this into comedy for a few days now but I just can't seem to do it. Maybe the issue is too close to me to see it objectively.

People who think that environmental concerns are not important or that they are being spun by scientists with a political agenda- all the religion hoppers claiming that we are an evil conspiracy to destroy religion for example- are ignorant of facts.

Our fisheries the world accross are not being harvested sustainably. The words "fisheries collapse" doesn't mean much to most people. We assume that systems simply dwindle and then recover when some new technology comes along. Hint- that isn't the case.

My buddist republican uncle once said to me, "When the midwest gets too salinated, we'll just genetically engineer salt resistant crops."

It isn't stupidity, it is lack of information. When you start to look at the earth from a systems point of view, it can be pretty scary. Then we go and issue some dire warning. With Rachel Carson, it worked. But only because she was thinking small. And because there wasn't an industrial spin machine to work against.

Now a days, it's a different story. S. Hawking just got one of those chilly shivers that occasionally makes us tell our bosses that we maybe shouldn't be doing this thing right here that has such a bad potential etc. The spin machine didn't take hold because he didn't tell us not to drill in the ANWR or drive suv's or eat McDonalds etc.

Date: 2006/06/19 08:23:38, Link
Author: BWE
Quote
You bought the book!  Excellent!  Did you like it?


It takes a very ignorant person to read it without either laughing or crying.

Oh, by the way Davey, There was a glaring ommision in your last post:more detail here. :)

Date: 2006/06/19 08:52:58, Link
Author: BWE
You shouldn't have to wait on the Potuguese bit, I set up a thread for it. Dave made a bet and I took it. link here

We know that Davey isn't a welcher so I'm sure he'll get over there to have that discussion. He has yet to address his claim in terms of his bet. I wouldn't be too hard on him for it. He has had a tough time refuting all the other things he's brought up. Now that he has time to focus in on the one thing, I'm sure he will.

Date: 2006/06/19 09:08:24, Link
Author: BWE
I haven't even presented my counter-argument. What's that tell ya?

Davey, if you're ready, I set up a thread for it here.

Thanks

Date: 2006/06/19 10:08:32, Link
Author: BWE
Come come now. To be fair, Davey hasn't yet had a debate either. I set up a thread for it here.
Let's wait and see how he does. I am not an expert on the subject either so it seems like he might have a chance. How can we know until he tries?

Once again Davey, the link is right here. Please, the ball is in your court now. It is time to get these people off your back and prove your immense understanding. :)

Date: 2006/06/19 11:53:24, Link
Author: BWE
That is because gOD is outside of time. :D

Date: 2006/06/19 12:11:56, Link
Author: BWE
Is this excedrin research?

Date: 2006/06/19 13:00:05, Link
Author: BWE
A non-sequiter seems totally in order on this thread.

Date: 2006/06/19 17:08:30, Link
Author: BWE
Hi Dave, I see you are logged into the board! Hey, check this out.!

Date: 2006/06/19 17:37:54, Link
Author: BWE
I got one: Is it ok to screw goats? (If you're a person).

Between Davey and T-diddy, my head is spinning.

Date: 2006/06/19 17:48:18, Link
Author: BWE
List some critical environmental concerns that could reduce Earth's carrying capacity:

Desertification
Salinization
Deforestation
Fisheries Collapse
Peak Oil
Global Warming
Meteor strike
War
Intense pollution (Chernobyl/ Parts of China etc.)

With the exception (albeit a mild exception) of global warming, the science on these topics is rock solid. These are the stuff of nightmares. Each individually has the potential to decimate the human population of Earth. And soon. Hawking was expressing a concern that many people who are aware of the science feel. We are badly abusing our collective body.

Ignorance is bliss.

Date: 2006/06/19 17:51:09, Link
Author: BWE
Oh gOD, assume the worst- of course.

Date: 2006/06/19 18:17:28, Link
Author: BWE
Danm RG,

That one's good. Oh yeah, Davey, did you follow that link? Here it is again. You were going to debate me on the Portuguese thing, remember? The bet you made? The one I took? The one you aren't paying up on?

Date: 2006/06/19 19:00:32, Link
Author: BWE
Yeah, Then what happened Davey? Oh, by the way, you bet me that you could prove your Portuguese thing. I accepted. Are you forfeiting? Should I start writing my post for your blog? If you can't find the thread I started, the link is here. Thanks, :)

Date: 2006/06/19 20:13:10, Link
Author: BWE
Or for that matter do you even have a clue what the carbon cycle is and why scientists don't debate it?

Oh yeah, just a reminder about the Portuguese bet you made. I know it's easy to forget and all so I am posting the
link again. just in case you lost it.

Cheers.
P.S. Global warming is sort of wrapped up with the Carbon cycle. But, since Stupid christianity- the kind that requires adherents to be stupid, like yours ferinstance- fights anything that data suggests, you probably don't worry too much about global warming eh?

Date: 2006/06/19 20:27:21, Link
Author: BWE

https://www.hantover.com/datasurge/img/images/10300.jpg

This is two views of hardware that gets put in nearly every cow you eat. It is the Shermer ME Captive Bolt stunner and it uses a .22 cap to force a metal rod directly into the brain of the cow before they wrap a chain around it's hind leg, hoist it up onto a rail (still alive, mooing and kicking often enough), roll it over a "Blood Pit", slice the neck skin from the throat to the brisket, reach way up (the cow is upside down) inside to cut the jugular so all the blood runs down into the "Blood Pit" (and consequently all over the guy who does the poking, the "Sticker") All before it is 1st legged with the udder removed, second legged and bunged, sided, hide pulled, de headed, gutted, split, washed and refrigerated.

Is god a vegetarian?

Date: 2006/06/19 20:50:39, Link
Author: BWE
Quote (TangoJuliett @ June 17 2006,13:47)
Skeptic:
 
Quote
Innovation in science is driven by ideas followed by research but the current environment does not allow progress in this area.  How can any scientist with any ambition or thoughts of professional success stray beyond the dogma.

Here is a link to an article about a scientist who overturned the prevailing scientific 'dogma' in regards to neurogenesis.

http://tinyurl.com/zgvmt

Did she do it by whining and complaining on a public forum?  No.
Did she do it by advocating that the controversy be taught in public schools?  No.
It took about 10 years, but she did it through research and the development and publication of relevant objective evidence.

Go figure...

Goddamnit. That is about the coolest tthing I've seen all week. Is she just all the he11 over the place in science news, scientific American and stuff? OT a little,
Herbert J. Gans “Positive Functions of the Undeserving Poor”
An essay I use in a class I assemble for PSU summer terms provides a sociological parallel. Anybody read it?

And Skeptic,

I have always been on your side. With comments like
Quote
Now, I'm not a scientist like you but I can see the level of merit in your argument. And like you, I'd just like to get them to open their minds and figure out a way to handle guys like you. If they had an effective way of communicating with guys like you then maybe something could happen.
and
Quote
Skeptic,

You are absolutely on track. These guys are all working off the "law" of Evolution much the same way physicists worked off the "Law" of gravity. If only they would just wake up and realize that there is a frameshift in understanding just over the event horizon they would be searching in 5 or more dimentians to find the causes of genetic degenetic-generation and malthusian saltation occurences instead of claiming that random mutation and selective pressure exerted by changing ecosystems, competition for resources and isolated niches with available food and places to raise young in relative safety are mechanisms that can generate upward genetic mobility and  a stratified genetically and specieally grouped biosphere that owes nothing to interactions with non-euclidean and euclidian universes that might intersect in non-dimentional singularities with the specific genomic anomalies exhibited by the various kingdoms and phylums and even down to the species level and below that only lose functionality rather than incorporate new variations and increased genetic information that is implied and implicated by neo-darwinian mysticism and neo-darwinists refusal to think outside of that particular box.

on your side, it was your race to lose. I tried to help but you just couldn't hold the tiger's tail and you got ate. Sorry, but you couldn't have asked for more support from me.

Date: 2006/06/19 22:32:00, Link
Author: BWE
My guess is that it's the same problem I'm having. :)

Just can't figure out the angle I suppose. The trick is that they most certainly have. That's what makes it work.

Date: 2006/06/20 10:07:06, Link
Author: BWE
Quote
QUESTIONS & ANSWERS

BWE ... I already won the Portuguese thing.  Have you been snoozing all this time?  Rilke never paid me though.  Maybe you could pay up for her?  Actually ... never mind ... keep your money.  I don't want to give you my Paypal info.  You'd probably do something dastardly with it.


Um. Davey,

Maybe I was sleeping. Because I don't remember even saying word one about it. I was waiting until you made a formal announcement. Did you present all of your evidence? Because if you did, I can put up a good counter-argument that might do you in.

Maybe the other kind people here can help refresh our memories,

Did I ever debate Davey on the Portuguese thing? I forgot.

Dave,  I made a thread for the debate: the link is here.

If you'd rather debate something else, perhaps plate techtonics, I'd be happy to  do that for the same stakes. My point was and is that you are too dumb to debate that the sky is blue let alone the evolution of the Portuguese language.

It's not that I even think you are wrong. It's just that I think that you don't know how to support any argument. If you'd like to reverse sides and have me argue for the French/ portuguese connection I'd be willing.

But Dave, you can't claim victory. You haven't had the debate. Unless I am being forgetful I don't think I have made any counter claims yet. I set up a thread for it. Link here.

I C&P'd the wager and the statement you'd be defending. See if I missed the mark somewhere. I don't mind being wrong. (I'm not a christian you know)  :)

Date: 2006/06/20 10:11:03, Link
Author: BWE
Did you ever read "When worlds collide" by Phillip Wylie?

Who gets to go is an interesting question.

Date: 2006/06/20 10:23:26, Link
Author: BWE
Quote
'Cept in my model the antibonding orbitals are not filled because the probability density is too low. So the antibonding orbitals do not exist in 3D space, as I'll explain later.


So, sorry to butt in here because this thread is one of my favorites and I hate to clutter it but something has me confused. First let me note that my understanding of particle physics is extraordinarily limited. But Ghost, wouldn't the supercollider research being done at Cern and, I suppose other places, demontrate, by deconstructing atoms that your model wouldn't work? It seems to me like you are making claims about particles and their natures that sort of challenge the work being done. Am I way off? Frinstance, what is being measured when we create antiparticles?

Date: 2006/06/20 13:35:29, Link
Author: BWE
Faid,

Respectfully, I think that Dave is simply unaware that he hasn't yet debated me on the topic. I'm sure that once he notices my posts, he will take up the challenge immediately.

He can follow this link to begin whenever he gets a chance.

Dave, I am right about you aren't I? It was an oversight wasn't it?

Date: 2006/06/21 06:07:24, Link
Author: BWE
Quote
Why don't you ask your library to subscribe to AIG-TJ and CSRQ?  Most mainstream journals are predjudiced against the creationist view in case you had not noticed. ...
because Creationists are stupid down to their C14 and have not done any research.

Quote
BTW ... I still don't understand why you just believe all those books you read that say the gorillas diverged at 8mya and chimps and humans diverged at 5mya.  Do you accept that with no justification from the books?  Did my silly story about going to Carrabba's help you understand why it seems so foolish to me for you guys to say that humans and chimps are closer than chimps and gorillas?
I'm surprised no one else jumped on this on this one davey. Man, you are really, really stupid.

Quote
Thus, how can he be "bigger" than galaxies?...

Quote

Bigger in the sense that a painter is "bigger" than his painting.  It is fascinating to me that most of you cannot grasp the idea of God fashioning his universe as a sculptor might fashion a sculpture or a painter might paint a painting.  
It is just as fascinating to me that you can. I'm doing it now oooooooohhhhhhhhmmmmmm..... I'm channeling a little midieval (the good old days) sculptor, his tongue out just a we bit, curled almost imperceptably over his top lip in concentration.

Date: 2006/06/21 09:02:36, Link
Author: BWE
Oh good, Dave, you are reading my posts. I was afraid they weren't showing up for you. Hey, are you ever going to have that debate about portuguese with me? I set up a thread for it. link here.

Or, if you'd rather just concede, I'll get busy writing that post for your blog.

Thanks so much. :)

Date: 2006/06/21 17:53:36, Link
Author: BWE
Quote (BWE @ June 21 2006,14:02)
Oh good, Dave, you are reading my posts. I was afraid they weren't showing up for you. Hey, are you ever going to have that debate about portuguese with me? I set up a thread for it. link here.

Or, if you'd rather just concede, I'll get busy writing that post for your blog.

Thanks so much. :)

Maybe they aren't showing up in you browser Dave.

Date: 2006/06/21 19:57:56, Link
Author: BWE
Because religion has great potential to be annoying and it eases the sting if we taunt them. We may have to deal with them in school boards, local politics, maybe even law firms, but we don't have to like them.

And, I assume I speak for many here, I think about it alot. I dunno why. I've read Old and new bibles, some of the koran and book of mormon, Lau Tsu, lots of stuff by Thich Nat Han, Dali Lama, lots of zen authors (And shopenhauer who was in the zen party without knowing it), and, western philosophers including some of the religious ones Augustine, Aquinas, Pascal, Luther (Well, he wasn't really a philosopher and I've only read a few translated pamphlets of his) etc. and along comes this guy who claims that we need to bow down before his provincial little god who sits at his potter's wheel, sculpting little figurines and contemplating his (He) emotional state at the moment. Not to toot my "wisdom" horn because it's all malarkey but my point is that reading gilgamesh and learning about the flint trade at Uruk ought to be enough to show them that neither they nor anyone else has a fuckin clue about god. But these poor bastards have too much invested to give up so they go out in the world to harass the rest of us with their ridiculous crap about some kind of knowledge of god when god isn't even a word that they can define in a way that means anything. I wouldn't mind if they would just shut up about it but they dont. They harass us at work, they pick fights with our kids over fuckin jesus, they make laws that inhibit others' will to be wierd, and they justify it with a crock of shit such as Davey Dickhead has been ladeling from. Here, we can listen to them politely and hear what they have to say and then expose it to the cold hard light of reality. Politely of course. And then, once they have proven their mettle at ignoring evidence, repeating lies and showing a tendency to want to dictate morals to others, we get to release all our pent up statements that we can't say to the local school board member because our kid's in school or the lawyer across the street because he is vindictive in the typical christian fashion or the maintenance worker who tries to tell you about fags or scumbags or worthless people while trying to hand you a fucking bible because he has your car apart already and you want him to put it together again. We get to say it all to folks like DaveyDickhead ® , knowing full well that his brain is already ruined from too many hits of blotter Jesus when he was a kid, but being nonetheless thankful for someone to embody the rest of the goddam christians/muslims/jews/hindus/ whatever that think that they know the right answer and that it came from their own personal god and that it should be law.

Wouldn't be a problem but his stupid fuckin god wants to make rules in the same world I live in. Sorry, the idea is stupid and you are a sucker. Don't drag me into it.

**edit
Quote (BWE @ June 21 2006,14:02)
Oh good, Dave, you are reading my posts. I was afraid they weren't showing up for you. Hey, are you ever going to have that debate about portuguese with me? I set up a thread for it. link here.

Or, if you'd rather just concede, I'll get busy writing that post for your blog.

Thanks so much. :)

Maybe they aren't showing up in you browser Dave.

Date: 2006/06/21 20:42:13, Link
Author: BWE


a favorite hike of mine on Mt. Hood. They call it Castle Rock.

Date: 2006/06/21 21:25:55, Link
Author: BWE
link here

Even though I am about to poke fun here, this is a cool article.
 
Quote
In competitive learning (also known as "Neural Darwinism"), the first presentation of an image activates many neurons, some strongly and a greater number only weakly.

With repetition of the image, the connections to the strongly activated neurons grow in strength. But the strongly activated neurons inhibit their weakly activated neighbors, causing a net reduction in activity. This reduction in activity, Biederman's research shows, parallels the decline in the pleasure felt during repeated viewing.
Like readings Davey's posts for too long. :)


**Edit** See Icthyic's post below.

Date: 2006/06/21 21:55:24, Link
Author: BWE
Dang, this is getting frustrating, I even offered to take the other position and let him have mine. Still nothing.

Davey Dickhead
Missed out on the Special Ed
That could have fixed his head

Cause he was stuck 'neath The Bong Bong Leaves
Pulling on his Reverend daddy's sleeves
Saying "When we take their stuff does it make us theives?"

His reverend daddy said:
Son they'd be better off dead
Than miss out on the lord's spread

So what we're giving in return is grace
Something in short supply in this godforsaken place
And when they see the color of the chief's new baby's face
We'll be gone son, without a trace.

Date: 2006/06/21 21:58:50, Link
Author: BWE
Well well well. I don't get out as much as I used to.

Funny we picked up on different parts.

Date: 2006/06/21 22:33:29, Link
Author: BWE
Quote (BWE @ June 21 2006,22:53)
Quote (BWE @ June 21 2006,14:02)
Oh good, Dave, you are reading my posts. I was afraid they weren't showing up for you. Hey, are you ever going to have that debate about portuguese with me? I set up a thread for it. link here.

Or, if you'd rather just concede, I'll get busy writing that post for your blog.

Thanks so much. :)

Maybe they aren't showing up in you browser Dave.

um, did i already say this?

You know I have offered to trade sides if you think your side is too weak. Did you catch that?

Davey, does it hurt?

Date: 2006/06/22 05:54:07, Link
Author: BWE
Quote (BWE @ June 22 2006,03:33)
Quote (BWE @ June 21 2006,22:53)
Quote (BWE @ June 21 2006,14:02)
Oh good, Dave, you are reading my posts. I was afraid they weren't showing up for you. Hey, are you ever going to have that debate about portuguese with me? I set up a thread for it. link here.

Or, if you'd rather just concede, I'll get busy writing that post for your blog.

Thanks so much. :)

Maybe they aren't showing up in you browser Dave.

um, did i already say this?

You know I have offered to trade sides if you think your side is too weak. Did you catch that?

Davey, does it hurt?

There are lots of ways to convert biomass to natural gas.
I was going to provide a link but I like making unsubstantiated claims.

Date: 2006/06/22 05:58:14, Link
Author: BWE
Sombody profits.

Date: 2006/06/22 06:08:43, Link
Author: BWE
DeadMan,
Northern California???

Date: 2006/06/22 06:19:20, Link
Author: BWE
Quote (BWE @ June 22 2006,10:54)
Quote (BWE @ June 22 2006,03:33)
 
Quote (BWE @ June 21 2006,22:53)
 
Quote (BWE @ June 21 2006,14:02)
Oh good, Dave, you are reading my posts. I was afraid they weren't showing up for you. Hey, are you ever going to have that debate about portuguese with me? I set up a thread for it. link here.

Or, if you'd rather just concede, I'll get busy writing that post for your blog.

Thanks so much. :)

Maybe they aren't showing up in you browser Dave.

um, did i already say this?

You know I have offered to trade sides if you think your side is too weak. Did you catch that?

Davey, does it hurt?

There are lots of ways to convert biomass to natural gas.
I was going to provide a link but I like making unsubstantiated claims.

that would be my point

Date: 2006/06/22 06:34:06, Link
Author: BWE
It is fascinating how important it is for them to keep their feet in their mouths[QUOTE]Quote (BWE @ June 21 2006,14:02)
Oh good, Dave, you are reading my posts. I was afraid they weren't showing up for you. Hey, are you ever going to have that debate about portuguese with me? I set up a thread for it.

Or, if you'd rather just concede, I'll get busy writing that post for your blog.

Thanks so much. :)

Date: 2006/06/22 07:02:44, Link
Author: BWE
Quote
They are looking for scientific sounding reasons to reject the Bible and set up their own morality and it helps to have some like minded people that affirm what they want to believe...
And I'm here to help em find those reasons you moronic half-wit.

[quote[... Part of it is science, but there is a very subtle thing going on here.  The subtle thing is that you have a lot of truth, but its mixed in with a lot of error concealed in sometimes inconspicuous places.  Combine this with a blindness which all humans are subject to when they want to believe something, and you have a very powerful deception.[/quote]

Oh the irony. Davey, you should read Sake and O Henry.  

Quote
Everyone is familiar with the 'Love is blind' concept.  Well this is the same way.  Skeptics can't stand those "goddam christians/muslims/jews/hindus/" and the feeling is so strong that, like the love-struck teenager, they cannot see the glaring errors in their theories.  


I wish to take umbrage with your use of the word skeptics. You seem to imply that there is a teensy-weensy ounce of validity to your stupid provincial god idea and I would like to be the first to point out that there isn't. While I am "skeptical" of your claims it is not because I am a "skeptic" it is because you are deluded.

When are you going to debate portuguese with me?

Imagine writing a post on my blog. oooo.

Date: 2006/06/22 07:31:32, Link
Author: BWE
Quote

That’s okay. They’ve already excised inconvenient verses from Leviticus. Why not move on and excise Genesis? The question is…at what point do they stop being ‘Christian’ and become something else?

Comment by rmagruder — June 22, 2006 @ 11:36 am


It's funny, when I was a kid, I thought I was a christian. Then I grew up and discovered that it meant that you believed in the christian god and all that. I guess that was the point at which I stopped being a christian.

Major problem having a History prof (Comparative religion) for a dad and a Botony prof for a mom. Talk about atheist brainwashing. I never had a chance.

My soul was lost to the swirling waters of the river styx long ago.

-I may be goin to heII in a bucket baby, but at least I'm enjoying the ride-

Date: 2006/06/22 07:53:39, Link
Author: BWE
Quote (stevestory @ June 22 2006,12:25)
Quote

Personally, I'm waiting for the "I used to be an atheist, because I was angry with God" testimony.  That one always gives me the giggles.


LOL Yeah. "I used to be an atheist, and a drinker, and used all kinds of the drugs, I freebased a lot of the marijuana, I smoked a lot of cocaine, I slept around with lots of hot girls..."

Yeah, whatever, rockstar.

And you gave it all up for god? Proof! proof that religion makes you stupid. :D

Date: 2006/06/22 08:12:37, Link
Author: BWE
Y'know,

I just read all his posts and I am not sure exactly how they started out OT? His moniker is a little confrontational, true but why the deletions?
Quote
As I was saying in the message before missy PZ wiped it out, for democratic reasons I guess (in the Bush sense of the word):
Poppers ghost reflects the kind of dicotoomous thinking that PZ harvests. Basically that if your´re not bent on insulting religion, you can´t be a scientist or an atheist. Black or white. Oh and did Poppers ghost call me an illiterate moron? What a surprise! These guys are great for the evolution cause. They insult, they like moving in flocks (PZ herdsman), you know, not an inch better than a christian fanatic neocon, but of inverted polarity.


That seems like a reasonable, if testy comment. And, considering the topic, I would say On-T.

What am I missing?

Date: 2006/06/22 08:19:18, Link
Author: BWE
Quote
What does Bill Dembski think of all this? A mild-mannered mathematician more at home with probability theory than politics, he shakes his head in disbelief. “I’ve found that when people get to know me one-on-one, they think what I’m doing is legitimate, or at least worth pursuing. But when they start listening to the siren call of the Internet, things get out of control.”


Nice qualifier.

Date: 2006/06/26 09:00:07, Link
Author: BWE
Man, I just watched season 1 of the muppet show this weekend. That is, IMHO, the best show that has ever been on TV.

Oh yeah, Davey, you should go on TV with your ideas, maybe Jerry Springer. Your god ideas could entice a chuckle from coast to coast.

I prefer my gods to be more, um, loving.

Enjoy your chemical imbalances. I surely did.

Date: 2006/06/26 10:10:24, Link
Author: BWE
Quote (carlsonjok @ June 26 2006,14:28)
 
Quote (afdave @ June 26 2006,12:38)
On the one hand, you are talking about the Moral Absolute that "Individual humans are not to kill."  On the other hand you have lawfully instituted, God-ordained governments which are delegated the power by God to kill--capital punishment, war, A-bombs, etc.

Okay, I have to admit some degree of curiousity about this?  Are all governments God-ordained?

Of course they are
Quote
The medieval metaphor of the Two Swords, first introduced by Pope Gelasius I (492-496), posited a unity of Christian society. It proclaimed that the two governments of sacerdotium and regnun, each with separate powers, were merely the spiritual and the temporal arms of a single Christian commonwealth. There was as yet no theory of church and state: the Church was not a State; it was the State, universal order, spiritual as well as moral. What we today know of as the state, the supreme civil authority, was merely the temporal arm, the police department if you will, of the Church. Every duality, however, is liable to be perceived as a dichotomy and it is not surprising that the later historical development of the West came to assume the character of a struggle between Church and State, a clash of the Two Swords. Ever since that fateful conflict, the modern man has lived in a binary world of antitheses and antinomies, dialectics and disputations, rifts and ruptures. Indeed, he either dreams of a Grand Theory that would restore the unity of his lost vision, or dreads this possibility!


Davey, does it hurt?

Date: 2006/06/27 08:08:26, Link
Author: BWE
Quote (The Ghost of Paley @ June 26 2006,17:26)
Quote (BWE @ June 26 2006,14:00)
Man, I just watched season 1 of the muppet show this weekend. That is, IMHO, the best show that has ever been on TV.

Oh yeah, Davey, you should go on TV with your ideas, maybe Jerry Springer. Your god ideas could entice a chuckle from coast to coast.

I prefer my gods to be more, um, loving.

Enjoy your chemical imbalances. I surely did.

BWE--

I see you changed your avatar. Did your mommy start nagging you about the last one? Now, it seems as though the Muppets are the pinnacle of cultural and aesthetic virtue among many evolutionists here. The average evolutionists' intellectual development has never extended beyond Sesame Street, but they needed some sarcastic humor to make them feel intelligent. Hence, Jim Henson rose to the challenge.

Are you kidding? It seems as if? They are the pinnacle. My mommy was busy writing a book about a fungus that grows in the brains of christians.

Date: 2006/07/26 17:10:54, Link
Author: BWE
Wow. Just wow. I'm gone for a month or two and you are still at it.

Dave, your brain is made of highly evolved dung. You are sweat from Father Sky's balls after they were cut off. Your religious ideas are more useless and wrong than something that is severely useless and wrong. For christs sake Dave. You have failed to make even one point that casts even a haze from a shadow of a doubt on one single thing that might make us believe in your pansy assed, pouting, juvenile, pathetic and provincial god. You have been all those things yourself too. You lost all our respect when you claimed to have won the portuguese thing but you also proved my point that you are in fact dumber than dirt and can't debate using reality. But we knew that the moment you claimed tyo be a YEC. You are as hopeless as the rest. You are a danger to children and civilization as a whole. You are wrong on so many levels that we could never unravel them for you.

I just read the last 10 or so pages and I formally declare it is safe to write yoy off as an unteachable idiot.
Cheers

Date: 2006/07/31 13:31:52, Link
Author: BWE
Sorry about the drive by's. Work has me nailed down all summer. Very good run through of the geology thing. Y'know it corresponds with the fossil thing too.

e.g. divergent species on either side of a split with same fossils on both sides. That is the most compelling evidence for both plate tectonics and evolution to me. I don't have time to pull up the specifics now but Dave, I'd be willing to make you some sort of a bet that I could produce the evidence.

Correction: Zooplankton living in the sweat from Father Sky's balls after they were cut off.

Some balls are held for charity and some for fancy dress...

Argy, I'm glad you caught that very important bit of news from my blog.

Date: 2006/08/01 06:03:12, Link
Author: BWE
When my son was around five years old, we saw a xian store at the mall and he asked me what it was. When I told him he started laughing (loudly) and said- seriously - "Dad, that's ironic isn't it?"

Any preacher with more than 2 suits is a shyster
-Lenny Bruce

Dave, you are dishonest. You are all those other things too but actually you have the real bad guy thing going. You are dishonest and you are trying to profit from your dishonesty.

You and others like you make me sick.

You are comical in your stupidity and I can make you the butt of any joke because of it but you are preying on those weaker than you and you should be ashamed.

Portuguese, dicksweat. Remember?

You are a bad man.

Date: 2006/08/01 16:19:02, Link
Author: BWE
You are a very bad man.

Date: 2006/08/02 03:21:27, Link
Author: BWE
Well, I read back 15 pages or so and I didn't see it but, if we are still even trying to present real info to the Snake Oil ® salesman, did anyone mention the magnetic reversals?



My explanation is that God didn't actually Flud the earth, he stripped away the magnetosphere and let everyone get irradiated. Noahaster and his clan didn't build an ark, rather a giant lead coated sporting arena where everyone stayed until god gave us back the magnetothingy. and this time, god put north to the north and south to the south (mostly, noahs intruments weren't very precise so god didn't worry too much).

Link here for davey to read

Date: 2006/08/02 06:37:32, Link
Author: BWE
Grave robbers took all the lead during roman times to make eating utensils and vitamin pills. All we have is a written document by the roman governor of the times claiming the jews started all the wars in history. Of course he was drunk and trying to tell the legionaires who was boss. Since the Anti defamation league's writings were burned at alexandria, there is no way to know if he issued a formal apology through his publicists or not.

Date: 2006/08/02 07:25:41, Link
Author: BWE
- Well, I've seen a horsefly, I've seen a dragonfly.
I've seen a housefly.
I've seen a peanut stand and heard a rubber band.
I seen a needle that winked its eye.
But I be done seen about ever'thing
When I see a jellyfish turn into a squid

I seen a front porch swing heard a diamond ring
I seen a polka-dot railroad tie
But I be done seen 'bout ever'thing
When I see a jellyfish turn into a squid
             
I saw a clotheshorse He rear up and buck
And they tell me that a man made a vegetable truck
(I didn't see that I only heard)
           
I heard a fireside chat - I saw a baseball bat
But I be done seen 'bout ever'thing
When I see a jellyfish turn into a squid

Date: 2006/08/02 09:03:06, Link
Author: BWE
Quote
That explanation is wrong, as detailed magnetic maps clearly show. There are no magnetic reversals on the ocean floor, and no compass would reverse direction if brought near an alleged “reversed” band.


OMG. Stupid doesn't do this stuff justice.

Innocent until proven guilty???? Alleged???

Fuck.

Date: 2006/08/02 13:50:55, Link
Author: BWE
Dave,

I have, right here in my office, a small piece of equipment that can measure salinity relatively accurately to parts per thousand. Any guesses on how it works? Any guesses on what it measures?

Hint: you don't need to know much but you need to know more than you do.

Date: 2006/08/03 06:29:53, Link
Author: BWE
It has only just gotten into me that these guys and those who are like them, are evil. Real evil. Like, they get the energy to go about their days from fear and anger rather than wonder and curiosity. Y'know, the dark side.

I used to just think they were comical, ridiculous, "a bit touched" as my grammy used to say, but now I think of it as straight snake oil sales. intentionally harmful for a profit.
???

Date: 2006/08/03 06:38:30, Link
Author: BWE
I can just see the watchmaker, searching with his hand behind him, muttering.

"Where the hel! did I put that damm viamin-c gene wrench?" Oh he11, I'm tired, I'll just stick them down over by those fruit trees and forget about that gene on these ones."

Date: 2006/08/04 21:00:27, Link
Author: BWE
How many creationists does it take to screw in a lightbulb?

Well, creationists say the bulbs screw themselves in but the maintenance crew claims otherwise. WHo you going to believe?

Date: 2006/08/10 09:09:02, Link
Author: BWE
Dave, the point that you are trying to make is that the crater was part of goD's wrath at the anasazi worshipping the sun rather than the son right? Why did god leave out the Americas with his jesus thing? Why are you a boneheaded idiot?

Every single independent method of dating things agrees to an uncanny degree. This is the opposite of a conspiracy Dave. It is a bunch of folks who figure things out all figuring things out and then looking at the other guys and saying, "gee whilikers mister, your results are the same as mine even though we used totally different methods to arrive at them."

Why do you think your goD is better than mine? I happen to think my god is better and he wrote more books so I know he is better. And your god can't even fix his pr problems. Mine can. Why is the hindu myth not true but the  xtian myth true? Why are some prophets real but others false? How can I know a real christian from a fake one? Do you wear boxers or briefs? Do enjoy sex with goats? WHat does baby blood taste like? I heard xians eat babies. Do you eat white babies too or just black ones?

Mamamamoron.

Date: 2006/08/10 11:45:13, Link
Author: BWE
Quote
The Warning Signs of Toxic Religion
By J. Lee Grady
Charisma Magazine

CBN.com – After Elisha watched Elijah ascend into heaven, the prophet went to the city of Jericho and performed his first miracle. The men of that city faced an environmental crisis: Their water was toxic, most likely because of the sulphur and other chemicals that had rained down upon nearby Sodom and Gomorrah years earlier. This poison had made the land barren (see 2 Kings 2:19-22) and it was probably affecting people and animals as well as plant life.

So Elisha performed a bold, prophetic act. He threw salt in the water and proclaimed: “Thus says the Lord, ‘I have purified these waters; there shall not be from there death or unfruitfulness any longer” (NASB). His proclamation brought immediate cleansing.

This obscure story in the Old Testament offers us a picture of the gospel’s power. The message of Jesus Christ heals us. The Holy Spirit brings life where death has reigned. He neutralizes the poisons that cause spiritual barrenness. He balances the pH level so that spiritual growth and vitality is possible.


All of us would like to enjoy a healthy spiritual life. But the sad truth is that many of us, and many churches today, are barren because of hazardous additives. We have believed a different gospel—one laced with legalism, performance-based religion and salvation by works—when Christ alone is our only source of life.

Jesus Himself referred to these toxins as “the leaven of the Pharisees” (Luke 12:1). He told us that the Pharisees’ brand of religion, which looked good on the outside, was deadly—and contagious.
Have you been infected? You can take your own pH test by examining these eight characteristics of a religious spirit.

  1. A religious spirit views God as a cold, harsh, distant taskmaster rather than an approachable, loving Father. When we base our relationship with God on our ability to perform spiritual duties, we deny the power of grace. God does not love us because we pray, read our Bibles, attend church or witness, yet millions of Christians think God is mad if they don’t perform these and other duties perfectly. As a result they struggle to find true intimacy with Jesus.  

  2. A religious spirit places emphasis on doing outward things to show others that God accepts him. We deceive ourselves into believing that we can win God’s approval through a religious dress code, certain spiritual disciplines, particular music styles or even doctrinal positions.  

  3. A religious spirit develops traditions and formulas to accomplish spiritual goals. We trust in our liturgies, denominational policies or man-made programs to obtain results that only God alone can give.  

  4. A religious spirit becomes joyless, cynical and hypercritical. This can turn a home or a church completely sour. Then, whenever genuine joy and love are expressed, this becomes a threat to those who have lost the simplicity of true faith.  

  5. A religious spirit becomes prideful and isolated, thinking that his righteousness is special and that he cannot associate with other believers who have different standards. Churches that allow these attitudes become elitist—and dangerously vulnerable to deception or cult-like practices.  

  6. A religious spirit develops a harsh, judgmental attitude toward sinners, yet those who ingest this poison typically struggle with sinful habits that they cannot admit to anyone else. Religious people rarely interact with nonbelievers because they don’t want their own superior morals to be tainted by them.
     
  7. A religious spirit rejects progressive revelation and refuses to embrace change. This is why many churches become irrelevant to society. They become so focused on what God did 50 years ago that they become stuck in a time warp—and cannot move forward when the Holy Spirit begins to speak in new ways. When religious groups refuse to shift with God’s new directives, they become “old wineskins” and God must find more flexible vessels that are willing to implement His changes.
     
  8. A religious spirit persecutes those who disagree with his self-righteous views and becomes angry whenever the message of grace threatens to undermine his religiosity. An angry religious person will use gossip and slander to assassinate other peoples’ character and may even use violence to prove his point. Jesus, in fact, warned His disciples: “There will even come a time when anyone who kills you will think he’s doing God a favor” (John 16:2, The Message).  

If the poison of religion has seeped into your life, ask Him today to pour a fresh understanding of His grace into your barren spirit.
link

Oh Daaaave. Did you read your 700 club today?

Date: 2006/08/12 10:04:00, Link
Author: BWE
link
link (interesting idea about pollution)
fisrt abstract
2nd abstract

link
 
Quote
ANALYSIS OF RED RAIN OF KERALA

Samples of a red rain that fell across the state of Kerala in India in July-August 2001 have been found to contain microscopic red cells (Louis and Kumar, 2006) of unknown origin. The early fall was associated with the 'thunder' and flash of a large meteor. They report that the cells appear to be very unusual in lacking a nucleus and DNA. Dr. Godfrey Louis kindly supplied us with a sample of this material for independent investigation in Cardiff.
High resolution electron microscopy has revealed internal structures as well as evidence of a replication cycle not commonly found in either bacteria or yeasts. These images are of thin cell slices viewed in the transmission electron microscope.
 
Quote
The first (above) shows three cells around 3 micrometres in diameter, with thick cell walls and a variety of nanostructures within a membrane, but with no identifiable nucleus. Apparent holes in the cell wall are real. The cell on the right has larger holes and may have lost its cytoplasm.


These quotes from the last link. Anybody know anything about these labs in britain? Crazy crazy. You'd think Davey made it up. Fact is sometimes stranger than fiction. This one could go either way I guess.

Date: 2006/08/12 10:18:03, Link
Author: BWE
Quote
Oh really, now.  So you deny that a majority of the "staircase" is sedimentary (i.e. water laid) rock?

Wow. Just wow. Goddam DikHeadDave. 3 questions:

1) Are you sure you ought to be equating sedimentary with water laid?
2) Do you know what metamorphic rock is, how it is formed, and why some of the stairs contain it?
3) STAIRCASE- why is this the word used to describe a process that happened ove the course of a brief time?

* and, to answer for davy gravy where the water came from, jeeze I can't believe you... er.. nevermind, gOdDiDiT!

Dyuh.

Date: 2006/08/12 10:28:04, Link
Author: BWE
Oops, forgot the wiki entry.
here.

worth a read for the overview.

Date: 2006/08/12 16:59:54, Link
Author: BWE
maybe this is old news? any idea what is going on?

Date: 2006/08/13 11:06:44, Link
Author: BWE
Hmmm. I think the question is: "Is it alien life?"

Life on Earth would have DNA. As far as I know, there isn't really any direct evidence for life "not from earth".

A. Is it life?
B. Does it have DNA?
C. Is it from outside our Biosphere?

Anyone know? It seems like a big deal to me.

Date: 2006/08/13 18:48:08, Link
Author: BWE
I searched all over. I haven't found anything like it. I did the the whole newscientist article and that wasn't the take there either, His deal was that there was just no evidence for extraterrestriality. The dna bit is what's wierd. Where are lab results posted. Any idea?

Date: 2006/08/15 18:15:10, Link
Author: BWE
I had a slime mold for a pet for several years when I was a kid. My mom and I adjusted environmental conditions periodically. I learned a lot about slime molds back then. Ahhhhh.....

Date: 2006/08/15 18:42:11, Link
Author: BWE
Dave, read it again. No it doesn't.

Dude, I am beginning to wish violence upon you. Sometimes I have to meditate for a long time to remember that Nero was a bad guy overall. I know that stupidity isn't a crime nor should it be but you are evil and decietful.

Dave you are a liar and a bad man.

Date: 2006/08/15 19:21:36, Link
Author: BWE
DaveTard,

I think I met you in Dallas last week. I took a picture. Is this you?

Date: 2006/08/15 19:27:07, Link
Author: BWE
Is it quote mining to pull up an old ditty I put on the thread where he lost the portuguese thing?

Quote
Davey Dickhead
Missed out on the Special Ed
That could have fixed his head

Cause he was stuck 'neath The Bong Bong Leaves
Pulling on his Reverend daddy's sleeves
Saying "When we take their stuff does it make us theives?"

His reverend daddy said:
Son they'd be better off dead
Than miss out on the lord's spread

So what we're giving in return is grace
Something in short supply in this godforsaken place
And when they see the color of the chief's new baby's face
We'll be gone son, without a trace.

Date: 2006/08/16 10:03:40, Link
Author: BWE
Davey DH, you are missing the requisite education necessary for this debate. I'm sorry that it means so much to you that your provincial little sky daddy isn't what you thought he was. It must be unsettling to realize that we simply are what we are if you were led to believe otherwise. Unfortunately, geology 101, oceanography 101, biology 101, or any other kind of things like it would absolutely devastate you.  But it might be worth it since you can't seem to find anything worthwhile to do with your time. You are simply too wrong to start here.



Icthy...
I never got it to be a man eater but I did get it to fruit more than once. My mom would never let me turn it into a man eater. She was kind of mean that way.

Date: 2006/08/16 15:42:41, Link
Author: BWE
DaveyDH said:
Quote
RULES OF ENGAGEMENT (ROE)
I need to say right up front that my reasoning with respect to this "Creator God Hypothesis" DOES NOT follow the Deductive Framework.  I have stated prior to giving my hypothesis, that I cannot provide a watertight proof for God and I don't believe anyone can, so people are correct in saying that my hypothesis would fail using the deductive schema.  However, we CAN use Abductive Reasoning then draw an Inference to the Best Explanation (IBE), and as Meyer points out below, this gives us powerful support for believing that the "Creator God Hypothesis" may in fact be true.  So there is good news, O Seeker of Truth!  There is massive support for the existence of God and for the literal truth revealed in the Bible.  Stay with me through all of my points and I will show it to you in terms you can understand!


Quote
Chris Hyland
Posted: May 01 2006,08:36  
A few pointers:

To save you some time, we don't need evidence that there was an ice age.

If you could give us something that we haven't heard a hundred times before I'm sure we'd all be very grateful.

If you're going to present this theory as an alternative to current science theories using abductive reasoning you need to show why it explains the data better than current theories. Just because your hypothesis also talks about the origin of the universe it does not mean it is automatically a better theory of the origin of species than evolution.
     ---------------------------------
Occam's Toothbrush
Posted: May 01 2006,08:38  
[cue smart people who should know better taking afdave's moronic bait]
   -------------------------------------------------
Chris Hyland
Posted: May 01 2006,08:46  
I know but I have a day off and im bored.
----------------------------------
afdave
Posted: May 01 2006,09:01  

I agree completely ... I plan on going to great lengths to show exactly that.  My Ice Age info will show that it was not a million (did I get that about right from ToE?) year Ice Age, but that it was relatively short, occurred right after the Great Flood, and helps to explain dinosaur extinction.



This was the way this all started.

Dave, all we have to do is show that the earth is older than 10k years and you lose. That blows your theory and then we go looking for better ones. Yours is out and we need to find one to fill its place.

A history of science class will show you that this has already taken place. Mitochondrial DNA sequencing of sharks never even needs to enter the picture. We don't need any advanced physics measuring red shift or various decay rates. We don't need the several hundreds of volumes of geologic investigation. We don't need to know jack shit about seafloor spreading, magnetic reversals, subduction zones, fault slip zones, specific chemistry of rocks or radiometric dating techniques.We don't need to know about paleontology, archaeology, paleobotany or even biology. We don't even need to know the origin of the portuguese fuckin laguage. All we need is core samples. We need ice core samples, dendrochronology, sediment core samples and volcanic eruption core samples. When they all match and all go over 10k years, your theory goes down the toilet where it belongs. And gues what? That's what happened.

Now that everyone else knows that your theory is wrong, they are released from that particular yoke and can go about looking for other information.

If you decide to do that, you have to know where the frontiers are. And, well, you need some science education to do that. About 15 years ago, I used to teach oceanography at Community College in Washington for a few extra bucks. I had a few creationist students come in but I never had a single one of them try to do a creationist experiment in lab. I never once mentioned religion and only a few students ever did. You know why? Because it doesn't get you anywhere in science. When you are looking at data, you don't get the luxury in a real science environment to speculate on the sky daddy. Because that is the end of the conversation. There is no more science to do. You have never done it, you don't know anyone who has and you are not qualified to speculate. I might ask you about the moral implication of a particular bible verse or maybe even the best routing equipment to use in our office. I might ask you questions about your travels, your air force experience, your family, or even, if I felt particularly confident, your church. But I would not ask you questions about science. Because you have conclusively demontrated that you don't even get what science is.

But I won't ask you any of those other things now because you have proven yourself to be a liar, a bully, dangerous to kids and ridiculously stupid on top of all that.

Davey DIckhead, you are a very bad man.

Date: 2006/08/16 17:23:26, Link
Author: BWE
My mom was a botanist way back in the 50's. We were hippies before there were hippies. I used to get a nickel a bug for new bugs I could catch to put in her collection. The catch: it had to be one she didn't have. I learned a lot about ecosystems from that one. (and bugs). Our summer road trips were to wilderness places to look for new birds. My mom kept a journal. I was little when Rachel Carlson wrote Silent Spring but I remember it as a major event. I was doomed from an early age. And having a history prof for a dad was a double whammy. I got it from both ends of the spectrum.

I kept the slime mold (Slimy Sam) in a glass terrerium. No kidding, it was the intended inhabitant. I'm sure a lot of Slimy probably escaped but he kept coming back, just when you'd think he wouldn't. We did a lot of varying temp. moisture, food sources (he liked maple leaves best, er, I think), light etc to get him to come and go. He would fruit when he got dry and bright light if I remember correctly, there was a lot of randomness (or perhaps lack of good laboratory controls). I'm not sure it is technically a sporophyte stage when you're talking slime mold but a sporangia fruiting body with haploid spores is what would happen.

Date: 2006/08/16 17:41:04, Link
Author: BWE
Dang, where have I been? W/Obrain here snuck in like everyone knows him. Oh, sorry, I don't read greek. I have read some works by most of those authors you list there but none in their native tongue. Um, is ancient greek close to portuguese?

Let's talk Plato. I am willing to start a thread or reply on yours that the good the true and the beautiful is simply a westernization (realizing of course that plato and western are nearly synonomous) of eastern traditions. Or maybe Rousseau. Though I'm not sure what to add. I am no philosopher.

I prefer Mill or Locke for enlightenment and my favorite is Blake-The Marriage of Heaven and #### Blake would be a hoot. I read his native tongue pretty well.

Do you believe in evolution? (You know, it's like god, you get to choose whether to believe or not)

Date: 2006/08/17 09:09:45, Link
Author: BWE
Daveey DH,

Do you deny that you are deliberately obfuscating and that you have told intentional lies?

Date: 2006/08/17 09:28:34, Link
Author: BWE
Have you told a lie on this thread DaveyDH?

Date: 2006/08/17 11:18:47, Link
Author: BWE
Dave, have you intentionally lied on this thread?

Date: 2006/08/20 19:04:37, Link
Author: BWE
Quote (afdave @ Aug. 18 2006,14:57)
Louis...  
Quote
Trust me on one thing Davey, I've met people in your situation before and I actually feel sorry for you.
I don't trust you an anything and no you don't.  You hate my guts and all people who think like me.  Which is too bad for you but oh well.  Hating people turns your heart black.  (not literally, guys, calm down--it's a figure of speech)

You are right dave. Davey DH, I insult you because you are not important to me and I find you mildly offensive/ THat said, hate only speaks to the one who hates. But DaveyDH, wasn't it you that projected the word onto DM?
I would hope that you could keep turning the other cheex. And DavieDH,

HAve you deliberately lied on this thread
?

Date: 2006/08/20 19:22:58, Link
Author: BWE
Quote (jeannot @ Aug. 20 2006,11:15)
Hmmm Dave, your flood theory puzzles me.

Why don't we mostly have fossils of benthic organisms in the deeper strata and fossils of planktonic organisms in the upper ones?

Why is that Dave?

And again, was it sea water?

Or just what was the salinity? Sturgeon, now they may not care, but poor STJ, ask him daveyDH, ask him what would would happen to a beautiful parrotfish in salinity of, oh, say 18 ppt. (sorry,. Icthyic) What would happen to the poor smolts? Why do the rivers run downhill?

(Having Native American's in the family helps)

Really Davey, why tf do the river's run downhill? A quick google search didn't give me one of the severaol freakin hundred creation stories I heard as a kid. Go figure it out. You have to find out a little about NW Indians, raven, coyote and salmon but ####, you don't seem to know anything about anything so wtf.
\
But wtf was the salinity? The big flood? The bass, the little sunfish? Bluegill? Perch? How would they do In a salinity of 18 ppt? Davey dh, is it fresh or salt water fish that live in 18 ppt salinity?

Oh yeah, have you deliberately lied on this thread?

Date: 2006/08/20 19:57:46, Link
Author: BWE
Not me. I can't admit my mistakes. Not unless someone points them out to me anyway. Or unless I notice them myself. But before I took a science class, I was good. I mean really really good. It's like rock & roll. Ity made me want to burn and rob, join a lynch mob, not belkieve in god.

Erg. I think I might be hung over in the morning. I hope I never get too old for this shit.

Davey DH,

Have you told a deliberate lie on this thread?

:)

Not STJ, the right flood perhaps, but a damm good one noone the less. hic*

Date: 2006/08/21 06:54:06, Link
Author: BWE
So lets see what we've established here:

1) Davey is a truly bad man who wants to do serious psychological damage to kids as a way to rationalize his own twisted childhood.
2) Davey DH is an idiot of the highest order of magnitude.
3) In order to disprove YEC rubbish, all we need to do is crosscheck various core samples and determine if they add up to more than, well, 6500?? years. But we could go ahead and make it 10k if the YEC morons want to move the goalposts.
4) On top of that we can demonstrate RM dating techniques and the relevant physics.

5) YECer are hamstrung by the fact that they need to have that darnded flood in there somewhere. The darnded flood however, left no evidence and would have wiped out most of the aquatic life in the world due to very narrow temperature and salinity tolerances.

6) Human nature is such that when someone lies intentionally, gets caught, lies again, gets caught again, then simply asserts they've won, the others around such a person get annoyed. Annoyance can lead to very mean thoughts. I'll admit to one or two myself but my negative thoughts are merely being brought up from an annoyed mind and they pass quickly. In the end, Dave came here to learn from us and in so doing, his lies were exposed to himself and he got crazy. His lies are obvious to most of the rest of the members of this forum and we got crazy and angry too.

But the thing is, DaveyDH, you went to the experts and challenged their information. THis is fine with Experts because that is how they refine their understanding. But when you look at the same evidence and then say yeah but, since the bible is true then there must be a problem with the evidence- it can be maddening.

DaveyDH, your provincial little set of books aren't literally true. THere was no global flood, The earth is ~4.5 byo, the universe is ~13.7 byo maybe, seawater has a salinity of over 30 ppt and fresh water typically has a salinity of under 1ppt (actually, that last number is part of a much larger set of data because there are different ways to make and store fresh water)

Also, ppt in this case is an acronym from the greek meaning christian appologists are just stupid, so pity them rather than being angry.

Now here's the deal with my input here on this thread. I have asked you to take a specific position in every case where I would have been happy to debate. In every case you have ignored me or declared the debate won before I began. THis behavior of yours is to a very small degree, frustrating. So, in the interest of being nice to me (which is right up at the top of all decent people's lists) please answer just this one direct question:

DaveyDH, Have you told a deliberate lie on this thread?

Date: 2006/08/21 10:56:50, Link
Author: BWE
So, DaveyDH says he is not lying. He honestly believes. OK, Davey, have we provided enough evidence that the Earth is over 10k years old?

Do you think that it less that 10k years?

1) Core Samples?
2) RM Dating?
3) E=mc2 ?
4) Seafloor spreading (plate tectonics and magnetic reversals)?
5) Red shift?
6) Geologic Column?
7) Archaelogical evidence?
8) The fact that all evidence, bar none, points to the same conclusion and that you doubt this because of a book written by people who didn't even know where rain came from?

I'll take you at your word , er..., well, I will, what are you guys looking at me like that for? I'll take your word that you aren't consciously lying to us. But you do understand that you are clinging to your pathetic little ideas and providing no evidence to show that they have any merit, right?

And you do understand that many people here have provided mountains of evidence that all point to the conclusion that you are wrong and you have not managed to refute even a single one, right?

So, you must be prepared to admit at this point that, even though every shred of evidence points out that your idea ab
out your pathetic little sky daddy is incorrect, that you are incapable of conceding the point because you just don't posess the emotional strength to confront that particular reality. So,... um,... we're waiting....

Date: 2006/08/21 11:25:05, Link
Author: BWE
Wow, I missed your last post.

Well then, we need look no farther than core samples.

first, ice core samples record the passing of years in seasonal snowfall. They go far beyond 6k years. Lest you try to jjump up and say that god made 36,000 individual snowfalls in a day or two or some other crap like that, there are numerous ways to test that.

Volcanoes leave deposits in ice core samples. They also leave traces in tree ring samples. Tree ring samples can be a dating method by finding a tree that was cut when another was young and cross referencing events recorded in the rings (which also grow in yearly cycles. The events that cross-reference in both ice and tree rings are a check each upon the other. Of course, if you allow c14 dating as valid, there are also archaelogical sites which can correspond: eg vesuvius blows, we have a real, known date. The date is also recorded in tree rings and ice core samples and c-14 dating gives the right date too. We count backwards in the tree rings untill we get past Rome and find that the years of other events still correspond to ice core samples and poof! ® we get past your 10k years and whoosh! ® out goes the wind from your skull.

That was easy.

Also, your flood doesn't have a single corresponding sediment layer over the earth. Also your flood story is a fable. Also your god story is a fable. Also your circularity argument is dumb because it assumes only one way to check dates (rm) of which I just showed you there are others. But don't take my word for it. Go out and find out!

And when you find some aig crud about dendochronology or ice core samples, go discover that sediment works the same way and cross-references yet again that the ice cores and tree rings are correct!

Then, once you are all twisted like a pretzel, go do something hedonistic, reflect on how good it feels knowing that god doesn't care.

:)

Date: 2006/08/21 11:45:31, Link
Author: BWE
I'm with you skeptic. Although, I would definitely be embarrassed to have a biology degree. I mean, -list makers? sheesh, not me. no way. I don't even like will and grace man. You'd never catch me in some kind of sissy thing like that.

Date: 2006/08/21 12:33:54, Link
Author: BWE
Quote (BWE @ Aug. 21 2006,16:25)
Wow, I missed your last post.

Well then, we need look no farther than core samples.

first, ice core samples record the passing of years in seasonal snowfall. They go far beyond 6k years. Lest you try to jjump up and say that god made 36,000 individual snowfalls in a day or two or some other crap like that, there are numerous ways to test that.

Volcanoes leave deposits in ice core samples. They also leave traces in tree ring samples. Tree ring samples can be a dating method by finding a tree that was cut when another was young and cross referencing events recorded in the rings (which also grow in yearly cycles. The events that cross-reference in both ice and tree rings are a check each upon the other. Of course, if you allow c14 dating as valid, there are also archaelogical sites which can correspond: eg vesuvius blows, we have a real, known date. The date is also recorded in tree rings and ice core samples and c-14 dating gives the right date too. We count backwards in the tree rings untill we get past Rome and find that the years of other events still correspond to ice core samples and poof! ® we get past your 10k years and whoosh! ® out goes the wind from your skull.

That was easy.

Also, your flood doesn't have a single corresponding sediment layer over the earth. Also your flood story is a fable. Also your god story is a fable. Also your circularity argument is dumb because it assumes only one way to check dates (rm) of which I just showed you there are others. But don't take my word for it. Go out and find out!

And when you find some aig crud about dendochronology or ice core samples, go discover that sediment works the same way and cross-references yet again that the ice cores and tree rings are correct!

Then, once you are all twisted like a pretzel, go do something hedonistic, reflect on how good it feels knowing that god doesn't care.

:)

Dipshit. You lose. Why are you picking out complicated stuff when your theory is disproven by very simple evidence?

Date: 2006/08/21 14:17:18, Link
Author: BWE
Quote
Now on to my hypothesis.  Its actually very simple and I've alluded to it over the last twenty or so pages.  The mutation process has developed (evolved) in order to preserve diversity within genomes to help ensure survivability.  Cells respond to environmental stimuli to up or down regulate mutation, possibly at specific loci, in order to promote adaptability for organisms.  It has been suggested that embedded proteins correspond to specific genes and can regulate or influence expression, etc.  Stimuli could include any number of things but we could group them under the heading of stress.  Based upon this populations under stress would develop variability more quickly and given a reduced degree of variability within the population traits could spread more quickly.  This would be reflected in long periods of apparent stasis followed by apparent "quick" evolutionary and additionally organisms that don't experience stress or environmental pressures would show less change over time, the living fossil concept.  These organisms would actually favor more robust error-correction processes which would mean that ultimately during extreme and rapid environmental change there would be an apparent very rapid extinction.  The idea of "simultaneous" evolution arises from the chance that very similar organisms in different locations but under similar environmental pressure would tend to evolve along the same path given that the available options for mutation would be limited.  


It's actually very simple. Worshippers at the golden dias of Darwin have to drink at a pool of elastic reasoning in order to first come to accept, then come to justify their incessant clamoring for `evidence this` and `proof that` while all the while ignoring the nonexistant reality that clearly and decicively shatters their urban elitist view, or more appropriately, interpretation of this unrelenting data steam that flows from the automatons and drones bred by this cult of information that the darwinist establishment forces on the rest of our society, no matter how pious of faithful we may be.

Date: 2006/08/21 15:30:39, Link
Author: BWE
Hey, I am 100% serious! Are you laughing at me or with me?

Oh whatever. I guess I'll take it where I can get it.
Thanks :D

Date: 2006/08/22 08:24:22, Link
Author: BWE
Quote (BWE @ Aug. 21 2006,17:33)
Quote (BWE @ Aug. 21 2006,16:25)
Wow, I missed your last post.

Well then, we need look no farther than core samples.

first, ice core samples record the passing of years in seasonal snowfall. They go far beyond 6k years. Lest you try to jjump up and say that god made 36,000 individual snowfalls in a day or two or some other crap like that, there are numerous ways to test that.

Volcanoes leave deposits in ice core samples. They also leave traces in tree ring samples. Tree ring samples can be a dating method by finding a tree that was cut when another was young and cross referencing events recorded in the rings (which also grow in yearly cycles. The events that cross-reference in both ice and tree rings are a check each upon the other. Of course, if you allow c14 dating as valid, there are also archaelogical sites which can correspond: eg vesuvius blows, we have a real, known date. The date is also recorded in tree rings and ice core samples and c-14 dating gives the right date too. We count backwards in the tree rings untill we get past Rome and find that the years of other events still correspond to ice core samples and poof! ® we get past your 10k years and whoosh! ® out goes the wind from your skull.

That was easy.

Also, your flood doesn't have a single corresponding sediment layer over the earth. Also your flood story is a fable. Also your god story is a fable. Also your circularity argument is dumb because it assumes only one way to check dates (rm) of which I just showed you there are others. But don't take my word for it. Go out and find out!

And when you find some aig crud about dendochronology or ice core samples, go discover that sediment works the same way and cross-references yet again that the ice cores and tree rings are correct!

Then, once you are all twisted like a pretzel, go do something hedonistic, reflect on how good it feels knowing that god doesn't care.

:)

Dipshit. You lose. Why are you picking out complicated stuff when your theory is disproven by very simple evidence?

Y'know, all this sciency stuff is gettin me down. DaveyDH, you lost. The earth is more than 6000y. Core samples prove it.
Nuff said.

Go ahead, try to poke holes. I'll fill em, patch em and paint em. You got nothing. Anybody here think I'm wrong?

Date: 2006/08/22 08:36:00, Link
Author: BWE
Indulge him? I thought you were all doing it for me. After all, I am the one who goaded him by telling him I could run faster, junp higher and screw better than him.

The guantlet was thrown and everyone picked it up. Plus we get to find out lots of neat info about RM dating, geology, archaeology, etc. It has proved to be a very informative thread for me anyway.

Date: 2006/08/22 10:06:24, Link
Author: BWE
Ok, I've been quietly trying to figure out what happened to DaveTard for a couple of weeks. (I haven't done more than try to read back in this thread) but I can't find it. What happened?

Sorry. ???

Date: 2006/08/22 10:31:32, Link
Author: BWE
Quote (Arden Chatfield @ Aug. 22 2006,15:15)
 
Quote (BWE @ Aug. 22 2006,15:06)
Ok, I've been quietly trying to figure out what happened to DaveTard for a couple of weeks. (I haven't done more than try to read back in this thread) but I can't find it. What happened?

Sorry. ???

You mean the last couple weeks before now? Mostly just hanging out at UDOJ and getting into hilarious insult-fests with Davison. He seems to have been sort of at loose ends.

Thank Bog he's back at UD now and he can once again let his freak flag fly.

:p

No, why'd he leave UD in the first place? did he post a photo of his penis?

Date: 2006/08/22 14:35:40, Link
Author: BWE
Quote (BWE @ Aug. 22 2006,13:24)
Quote (BWE @ Aug. 21 2006,17:33)
Quote (BWE @ Aug. 21 2006,16:25)
Wow, I missed your last post.

Well then, we need look no farther than core samples.

first, ice core samples record the passing of years in seasonal snowfall. They go far beyond 6k years. Lest you try to jjump up and say that god made 36,000 individual snowfalls in a day or two or some other crap like that, there are numerous ways to test that.

Volcanoes leave deposits in ice core samples. They also leave traces in tree ring samples. Tree ring samples can be a dating method by finding a tree that was cut when another was young and cross referencing events recorded in the rings (which also grow in yearly cycles. The events that cross-reference in both ice and tree rings are a check each upon the other. Of course, if you allow c14 dating as valid, there are also archaelogical sites which can correspond: eg vesuvius blows, we have a real, known date. The date is also recorded in tree rings and ice core samples and c-14 dating gives the right date too. We count backwards in the tree rings untill we get past Rome and find that the years of other events still correspond to ice core samples and poof! ® we get past your 10k years and whoosh! ® out goes the wind from your skull.

That was easy.

Also, your flood doesn't have a single corresponding sediment layer over the earth. Also your flood story is a fable. Also your god story is a fable. Also your circularity argument is dumb because it assumes only one way to check dates (rm) of which I just showed you there are others. But don't take my word for it. Go out and find out!

And when you find some aig crud about dendochronology or ice core samples, go discover that sediment works the same way and cross-references yet again that the ice cores and tree rings are correct!

Then, once you are all twisted like a pretzel, go do something hedonistic, reflect on how good it feels knowing that god doesn't care.

:)

Dipshit. You lose. Why are you picking out complicated stuff when your theory is disproven by very simple evidence?

Y'know, all this sciency stuff is gettin me down. DaveyDH, you lost. The earth is more than 6000y. Core samples prove it.
Nuff said.

Go ahead, try to poke holes. I'll fill em, patch em and paint em. You got nothing. Anybody here think I'm wrong?

hi davey.

Date: 2006/08/22 14:52:01, Link
Author: BWE
Paley, Y'know how i caught on? Did a google search for some of your quotes.

Date: 2006/08/29 09:02:08, Link
Author: BWE
Here's the deal daveyDH, (short for the childish moniker i use for you: "DaveyDickHead")

All we had to do was prove that the earth is more than 6k years old. I and others did this.

You can't get past core samples. Even though you've done an, well, amazing job of snatching fiction from the jaws of reality and moved around from one bizarre idea to another, you have not given one single positive proof of a young earth. Not one.

And that is because there isn't one.

And I've been to your church. Or one just like it. The guy on stage started by telling us ghandi is in he11. I suppose that is because ghandi said
 
Quote
I like your Christ, I do not like your Christians. Your Christians are so unlike your Christ.
Mohandas Gandhi
link

I tend to agree with Ghandi. I do not tend to agree with you. However, you have made me think that there is a deeper truth to another ghandi quote;
Quote
Evil is, good or truth misplaced.

And:
Quote
Faith... must be enforced by reason... when faith becomes blind it dies.

Date: 2006/08/29 09:06:15, Link
Author: BWE
You could let me moderate once in a while for fun. I'd do a bunch of neat stuff. Then you wouldn't have to take the heat but you could let your devils out for a jog now and then.

Date: 2006/08/29 11:50:37, Link
Author: BWE
Quote (BWE @ Aug. 29 2006,14:02)
Here's the deal daveyDH, (short for the childish moniker i use for you: "DaveyDickHead")

All we had to do was prove that the earth is more than 6k years old. I and others did this.

You can't get past core samples. Even though you've done an, well, amazing job of snatching fiction from the jaws of reality and moved around from one bizarre idea to another, you have not given one single positive proof of a young earth. Not one.

And that is because there isn't one.

And I've been to your church. Or one just like it. The guy on stage started by telling us ghandi is in he11. I suppose that is because ghandi said
 
Quote
I like your Christ, I do not like your Christians. Your Christians are so unlike your Christ.
Mohandas Gandhi
link

I tend to agree with Ghandi. I do not tend to agree with you. However, you have made me think that there is a deeper truth to another ghandi quote;  
Quote
Evil is, good or truth misplaced.

And:
 
Quote
Faith... must be enforced by reason... when faith becomes blind it dies.

Um...

Date: 2006/08/29 12:42:49, Link
Author: BWE
Quote (BWE @ Aug. 29 2006,16:50)
Quote (BWE @ Aug. 29 2006,14:02)
Here's the deal daveyDH, (short for the childish moniker i use for you: "DaveyDickHead")

All we had to do was prove that the earth is more than 6k years old. I and others did this.

You can't get past core samples. Even though you've done an, well, amazing job of snatching fiction from the jaws of reality and moved around from one bizarre idea to another, you have not given one single positive proof of a young earth. Not one.

And that is because there isn't one.

And I've been to your church. Or one just like it. The guy on stage started by telling us ghandi is in he11. I suppose that is because ghandi said
   
Quote
I like your Christ, I do not like your Christians. Your Christians are so unlike your Christ.
Mohandas Gandhi
link

I tend to agree with Ghandi. I do not tend to agree with you. However, you have made me think that there is a deeper truth to another ghandi quote;  
Quote
Evil is, good or truth misplaced.

And:
 
Quote
Faith... must be enforced by reason... when faith becomes blind it dies.

Um...

Ah, Davey? Core samples?

Date: 2006/08/29 13:38:38, Link
Author: BWE
Methinks DaveyDH will not return. That is pretty rough stuff he's involved with. The fundy program:

10 lie for jesus
20 change the subject when called on the lie
30 lie again and again,
40 var=get in too deep
50 if var=true goto line 70
60 goto line 10
70 go somewhere else and lie to someone new
80 goto line 10

Core samples? DaveyDH, you are a very bad man.

Date: 2006/08/30 06:01:36, Link
Author: BWE
me (a ways back)
Quote
Well then, we need look no farther than core samples.

first, ice core samples record the passing of years in seasonal snowfall. They go far beyond 6k years. Lest you try to jjump up and say that god made 36,000 individual snowfalls in a day or two or some other crap like that, there are numerous ways to test that.

Volcanoes leave deposits in ice core samples. They also leave traces in tree ring samples. Tree ring samples can be a dating method by finding a tree that was cut when another was young and cross referencing events recorded in the rings (which also grow in yearly cycles. The events that cross-reference in both ice and tree rings are a check each upon the other. Of course, if you allow c14 dating as valid, there are also archaelogical sites which can correspond: eg vesuvius blows, we have a real, known date. The date is also recorded in tree rings and ice core samples and c-14 dating gives the right date too. We count backwards in the tree rings untill we get past Rome and find that the years of other events still correspond to ice core samples and poof! ® we get past your 10k years and whoosh! ® out goes the wind from your skull.

That was easy.

Also, your flood doesn't have a single corresponding sediment layer over the earth. Also your flood story is a fable. Also your god story is a fable. Also your circularity argument is dumb because it assumes only one way to check dates (rm) of which I just showed you there are others. But don't take my word for it. Go out and find out!

And when you find some aig crud about dendochronology or ice core samples, go discover that sediment works the same way and cross-references yet again that the ice cores and tree rings are correct!

Then, once you are all twisted like a pretzel, go do something hedonistic, reflect on how good it feels knowing that god doesn't care.


DaveyDH
Quote
You say "I AM happy, you moron!"  Really?  Most of you don't SOUND very happy.  It sounds like you are extremely frustrated and disgusted with "my ilk" and "fundies" in general because they're "taking us back into the dark ages" and "choking science" and "setting up a theocracy" and so on.  

So if you are happy, wonderful.  I'm happy that you're happy!  But just look back over these 170 pages sometime.  What you may find is that you are a bitter, unhappy individual.  And my hope for you is that you will find the ultimate reason for ANY human being to be bitter, unhappy, empty and unfulfilled in their life:  a broken or non-existent relationship with their Creator.

The truth of the matter is that ...

1) There really is a Creator of all things
2) And He has spoken
3) And He wants a relationship with the Humans He created
4) But we have rejected Him and want to be ruler of our own lives
5) The end result of this rejection would be disastrous--the Bible calls it He11
6) But God provided a way of escape
7) It's a well known story--a strange one to be sure, but well known by many in the Western world--the story of Jesus

And you are a sucker.

Read this book DaveyDH.

You've been duped. I am happy to be able to have the full range of emotional responses to your brainwashed ramblings.

I am happy to be mad. I am happy to be so depressed that all I can think about is making you unhappy so that I can share my depression.

Oh who am I kidding. DaveyDH, of course you are right. The void in my heart is shaped like a god. I want you to tell me how to fill it. I can't stand this constant pain that I feel knowing that there is only one set of footsteps in the sand for me. And DaveyDH, I am terrified of he11. I don't want to be stuck for ever in torment like what I feel now. I want to know that at the end of this tortured road there will be bliss.

DaveyDH, being as I never had any religion so now I have to choose one, and being as there are so many good ones to choose from, how should I proceed? What do I need to do to narrow the field so I can figure out which one is the one true religion? DaveyDH, I really need your help. I'm lost and I'm going to he11. I'm scared.

Date: 2006/08/30 06:23:47, Link
Author: BWE
Quote (afdave @ May 17 2006,10:10)
Quote
How is a 'supernatural agent' explanatory?
it appears to be words strung together and declared an explanation rather than being an explanation.
You do know what an explanation is, don't you?

Second question:
given the examples you've provided, we must assume that God is physical and is, in fact, embodied as a matter of essential nature.
Otherwise, you undercut your recourse to "it's like human intelligence but more so" -- the only examples of intelligence we have or can legitmately conceive are embodied.
Intelligence is always action in the world.

Finally, please deal with the apparent fact that the world is causally closed.
You are correct that it is not explanatory in the sense that we know how the SA did it.  But please note that the 'Gods of Evolution' -- i.e. Millions of Years and RM/NS also do not have any explanatory power in the sense that you use.  I know you all try very hard to make it look like you have explanations, such as the stack of books displayed at the Dover trial, but these are nothing more than fancy "Alice-in-Wonderland" just so stories of how you wish it happened, or how you think it might have happened, or whatever.  None of this stuff can be demonstrated experimentally and when you have tried to demonstrate evolution experimentally, we have just the opposite of what you predict, i.e. dead and damaged fruit flies, etc.

Take my Creator God Hypothesis, on the other hand.  While admittedly we have no idea HOW the Creator did the things He did, at least we are honest about this and don't make up fairy tales about how we think He might have done it, unless we come across some experimental evidence that gives us a good reason to believe He did some piece of it in a certain way.  My Hypothesis fits well with observed phenomena in the universe which we live in and predicts many things which actually have turned out to be true as more knowledge has been gained.  My Hypothesis (the YEC has position) also has not changed over the last 140 years as yours has, and I doubt it will change.  As more information turns up, the YEC position will continue to be explained more and more fully and will itself explain more and more phenomena.

I don't follow why we must assume that God is physical.  I don't think I said "it's like human intelligence but more so."  I think I said that my hypothesis proposes that the Mind of God is like human intelligence in some respects, but far, far more advanced and powerful in its computing ability (or something like that).

Causally closed?  Please explain.

Return hugs,  AFD.

 
Quote
Im not sure this applies to nature. What does happen all the time is people use the principles of evolution.
For what?  I hear Evos claiming that to reject ToE is to reject progress and scientific productivity.  The only thing productive that I know of that comes out of ToE is Designed Adaptability and Natural Selection (which you call ambiguously ... 'evolution';), i.e. we now understand that bacteria adapt to anti-biotics and develop resistance and this helps us by prompting us to develop new anti-biotics, etc.  Here's a suggestion from a progressive minded YEC:  instead of trying to 'stay one step ahead' of the bacteria, how about we all recognize they were designed and then chase after a smarter way to defeat them more permanently than just developing a new anti-biotic every year.  That's just one suggestion.  There are many more.

 
Quote
You're dangerously misinformed and a perfect example of everything that is poisonous about Christianism, fundamentalism and the intelligent design movement.
You don't know logic.
You don't know what a scientific explanation is.
And when things are explained to you they don't penetrate your mental barriers.
And yet, you would have the arrogance to replace this mightly success that modern science is with your vague and backward notions of theology.
I hope one day you'll become a witness in another Dover type trial.

Yes. I'm dangerous and so was Newton and Maxwell.  Look out world!

 
Quote
No, Dave. Wrong, Dave. Saying a "Supernatural agent did it" explains exactly nothing. In fact, it's the ultimate admission of intellectual defeat. When you ask, "What caused this particular natural phenomenon?" and answer, "A supernatural agent did it," that's exactly equivalent to saying "I have no idea whatsofuckingever what caused it."
See response to Shirley's question on this thread.  I have also answered this criticism on the "Ape" thread.  Please re-read it.

 
Quote
You keep saying your "hypothesis" is "science," but in fact it's a "science killer." It annihilates any inquiry into how something actually happened, or what its cause was. If the answer to every question really was, "God Did It," we'd all still be living in caves.

I always think it's funny when Evos try to imply that "Their Blessed Theory" ToE is somehow responsible for all that is good in science, when in fact, the opposite is true.  The General ToE is in reality a "black eye" on the otherwise beautiful face of science. Have you never read the actual writings of the founders of modern science?  Do you really have no idea that most of them were theists?  Many of them YECs?  Living in caves!  What a hoot!  This is like Clinton bragging about the economy being so good when he had nothing to do with it.

Outta time.  Gotta run.  Tomorrow ... drum roll ...

Morality.  Why do we all have a sense of it?  Why do none of us live up to it perfectly?  Where did it come from?  How does this phenomenon give support to the Creator God Hypothesis?

Psychology ... that's science, right?

Reading assignment for tonight:  Mere Chrisitanity, Part 1 - Right and Wrong as a Clue to the Meaning of the Universe, by C. S. Lewis.

See you tomorrow!

I just wanted to repost this doosie.

Date: 2006/08/30 06:32:20, Link
Author: BWE
Quote (deadman_932 @ Aug. 30 2006,11:21)
Hah! You're a madman, BWE. The good kind. I have to respect that.

Awww, that's the nicest thing anyone has ever said to me DM. Thank you so much. *sniff..*

Date: 2006/08/30 06:54:07, Link
Author: BWE
Um... Er... DaveyDH? I'm not sure how to say this but, I wasn't exactly laughing with you.

And By the way, Core samples prove an old earth therefore your whole thing is shredded.

And, DaveyDH, does mastubation make you go blind?

Date: 2006/08/30 07:58:27, Link
Author: BWE
New ones?

Date: 2006/08/30 12:34:00, Link
Author: BWE
Hi DaveyDH,

Core samples blow your theory. If all we need to do is show that the earth is more than 6k years old, we don't need any more than simple graphing skills to blow your theory all to he11  ;)

Guys, help me out here. We can do this without all this complicated stuff like multiplication and division and particle physics and stuff. Core samples. Earth is at least 40k years and down goes DaveyDH's ship. No?

gOD, I don't want to go to he11. I repent. Oh really I do. Which god do I choose though? THere are so many. Ohhh... my head hurts. Why can't I find something to fill that god shaped hole in my heart?

Is there a god that still let's me eat pork, drink whiskey and allow my neighbors all their vagarities?

I want a new drug. one that won't hurt my head. One that...

Date: 2006/08/30 13:24:32, Link
Author: BWE
Right! Thanks Ich,

DaveyDH,

 
Quote
In the first drilling season in 1990, the drill reached a depth of 770m where the ice is 3840 years old. In 1991, the drilling continued into 40,000 year old ice at a depth of 2521m, and on 12 August 1992, the drill hit bedrock at 3029m below the surface, where the ice is 200,000 years old or more. The core is now stored in a cold house at the University of Copenhagen. The GRIP deep drill is an updated version of ISTUK (IS means ice in Danish, TUK means drill in Greenlander). ISTUK was constructed in 1978 and used successfully under the American-Danish-Swiss GISP 1 program at Dye 3 in South Greenland where it hit bedrock at a depth of 2037m in 1981.


K. Makinson
Although the actual drilling was completed in 1992, there was a last short field campaign in Greenland and at Summit to measure ice sheet strain parameters and to extend upward the GRIP hole so that detailed temperature and deformation measurements will still be possible. Using the experience accumulated through GRIP and the facilities of this last campaign, the successful development and testing of a special drill for the European Project for Ice Coring in Antarctica (EPICA) was also carried out. This new European drill will be able to operate in the much harsher environmental conditions to be found at Dome Concordia in Antarctica.

Dating the GRIP Core
It was possible to count annual layers in the GRIP core to obtain an excellent dating, particularly back to the Younger Dryas period. Parameters used to date the core included ECM, dust, nitrate and ammonium, which all give excellent annual layers, particularly in the Holocene period. Comparison with the previously dated Dye 3 core, using volcanic and other tie-points, provided a starting point. Numerous volcanic eruptions were documented, allowing the possibility to make comparisons with other cores. Deeper ice was dated using ice flow models.
link here

Ok DaveyDH, go ahead and start with how a bunch of layers happened all at once. Pleeeease.

Or, oh, oh, I got it, tell us how the scientists were counting wrong, or how they faked it or how it's all wrong somehow.

To save you a little time (I bolded the part you probably want to start from):
 
Quote
First, volcanic ash signatures beyond about 200 years are equivocal for a number of reasons, especially because the historical record older than 200 years becomes more sketchy the older the eruption. 2,000 years seems to be the maximum for which any volcanic ash signal and the historical record can be correlated.3 Hammer, who was the first scientist to use volcanic signatures, states:

   The use of volcanic reference horizons in ice cores, however, has not been widely used. The reason is twofold: First, before volcanic horizons could be used for dating purposes it was necessary to establish a time scale independent of any subjective interpretations of the volcanic signals (by seasonal variables). Second, the information on past volcanic eruptions is limited and the dating of the eruptions is not very precise, apart from certain well-documented historical eruptions.4

Second, the use of climatic cycles from the astronomical or Milankovitch ice age theory (Ross’s second and fourth indicator above) is an exercise in circular reasoning.5 Both the Greenland and Antarctic ice cores are tuned to the deep-sea cores, which are dated assuming the astronomical or Milankovitch ice age theory:

   Taking advantage of the fact that the Vostok deuterium (&#948;D) record now covers almost two entire climate cycles, we have applied the orbital tuning approach to derive an age-depth relation for the Vostok ice core, which is consistent with the SPECMAP marine time scale [from deep-sea cores] … The deep-sea core chronology developed using the concept of “orbital tuning” or SPECMAP chronology … is now generally accepted in the ocean sediment scientific community.6

“Orbital tuning” refers to the cycles in the astronomical theory. This quote is referring to the first two cycles in the Vostok core, but since then, glaciologists have drilled deeper at Vostok and added more cycles from Dome Fuji and Dome C—clear to the ninth cycle in Dome C. This is how the Antarctic ice cores are dated—simply by curve matching with deep-sea cores! Annual layers cannot be derived from ice cores drilled on top of the Antarctic Ice Sheet, as implied by Ross, since the snowfall rate (less than 5 cm of water equivalent per year) is too light for annual layer dating. As far as the strong oscillations in &#948;D, presumably correlated to temperature, in these Antarctic cores are concerned, Oard suggests that they are similar to the large oscillations in the “Greenland Ice Age” portion of the cores but with higher amplitude.7

Further evidence of circular reasoning, via tuning the ice core chronology to the astronomical ice age theory, is shown in the Greenland ice cores. This was demonstrated when Deborah Meese and colleagues first dated the GISP2 core by “annual layers” down to the 2,800 meter level at 85,000 years BP (before present).8 However, the date at this level disagreed with the deep-sea cores and the astronomical theory, so the layer between 2,300 and 2,800 meters was “remeasured” to a finer resolution. They found 25,000 more annual layers in that 500-meter interval to arrive at 110,000 years at 2,800 meters, just as expected from the chronology from deep-sea cores!9

Glaciologists do measure annual layers near the top of the Greenland ice cores, but deeper down the cores they are picking up subannual layers (storm layers and other variations). The uniformitarian scientists are simply assuming the ice sheets are old, and so “old age” is what they find. Creationists have an alternative interpretation in which the post-Flood rapid Ice Age causes very thick annual layers during the Ice Age followed by a decrease to the current annual snowfall of today.2, 10–14
AIG link

Of course, you could follow your tactics of just acting insane and hope we give uyp in disgust but I think this one is too easy. Hmmm... Did I really say that?

Date: 2006/08/30 14:27:48, Link
Author: BWE

Quote
Where do bad folks go when they die?
They don't go to heaven where the angels fly
go to the lake of fire and fry
see them again 'till the fourth of July

-the meat puppets (redone by Nirvana)

This is my personal favorite. I really don't want to go to he11. This is what happens there. I know. I've seen the paintings and read the inferno (not in italian... or portuguese for that matter). I read my 700 club:
Quote
Is #### A Real Place?
By CBN.com

CBN.com -- WHAT IS #### LIKE?

There are two descriptions of #### in the Bible. One is of a burning fire. Jesus often used the word GEHENNA to describe ####. Gehenna was the refuse dump outside Jerusalem that was always on fire. Jesus said #### was a place of worms, maggots, fire, and trouble. From that we get the image of a lake of fire and the concept of perpetual burning. The evil ones there are full of remorse and torment (see Mark 9:43-48).

Jesus also said that #### would be "outer darkness." He said that some in His day "will be cast out into outer darkness. There will be weeping and gnashing of teeth" (Matthew 8:12, see also Matthew 22:13). Here the image is one of terrible loneliness. There will be separation from God and man. Those who are consigned to #### will be put out into the inky blackness of eternity, with nobody to turn to, nobody to talk to, and they will be constantly alone. They will suffer the remorse of knowing they had the opportunity to come into heaven with God but turned it down.

The Bible speaks of a lake of fire reserved for the devil and his angels (see Matthew 25:41). Human beings were never intended to go into ####. But the ones who choose to reject God will one day follow Satan right into ####.

There will be no exit from ####, no way out, no second chance. That is why it is so important in this life to receive the pardon that God extends to all men through the cross of Jesus Christ.
he11 -700 club style
Boy they sure swear alot at the 700 club

Date: 2006/08/30 18:43:26, Link
Author: BWE
That's because your an idiot.

turns out revelations is a political tract regarding nero.

fundies. can't live with 'em, can't feed 'em to the lions anymore.

Date: 2006/08/30 18:58:07, Link
Author: BWE
S TJ,

Dija ever get a hold of those folks?
DaveyDH has brought out the little devil in me again.
:O

This thread suddenly seemed appropriate to me again.

Date: 2006/08/30 20:22:53, Link
Author: BWE
Quote
Quote (afdave @ Aug. 30 2006,12:55)
Ved wins today's award for "Most Creative Post" ... good one, Ved.

And you win everyday's award for most obvious small penis complex and general stupidity. :)




Congratulations DaveyDH.

That would be the MOSPC award and the GS award for those who prefer to use the acronyms at a later date.

Date: 2006/08/30 20:54:02, Link
Author: BWE
Quote
The deal between the Democratic-controlled Legislature and the Republican governor, Arnold Schwarzenegger, calls for a 25 percent reduction in carbon dioxide emissions by 2020, and could establish controls on the largest industrial sectors, from utilities to oil refineries to cement plants.


Quote
The governor, whose popularity plummeted after a group of polarizing ballot initiatives failed at the polls last year, has been steadily pedaling to the left for months, supporting legislation to increase the state's minimum wage and to make some prescription drugs more accessible.

one link randomly selected

My dad knew one of the state auditors or maybe the treasurer, i forget, when arnie was elected. According to da's friend, terminator actually believed ayn randian and friedmanic rhetoric. He immediately gutted an already broken system thinking that it would be eutopia.

If that take is true, might this (and I have to add his solar initiative which he should get credit for too) be a case of someone hypnotized by the flashing lights (like some folks are with extreme politics or religion) but who actually can recognize when outcomes aren't meeting expectations? ANd then modify their thinking?

Is it possible he is an honest elitist? (semi-honest, I do remember the enron rumors and he is in politics after all)

How does it look from Cali? (That would be you Ick.)

so- to summarize, 2 questions:

1) is it a case of "once was blind but now I'm starting to see"? That might provide hope in this fundy-infested swamp we call life.

2) What do you think of the guy now that he's done some stuff?

Date: 2006/08/30 21:51:04, Link
Author: BWE
beautiful summary. thanx.

-> more about science and reality stuff he did
1 solar initiative
2 stem cells
3 greenhouse emmissions cutting

those are better'n a lot of dems no?
am i missing info?

Date: 2006/08/31 05:54:28, Link
Author: BWE
Quote
1 solar initiative
2 stem cells
3 greenhouse emmissions cutting


THat's #2 :)

I forgot about the Nat'l guard thing though. And that's just what I mean. Whereas Bush the lesser when faced with a choice chooses the option from the "wrong" column, arnold appears to be choosing from the "right" column. He's listening to silicon valley repubs maybe more than lockheed repubs now?

I mean, I'd vote for a guy who favors city planning over sprawl, science over ignorance, peace over war and environmental protection over rape and run republican normalcy.

I'd like a guy who outlawed private prisons too but hey, the above is the core of a good platform to me I guess.

Date: 2006/08/31 06:05:34, Link
Author: BWE
Ok DaveyDH,
Now that I'm in the search for the one true god ®, I'm down to number 37 and that's the christian god. I was trying to remember who I knew that knows basically anything about christianity and suddenly I remembered, "OH Yeah! DaveyDH knows about christians". You see, normally I don't associate with christians since they seem to be a dishonest myopic bunch for the most part. But I know you DaveyDH. So I figured I could ask you some questions that have me flummoxed.

1) What's with the trinity thing? Is it one god, or 3 gods?
2) Do you really have to do the whole accepting christ thing or can you just put one of those little fish thingies on your car?
3) Why again did we need a new covenant?

Thanks in advance. I appreciate all your help in this matter.

Date: 2006/08/31 07:33:52, Link
Author: BWE
Diogenes,

Ouch. I've been properly chastized. :)  I just can't bring myself to be thorough in the face of DaveyDH. I just reread some of revelations a few weeks ago in light of the greek manuscript that they just deciphered. How anyone can ... oh well...

Neat info though. Thanks.

Greying punk rockers. Double ouch. God save the queen eh?

I also just watched Dawkins' "The root of all evil" and I'm a little jaded at the moment. It'll fade I suppopse.

Date: 2006/08/31 08:19:14, Link
Author: BWE
I've always thought it was a good idea to have the executive and legislative on opposite sides of the spectrum.
ial
Now if we could only shut down the military-industrial complex's control over both. ???

Date: 2006/08/31 09:52:09, Link
Author: BWE
Wow Ved, Violin. Hot diggity dog.

I got outta the rock and roll business :) a while ago. Now I am in a nominally acoustic band doing all originals.

Fun.

Date: 2006/08/31 09:54:14, Link
Author: BWE
Wow Ved, Violin. Hot diggity dog.

I got outta the rock and roll business :) a while ago. Now I am in a nominally acoustic band doing all originals.

Fun.

Date: 2006/08/31 22:08:49, Link
Author: BWE
**My Psychic prediction, inspired by the buddha who made the sun and moon*

Water will be the global issue of the coming century. CA is not alone. Have you heard the term "breadbasket" referring to the midwest? The Ogallala getting salinated would just ruin our day. And we wouldn't even need to live there. Not to mention Hanford and the Columbia, The Volga, The Yellow river, Ganges and etc watersheds being polluted or otherwise threatened in terms of water safety for humans.

Arnie has his work cut out. QUestion is for me more like "will he do it now or is it just lip service?"
From here in Oregon it looks like the burden of leadership was a shock to him and he is trying to do the right thing now. If so, maybe he'll figure out how.

P.S. housing has gone up here too. Even Bellinham WA (Tiny college town near Canada) has a normal house in town going for 350k. Where the heck do the folks get the $ there?

Date: 2006/09/01 07:44:13, Link
Author: BWE
Point of B-ham is that it's a tiny dot in the middle of nowhere with barely any industry. It's got a college not much else.

You could buy a little house here in Portland for that much.

But Cali- that's another story. Prices go up when people own more than 1 maybe? Hard to say. It looks like a wasteland S of Santa Cruz to me. I can't imagine living there. Not to knock those who do, it just isn't me.

Environmental problems are big problems. We were just instructed to ignore the findings of the only serious research done in the 21st century on Halibut stocks and nutrient requirements. Reason? Politically unpopular.

Won't be long till the West Coast starts to look like the Grand Banks. We'll be paying as much for wild seafood as we would for a house in SF.

Maybe we should try for another tax cut.

Date: 2006/09/01 07:51:25, Link
Author: BWE
Eyeballs, functioning synapses and a wee bit of childhood brainwashing.

It didn't happen, everyone who has checked it out honestly has discovered this Dave. Fundies just don't happen to have honesty as one of their strong suits.

Broad generalization. Still true.

Date: 2006/09/01 08:41:12, Link
Author: BWE
It's a couple minutes of extreme discomfort. For a lifetime of fun? It's worth it.

I had a scary experience once in Puget sound just off lopez island where I got tangled underwater. I really wasn't sure if I could get out in time and I at first thought "why did I get into this mess?". But then I decided to just keep trying and I did get unstuck although I lost a bit of gear and a knife that my Grandfather gave me.

But the story I tell other people is that God appeared in a blaze of white light, split the bay for me and guided me to firm ground. And in payment, he accepted some of my gear and my knife. (I didn't tell that one to the folks on the boat, they would have known it was a lie.) When Jesus and the holy ghost showed up to share the loot, they flew off into the sky up to a particularly pretty cloud. It looked like a bunny.

But now all the good churches include it in their list of miracles proven by evidence.

Date: 2006/09/03 10:17:05, Link
Author: BWE
I had to tell Poppers ghost that he had a hole in his head and his brains were leaking out. He sincerely took offence.

The first time I had even looked at PT in months and I tried to make a little point but was slightly inebriated and missed my mark some. I would have been happy to go back some but he jumped up and made an ass of himself so I had to have just a wee bit of fun at his expense.
link to thread

Unfortunately Matt Young had to stop comments over it.

I agree, civility has a place at AtBC.

Any comments on my comments at PT are welcome.
I would be tickled if someone else thought he had a hole in his head and his brains are leaking out too.

Date: 2006/09/03 10:33:46, Link
Author: BWE
Quote
As for my fatih, the minister that I remember most fondly was a scholar of the Spanish Mystics, and I was influenced by him to study Kiekegaard, Schopenhauer and Unamuno, not a bad group to be influenced by.


Meaning that existential questioning was encouraged. That leads to enlightened* thinking. I think it is safe to say that fundies are not spending a lot of time reading things other than the bible and bible apologetics. And that is the root of the problem and, in fact, the point of this thread.

If kids started reading instead of watching tv and read alot, they would be exposed to enough ideas to vaccinate them against fundy myopia.

Aside: I was in college when I first discovered Christians were real. No kidding. It came as a shock. I thought education cured that issue 100%. I thought it was a way for uneducated people to explain stuff they didn't understand and I also thought they didn't take it seriously.

*open minded

Date: 2006/09/03 10:56:04, Link
Author: BWE
Quote

Avenging angel of the religious right
Pages 1 2 3 4 5 6

In 1992, Ahmanson banded together with four right-wing businessmen to back the campaigns of anti-gay, anti-abortion, pro-big business candidates; two years later, they scored their first major victory, propelling the GOP's takeover of the California Assembly. With $3 million funneled through seven pro-business, anti-abortion and Republican political action fronts, Ahmanson and company captured a startling 25 of the GOP's 39 legislative seats for their candidates. Their push ushered two important movement cadres into power: Tom McClintock, a veteran activist and former director of economic and regulatory affairs of the Ahmanson-funded libertarian think tank Claremont Institute; and Ray Haynes, an unknown lawyer from another Ahmanson-funded group, the Western Center for Law and Justice, which once filed a brief defending a local school district for banning Gabriel Garcéa Marquéz's novel "One Hundred Years of Solitude."

Upon seizing power, McClintock sponsored a bill returning the death penalty to California, while Haynes led a failed 1995 attempt to ban state funding for abortion and numerous futile fights to block anti-hate crime and domestic partnership legislation. In 2003, the two Ahmanson cadres became instrumental figures in propelling the campaign to recall Democratic Gov. Gray Davis. In March 2003, Haynes personally convinced a fellow arch-conservative, U.S. Rep. Darrell Issa, to bankroll the recall ballot qualification. After the recall qualified with the help of $1.7 million from Issa, McClintock entered the recall campaign, ultimately finishing third as the token cultural conservative. As in 1992, Ahmanson's camp provided the groundwork for McClintock's campaign: John Stoos, an avowed Reconstructionist associated with Chalcedon, served as his deputy campaign manager, and Ahmanson hosted some of the most prominent leaders in the Christian right for a fundraiser in Colorado in September that, according to the Los Angeles Times, raised $100,000 .

To complement his electoral efforts, Ahmanson has pumped enormous amounts of money into ballot measure committees, dramatically altering California's social landscape in the process. In 1999, Ahmanson helped to sharply restrict affirmative action in California with a $350,000 donation to Proposition 209; that same year he helped ban gay marriage with a donation of $210,000 -- 35 percent of all total funds -- to Proposition 22. To avoid giving voters the impression that Prop. 22 was somehow anti-gay, its "Protection of Marriage Committee" spent nearly half of Ahmanson's donation on billboards presenting the measure as "pro-family."

Despite his penchant for behind-the-scenes string-pulling, Ahmanson's anti-gay campaigns have attracted close scrutiny by Jerry Sloan, a Sacramento gay-rights advocate and founder of Project Tocsin .

"Ahmanson's financing of these various initiatives both statewide and locally and his financing of anti-gay legislators who fight tooth and toenail against any legislation that would protect people or enhance our rights as citizens has made the struggle for our rights probably two or three times harder than it should be," Sloan told me. "I can't think of anybody who's more dangerous to the average Californian than Howard Ahmanson."

Link to Salon Article

Robert Obrien,
What do you think of global warming, peak oil, deforestation, and land salinanization in terms of large problems that we should be dealing with politically?
-I only know a few repubs of the McClintock variety.

Date: 2006/09/03 12:06:10, Link
Author: BWE
Norm did a good job too. But it was PG that really rose to the occasion for me.
Quote
Meditation and reflection are not elements of the scientific method. Let us know when you figure out what are.

Quote
Give it up, Norm; the layers of intellectual dishonesty are too thick to penetrate.
referring to folks who were not in agreement rather than folks who were being ID (intellectually dishonest)
Then, in response to my mention of the Tao of Physics:
Quote
In response to the nonsense about “The Tao of Physics”, I offer this statement from Murray Gell-mann:

Followed by a quote mine that was substance-less.

Then the doosie.
Quote
   
Quote
(BWE) Well, if that’s what they really think, then I have to agree that they are probably wrong.


Why? Can you prove it? Can you prove that I’m not the reincarnation of Marie Antoinette? I remember the terror of having the blade fall, but it was such a shock to my psyche that everything that preceded that is rather hazy. I was then reincarnated as Karl Popper, who died, and I am now his disembodied spirit, occupying the body of some poor geek and making him type these messages. Can you prove otherwise?

Catholicism too is willing to change if science (or rather, the empirical observation that science makes possible) proves it wrong. The Bible is truly the word of God, but only “symbolically”; it was written by real men inspired by God. The Eucharist is really and truly the body and blood of Christ, despite lacking his DNA. Mary was immaculately conceived, though she had flesh-and-blood parents, and then gave birth to Jesus without the involvement of a biological father – hey, science can’t prove otherwise. Jesus died, then was resurrected – hey, science can’t prove otherwise. Despite a fairly strong historical case that no such person as Jesus existed, it’s not a proof. If it were possible to build a machine that could view the past, it would at first be resisted, perhaps by arguing that it viewed an alternate universe, but if all the observations exactly coincided with historical records, yet there were no observations of Jesus, he would likely be recast the Catholic church – or perhaps the New Modern Catholic Church – as allegorical: the ideal human that God wants us to aspire to.

Science can’t prove that humans never rode on the backs of dinosaurs, and it can’t prove that the flagellum evolved. But science isn’t in the business of proof, only inference to the best explanation. Religion, including Buddhism with its dharma, are based on a different epistemological principle – authoritative assertion, aka dogma, aka “revealed truth”. But everyone, of any religion or no religion, uses the same epistemological principle as that of science – though less rigorously – in everyday life to determine whether it’s true, say, that their spouse is cheating on them, that the pedestrian is going to step off the curb into their path, that they have time to run a quick errand before the kids get home, etc. I think everyone knows down deep that authoritative assertion is not a reliable source of truth.


once again, missing the point or even possibly getting the point but being assholish about replying.

So I replied with my next 2 posts:
Quote
Wow, blood in the water? I make too many assumptions. Ha, If you only knew. You might even be shocked and offended.

Main Entry: prob·a·bly
Pronunciation: ‘prä-b&-blE, ‘prä(b)-blE
Function: adverb
: insofar as seems reasonably true, factual, or to be expected : without much doubt is probably happy> it will probably rain>

What school did you say you were just starting at?

I know one thing for absolute certain fact but it’s a secret that I only tell my friends.

You also have a hole in your head that your brains are leaking out of.

Cheerio!
-------------------------------------------------
Comment #124947

Posted by BWE on September 1, 2006 12:55 AM (e)

STJ,
Hmmm. To me it seems like scientifically testing for “Happy”. I was being exceptionally general and it was a misstatment. I tried to clarify but, as I noted above, I failed. Well, no harm there I hope. I may be simply off my nut. That’s OK with me. I am in many other ways too. ID makes claims of fact. As far as I know, zen does not. Admitted, I am a bit hedonistic to be a monk or even to make a claim to be really living the whole practice, but things being what they are is pretty much ok with me.

In the interest of my deep caring for Norm and popper’s immortal souls, I do feel that I should use the whole quote rather than just the tail end.

  <quote> Er… Since I am grossly oversimplifying anyway, buddism uses the scientific method to explore consciousness through meditation and reflection. More to the point, the 2 are on the same path.</quote>

And then went on unsuccessfully to try to explain myself in that it is an open minded process that other’s who understand it can analyze your experience. It is not scientific. It was an abjectly failed analogy.

I am glad that you all are so gracious in helping me walk the straight and narrow.


to which pg replied:
Quote
Comment #124950

Posted by Popper's ghost on September 1, 2006 12:59 AM (e)

BWE, I can’t make much sense of your drivel, but it seems personnally directed and offensive. That you give me a definition of “probable” suggests that you didn’t read my post or didn’t comprehend what I wrote about inference to the best explanation.
To which I replied "Seems?"
And the rest of the thread excersized the SLoT.

Date: 2006/09/04 11:07:43, Link
Author: BWE
Quote (Robert O'Brien @ Sep. 03 2006,18:18)
Quote (BWE @ Sep. 03 2006,15:56)
Robert Obrien,
What do you think of global warming, peak oil, deforestation, and land salinanization in terms of large problems that we should be dealing with politically?
-I only know a few repubs of the McClintock variety.

Global warming--If the null hypothesis is that there is no global warming and the alternate hypothesis is that there is global warming, I think the cost of making a type II error is such that we ought to curb our "greenhouse gas" emissions even if some climatologists continue to dispute there is sufficient evidence to conclude global warming has occurred and continues to occur.

Peak oil--eh?

Deforestation--deforestation certainly concerns me and I think, on the whole, the government's management of our forests has been inept. I disliked Gail Norton as Secretary of the Interior and I am glad to see her go.

Land salinization--I'm afraid I don't know about this issue. I am alarmed by the loss of topsoil, however.

One thing you did not mention is power in CA. I would like to see a move toward decentralized micropower alternatives in the future.

Fair enough. Are you willing to sacrifice those ideals to make sure gays can't marry?
McClintock doesn't seem to have those kinds of issues at the forefront of his agenda.

Date: 2006/09/04 12:58:07, Link
Author: BWE
How ever many style points are available, that's how many he gets.

Date: 2006/09/06 07:23:35, Link
Author: BWE
DaveyDH,

Core samples from various annually marked things correspond and count up to more that 6500 years.

DaveyDH, figure out why the Dansgaard-Oeschger oscillations are calibrated the way they are. They are the ice record of the temperature fluctuations during the last ice age. We don't need to go back any farther than that to blow, BLOW your theory. Right?

So here is your challenge:
1) Figure out how the ice cores (just to the D-O oscillations) are calibrated. (Hint: use the oscillations in your research)
2) Figure out what a real scientist's objections to the following from AIG might be:

 
Quote
On the other hand, if the ice built up rapidly, as in the creationist model during the Ice Age, the annual layers would be very thick at the bottom and thin upward to the present average annual layer thickness. There would be some compression of ice during this short time, of course, but far less than the uniformitarian model suggests.2 Figure 12.4 shows these contrasting views of the annual layer thickness with depth.

The assumed thickness of the annual layers is important because it constrains the expected annual thickness in the measurements. The measurements can deviate a little from the assumed annual layer thickness but not by much. For instance, in the oxygen isotope method, uniformitarian scientists normally need eight measurements per annual cycle to pick up the “annual” signature. As an example, halfway down the GRIP Greenland ice core at about one mile (1,600 m) deep, uniformitarian scientists believe the annual layer thickness is 4 inches (10 cm).5 The measurements for oxygen isotopes would then be spaced every 1/2 inch (1 cm) apart.
Figure 12.4


Figure 12.4. The thickness of annual ice layers down the GRIP ice core on central Greenland, calculated according to the uniformitarian3 and creationist4 models.

Since the creationist model postulates an annual layer thickness significantly thicker, say 12 inches (30 cm) as an example, the uniformitarians have taken more measurements than needed and are, therefore, measuring multiple cycles of oxygen isotopes within one year. This is how the number of annual layers becomes greatly exaggerated.6, 7

As already stated, the uniformitarian and creationist estimates of annual thickness are much the same at the top of the Greenland ice sheet. The difference between the two models becomes more and more significant deeper in the ice core. Because of extreme annual layer thinning at the bottom of the core in the uniformitarian model compared to the creationist model, the uniformitarian scientists may be counting 100 layers that they think are annual. These layers in the creationist model may represent only one year.


(Hint: You could probably do this using only logic but don't worry, I don't expect that of you)

And DaveyDH, what would happen if you discovered that you were wrong? You know, the only evidence that you have that the bible was written by god is that someone told you it was. No evidence was ever given.

Well, I am like that too except I'm saying you are betting on a lame horse and I have evidence.

By the way, I'm laying a trap here. Just so you know.

But if you are right and the rest of the world is wrong, then I'll be the one trapped. And, if you can show me, through evidence, that this AIG article is a better interpretation of the data and the science of core samples is a worse interpretation of the data, I'll repent. And I'll go to a church service of the demonination of your choice. And I'll report back.

I suspect you will end up simply saying "I proved it" by pointing to the AIG article. That probably won't work. Just to let you know ahead of time.

Good Luck! May the best Tard win.

Date: 2006/09/06 10:43:23, Link
Author: BWE


"The Golden State Pagans"

Date: 2006/09/07 06:49:31, Link
Author: BWE
The other problem with this type of conspiracy theory is that so many people have been caught lying. And they keep doing strange things. And they are Cheney / Rove who are well known to be dastardly Machiavellian types. And and and.

It's too easy of a target. The conspiracy theories are as plausible as the "official" accounts so people who have never experienced massive ineptitude are forced to believe them.

I just googled 9-11 conspiracy and wow. Lot's of sites. And, they are often plausible given few facts.

I have never read much about this before so I don't have my info straight but the Conspiracy researchers appear to be using better math and so forth than the News and Gov't reports.

What are you going to believe? You are Joe mechanic, you know a little about the vote rigging, the secret energy task force, the NSA wiretapping, the lies before the war, etc. and someone points out the obvious inconsistencies in the official accounts so, being in need of an explanation, you take the one offered.

Date: 2006/09/08 07:49:02, Link
Author: BWE
Quote
Unable to compete in the world of free debate with transparent facts, liberals behaved like children this week, proving that in the end national security and even national identity are always subservient to their own ego, reputation and appearance.

It was pathetic, cowardly and sickening.

It is also far too typical.

Liberals, who in large part are people devoid of true substance and belief, who also have great contempt for God, morality and truth, are often unable to deal with facts that reflect poorly upon them. And using pathetic, self-serving, crybaby tactics is how they are commemorating this week, the fifth memorial of 9/11.
Nutjobs R Us

We will be editing articles from "Nutjobs R Us" for examples of magnificent phrasing and we will be looking at the idea of "Framing the Debate."

RRRRRIIIIINNNNNNNNGGG!!
Oh, darn, there's the bell. We'll see you tomorrow at Karl Rove Elementary. Bye. Suzie, your Dad's here to pick you up today.

Date: 2006/09/08 07:53:52, Link
Author: BWE
LInk Here
Quote
The woman, a WND reader and longtime Amazon customer, said she had submitted information that she had purchased "Harry Potter and the Goblet of Fire," she said she already owned "The Chronicles of Narnia" and she rated "Lady and the Tramp."

"Brokeback Mountain popped up in those recommendations," she said. "A film I had absolutely no interest in. So I wondered what had caused this film to pop up."

She made a "snapshot" of the page, too.

"I can't see any reason for these movies to bring up a recommendation for a movie about homosexual lovers unless someone in Amazon has an agenda (especially in the IT dept)," she wrote.

"It makes no sense to me that this would just come up without being selectively programmed to do so," she said.

Several messages left with Amazon generated only an e-mail response, in which the company repeated its published policy regarding recommendations.

"We display recommended items in several areas throughout our store. To make these suggestions, we determine your interests by examining the items you've purchased, items you've told us you own, and items you've rated. We then compare your activity on our site with that of other customers. Using this comparison, we are able to recommend other items that may interest you," the e-mail said.

"Your recommendations will change regularly based on a number of factors, including when you purchase or rate a new item, as well as changes in the interests of other customers like you."

It also suggested a website link for further information.

"Usually, there's a clear correlation between the recommendation and your previous purchases, ratings, etc," the woman wrote. "In movies, the connection is usually a leading actor, movie's genre, the director, etc. But this totally blew me away!"


Also, from a link "Brokeback Mountain: The rape of the Marlboro man"
Quote
The "Marlboro Man" campaign launched 50 years ago. Today, the powerful cowboy image is being used to sell us on another self-destructive product: homosexual sex and "gay" marriage.

...Four years later, Jack sends Ennis a postcard saying he's coming to town for a visit. When the moment finally arrives, Ennis, barely able to contain his anticipation, rushes outside to meet Jack and the two men passionately embrace and kiss. Ennis's wife sadly witnesses everything through the screen door. (Since this is one of the film's sadder moments, I wasn't quite sure why the audience in the Portland, Oregon, theater burst out in laughter at Alma's heartbreaking realization.)

I'm from Portland and I know the answer but its a secret. :)
oops, almost forgot the link

I mean, you can be sitting there discussing your latest needlepoint project with your welding buddy, and simply saying the phrase "Brokeback Mountain" can make you laugh.

Anyway, this post is also funcioning as a sort of a hat tip to Jason Spaceman for posting all the WND (Suspiciously close to WMD??) articles.

Date: 2006/09/08 08:20:20, Link
Author: BWE
Well past the time when that was useful information to me Arden.  ???  

As I tell the christians who come to my door, "it's too late for me, go up to the university and get 'em before theyr brains are turned to jelly. GodSpeed!"

Date: 2006/09/08 08:46:59, Link
Author: BWE
Quote (afdave @ Sep. 08 2006,13:21)
We'll see who's laughing 10 years from now ...

Deadman and friends?

Or the RATE Group ...

I can imagine William Jennings Bryant saying the same thing.




[very small font size]

Just before he laid down in his room that fateful day at the end of the movie.

[/very small font size]

DaveyDH, you are a very bad man.

Tell me about those beetle species. Five days per?
Or Monkeys?
Or Core samples?

The problem with the dating debate (and no you may not) is that you are simply too stupid to have this debate. There are too many part involved with Design of Experiments that you just don't get.

We need to take this a step back. Assume that RM dating cannot be held to be accurate. (C'mon guys, work with me here) Why does evry single scientific, independent method of dating ever devised come up with counts going back more than your 6500 years?

Why is the beetle and monkey thing so hard for you to do the math? How do kinds evolve and how fast do they do it.

Davey, you have no evidence. (Actually you have every bit of evidence ever collected but it's just pointing the wrong way.)

How can your brain be so small as to not recognize how wrong you are?

As Dawkins says in a movie he made, "It must be terribly lonely to suffer the delusion thqat you are napoleon because no one will help you to support it. But imagine the feeling of support you would have if you could walk in a group of several thousand people who all shared the same delusion."

You can't get past Core Samples DaveyDH. You will hit a brick wall there, I promise.

Date: 2006/09/08 10:36:04, Link
Author: BWE
Quote (afdave @ Sep. 08 2006,14:51)
Help!  Help!  Dave is demolishing our arguments against the Snelling papers ...

Quick!  Bring up dendro and ice cores and belly buttons!

Good gOd DaveyDH, You are simply too unaware of what constitutes rigor in science.

Ice cores and tree rings are good because the mechanics are easier for a guy like you. Remember, we don't need to prove 400k years, just more than 6500, right?

Date: 2006/09/08 10:46:54, Link
Author: BWE
Main Entry: 1lib·er·al
Pronunciation: 'li-b(&-)r&l
Function: adjective
Etymology: Middle English, from Anglo-French, from Latin liberalis suitable for a freeman, generous, from liber free; perhaps akin to Old English lEodan to grow, Greek eleutheros free
5 : People who in large part are devoid of true substance and belief, who also have great contempt for God, morality and truth. Often unable to deal with facts that reflect poorly upon them. Commonly use pathetic, self-serving, crybaby tactics.<Dang liberal>

Man, ouch. The truth hurts me Momma, make it go away.

Date: 2006/09/08 10:52:15, Link
Author: BWE
Quote (afdave @ Sep. 08 2006,14:07)
Quote
all we need is one (1) date in excess of 6,000 years to utterly disprove your young-earth "hypothesis." That's all it takes.
And the sad thing for you, Eric, is that you do not have a single real date in excess of 6000 years.  Too bad!  So sad!

Ice cores, huh?  You really think you've got a humdinger for me now, do you?  OK.  BWE.  That's what everyone else said too.

[sheepish grin]
Well, I wouldn't exactly call it a "humdinger" but...
Gawsh, thanks.
[/sheepish grin]

Date: 2006/09/08 13:37:10, Link
Author: BWE
Ha ha ha hahahahahahahaha.... ouch.

Jesus fucking chrisp daveyDH.

Like you won the portuguese thing. Without making a single post in debate. Even after I offered to take either side!!

hahahahahahahahahahahahahahahahaha...

You are winning if your goal is to look like an idiot.

You are winning if your goal is to demonstrate overcompensation for small penis size.

You are winning if you are delusional.

Hahahahahahahahahahaha... ouch...Hahahahahahaha!! :p  :p  :p  :p

Core Samples.
That should be easy. If you can show me that the earth is 6500 years old I'll repent. I'll go to church. I'll even start respecting religion.

And I'll tell people that you were the reason for my transformation.

Core Samples.

Date: 2006/09/09 10:01:19, Link
Author: BWE
Quote
No. No. And no.  Putting words in my mouth is not a good technique, Jon, just because you cannot make your case with your own positive information.  The rocks are NOT billions of years old.  Honest K-Ar dating is impossible, xenoliths or no xenoliths.  And the earth is probably 6000 years old.  Is that clear enough for you?


Jesus Crisp DaveyDH, Are you saying that 100% of Argon dates are wrong? Are you saying that 98.2% are wrong?

If I could be allowed to guess at what you mean, I would guess one of the following:
1. Because the method has flaws that are very difficult to control for in the laboratory, all dates that have been arrived at using the method are suspect.

2. There are logical fallacies built into the test therefore the test is not able to produce accurate results ever.

3. The Bible might claim that the world is 6000 years old therefore argon dating that contradicts this info must be wrong.

Is one of these what you are trying to say?


So, I have 2 questions. What if we could RM date a series of things at over 6000 years and then verify the accuracy using several other, independent dating techniques? Assuming we could do that, would you believe the Earth is more than 6k years old?

If you looked at the evidence and decided that it shows that the Earth is actually more than 6000 years old, how would that information affect your life?

Have you had a chance to look at the AIG article I posted about ice cores? Have you tried to figure out what a scientist might object to in the article?

Remember, if you can show me just that core samples don't demonstrate more than 6000 years of earth's history, I will convert to whatever religion you want me to. And I will publicly renounce my belief in (b)illionsofyearsism.

:)

Date: 2006/09/10 12:28:41, Link
Author: BWE
Hmmm. Been awhile since I was at college. Are there a disproportionate # of homos in science these days?

I thought they were just run-of-the-mill libruls. Not so much the fancy "city" type.

PS I've read a fair amount of the conspiracy stuff since this thread started (9-11 and normal neocon) Wow. Lots of stuff.

The "conspiracy theorists" have gone mainstream. When I was a kid they were about x-files stuff. Now they are about everything. Darn, maybe they are right. ;)

Date: 2006/09/10 18:57:34, Link
Author: BWE
Quote (afdave @ Sep. 09 2006,20:43)
Eric ...    
Quote
So who's going to "force" me to be a creationist, Dave? God? Doubt it.
Do you have a tongue, Eric?  Did you read the verse?  It said, "and that every tongue should confess that Jesus Christ is Lord, to the glory of God the Father."  This includes you, my friend.  Don't wait until it's too late.

SS...  
Quote
Dave, if god ordered you to kill someone, would you do it?
No.  What Deadman is thinking of is probably the discussion about Joshua.  And yes, if I were living in Joshua's day and were in Joshua's shoes, I would have, as he did.  

But the divine authority structure was changed with the advent of Jesus Christ, his apostles and the completion of the canon of Scripture.  There are no longer any "prophets" and "apostles" who receive direct instructions from God.  Sorry, Mohammed and Joseph Smith ... you are in error.  God has spoken to us in these latter times through His Son, the Living Word, and through Scripture, the Written Word, the latter portion of which was penned by the authorized agents of Jesus himself--the Apostles.

Hebrews 1 ...    
Quote
1 ¶ God, who at various times and in various ways spoke in time past to the fathers by the prophets,
2 has in these last days spoken to us by His Son, whom He has appointed heir of all things, through whom also He made the worlds;

In the end DaveyDH always seems to devolve into "My religion's better'n yurs."

To which I would have to answer, "No it isn't."

Core samples (in fact all the evidence presented so far) prove an old Earth.

And since the whole world of religion is open to those of us who weren't brainwashed as kids, we have much better religions to choose from so your provincial little god doesn't make much sense.

By the way, is there anyone out there who thinks dave has won a single argument? Any of your friends DaveyDH?

I have to laugh about the Portuguese thing still. You claimed victory without firing a shot.

Date: 2006/09/11 04:56:16, Link
Author: BWE
It's OK to have an irrational belief as long as you know it is.

A 21st century christian probably looks like any other Christian (God of the gaps) but nowadays the gaps are getting smaller and smaller. As long as that's OK with you then there is no conflict.

Davey, however "brave" he is to stand up for his myopic view of wonderland, is someone I would like to be able to keep away from my kids. And personally, I would like to be able to call the cops and say "911? Yeah, a Fundy's been around my kids, can you send a couple of officers?" Because, for those of us who want to search for that esoteric idea we call "truth" or even "accuracy", people like Davey are dangerous. They want to shut us down because we expose the basic Lie in their message.

In the end, it is Davey's Lying and belief that there is some noble purpose to his Lying that is generating hostility in that thread. In general it is the Lying that makes Fundy's dangerous. If we put Liars in charge you get America today. You can't even formulate an accurate opinion of what is going on because the only thing you can know is that the Administration pathologically lies. Same with Fundies. Pathological Lying set up to bolster an agenda and put members of the "In" group in power. And it is about power in the end.

Date: 2006/09/11 05:59:39, Link
Author: BWE
Quote
there is a massive body of original writings which support the fact that America was most definitely founded as a Protestant Christian nation--not an authoritarian one as some here like to say that the GWB's of the world want, but a definitely Christian, Bible promoting one.


You must be on the "Original Intent" by David Barton bing again DaveyDH.

Take a bunk bed, now take the top off. What have you done? The same thing that has been done to David Barton.

He admitted to using quotes out of context, fabricating quotes and using quotes that he was aware were not from the authors he attributed them to. It's called Lying for jEsus, something you are familiar with.

Jefferson, Hamilton, Franklin, Paine, -Not Fundies. Don't know about the rest because those are the only ones I have read works by. But I can go with John Locke or Adam Smith. Not Fundies.

Wanna do it like portuguese?

Date: 2006/09/11 06:50:51, Link
Author: BWE
Here is his own admission with an excuse that looks suspiciously similar to one you might write.

Link

And the beauty is he still twists the truth when he appologizes.

Quote
2. It is impossible to rightly govern the world without God and the Bible. -- George Washington (unconfirmed)


Followed by this, hoping to try to equate the two most dissimilar things:
Quote
There is a very real possibility that the quotation has its origin in an 1835 biography by James K. Paulding. In a description of Washington's character, with supporting quotations, Paulding declares Washington to have said:

   It is impossible to account for the creation of the universe without the agency of a Supreme Being. It is impossible to govern the universe without the aid of a Supreme Being.9


Quote
George Washington, the first president of the United States, never declared himself a Christian according to contemporary reports or in any of his voluminous correspondence. Washington Championed the cause of freedom from religious intolerance and compulsion. When John Murray (a universalist who denied the existence of ####) was invited to become an army chaplain, the other chaplains petitioned Washington for his dismissal. Instead, Washington gave him the appointment. On his deathbed, Washinton uttered no words of a religious nature and did not call for a clergyman to be in attendance.
From:
George Washington and Religion by Paul F. Boller Jr., pp. 16, 87, 88, 108, 113, 121, 127 (1963, Southern Methodist University Press, Dallas, TX)
See I can cite a source that I know nothing about also!

I especially liked this one:
Quote
3. Our laws and our institutions must necessarily be based upon and embody the teachings of the Redeemer of mankind. It is impossible that it should be otherwise. In this sense and to this extent, our civilizations and our institutions are emphatically Christian. --Holy Trinity v. U. S. (Supreme Court) (inaccurate)

This appears to be a classic example of a cut-and-paste typographical error. These words are not found in the Holy Trinity case. However, these same thoughts are found throughout the case and in other state and federal court rulings, primarily in the early years. After offering a general survey of America's Christian history, and speaking out against the practice of polygamy, the Holy Trinity court stated:

   These, and many other matters which might be noticed, add a volume of unofficial declarations to the mass of organic utterances that this is a Christian nation.10


I'm still trying to figure oput how it jibes with this little beauty:
Quote
ARTICLE 11.

As the government of the United States of America is not in any sense founded on the Christian Religion,-as it has in itself no character of enmity against the laws, religion or tranquility of Musselmen,-and as the said States never have entered into any war or act of hostility against any Mehomitan nation, it is declared by the parties that no pretext arising from religious opinions shall ever produce an interruption of the harmony existing between the two countries.

from the Treaty of Peace and Friendship, signed at Tripoli November 4, 1796 (3 Ramada I, A. H. 1211), and at Algiers January 3, 1797 (4 Rajab, A. H. 1211). Original in Arabic. Submitted to the Senate May 29, 1797. (Message of May 26, 1797.) Resolution of advice and consent June 7, 1797. Ratified by the United States June 10, 1797. As to the ratification generally, see the notes. Proclaimed Jane 10, 1797.
http://www.yale.edu/lawweb/avalon/diplomacy/barbary/bar1796t.htm

And Dorky Lie for Jesus guy says this, which, if you read it twice says something a little different than he might mean.
Quote
4. We have staked the whole future of American civilization, not upon the power of government, far from it. We have staked the future of all of our political institutions upon the capacity of each and all of us to govern ourselves . . . according to the Ten Commandments of God. -- James Madison (unconfirmed)

While these words have been the most controversial of all unconfirmed quotes, they are consistent with Madison's thoughts on religion and government. They are consistent because the key idea being communicated is self-government, not religious laws or establishments. Our future rests upon the ability of all to govern themselves according to a Biblical standard. Madison could have easily offered the thought.

Concerning a republican form of government, he spoke in the Federalist #39 of "that honourable determination which animates every votary of freedom, to rest all our political experiments on the capacity of mankind for self-government." (emphasis added)13 Here we see an interesting similarity to the quote's wording, which may have led to a paraphrase that was erroneously attributed to Madison.

Speaking against direct religious taxation in his Memorial and Remonstrance, Madison wrote:

   While we assert for ourselves a freedom to embrace, to profess, and to observe, the Religion which we believe to be of divine origin, we cannot deny an equal freedom to them whose minds have not yielded to the evidence which has convinced us.14

The religion of divine origin was obviously Christianity, of which Madison said he was convinced. Therefore, it would be appropriate for Madison to refer to the Ten Commandments as a foundation for self-government. Granted, he fought to abolish religious establishments much of his life, but that is not the issue. The issue is whether Madison could have made such a statement. He could have; the questionable quote is not out of character.

In the context of America's attitude toward religious establishments (which was a State's right withheld from federal cognizance), Madison responded to an essay/sermon by Reverend Jasper Adams with these words:

   Waiving the rights of conscience, not included in the surrender implied by the social state, & more or less invaded by all Religious establishments, the simple question to be decided, is whether a support of the best & purest religion, the Christian religion itself ought not, so far at least as pecuniary means are involved, to be provided for by the Government, rather than be left to the voluntary provisions of those who profess it. 15 [emphasis added]


So I dug up another one of those little quotes which are equally as good:

Quote
James Madison, fourth president and father of the Constitution, was not religious in any conventional sense. "Religious bondage shackles and debilitates the mind and unfits it for every noble enterprise."
"During almost fifteen centuries has the legal establishment of Christianity been on trial. What have been its fruits? More or less in all places, pride and indolence in the Clergy, ignorance and servility in the laity, in both, superstition, bigotry and persecution."
From:
The Madisons by Virginia Moore, P. 43 (1979, McGraw-Hill Co. New York, NY) quoting a letter by JM to William Bradford April 1, 1774, and James Madison, A Biography in his Own Words, edited by Joseph Gardner, p. 93, (1974, Newsweek, New York, NY) Quoting Memorial and Remonstrance against Religious Assessments by JM, June 1785.


Quote
6. Whosoever shall introduce into public affairs the principles of primitive Christianity will change the face of the world. --Benjamin Franklin (unconfirmed)

Franklin knew quite well the value of Christianity to society. In the context of teaching history to the youth of Philadelphia, he said:

   History will also afford the frequent opportunities of showing the necessity of a public religion, from its usefulness to the public; the advantage of a religious character among private persons; the mischiefs of superstition, &c. and the excellency of the Christian religion above all others, ancient or modern. 18

This is not to say that Franklin was a Christian; he did not believe in the divinity of Christ. This is easily documented. However, he was well aware of the utility of religion in general and Christianity specifically. In a letter to his daughter, Franklin stated:
This one is just amazing.

I might go on but it takes too much time.

You're a Liar, an idiot, and a sucker. What a combo.

Now, about those core samples....

Date: 2006/09/11 07:15:38, Link
Author: BWE
Maybe we should add the "Founding fathers designed a Christian Nation" to his beauties outside of science.

I'd love to have a go at that one. Sounds like a few others might too.

Stakes: Winner gets to post on the other's blog.??

Date: 2006/09/11 07:19:58, Link
Author: BWE
Oh DaveyDH, I'm getting turned on. We should move this topic to a more intimate place. I just put it on the Portuguese thread. I thought it would be an appropriate place for this topic.

You game big boy?

Date: 2006/09/11 07:26:02, Link
Author: BWE
Am I the only guy here old enough to remember the Orange Sunshine?

Jesus Crisp, lizards are entertaining.

DaveyDH is a one man case study of the power of brainwashing. It's amazing. I mostly say things just to make the lizard talk.

:)

Date: 2006/09/11 07:35:45, Link
Author: BWE
Oh yeah,

I almost forgot this one.

DaveyDH, How long does it take permafrost to form and why is it an issue in global warming?

how long?


???

Date: 2006/09/11 08:51:09, Link
Author: BWE
Good Question GoP, Any suggestions?

I'd have to say that it ought to show that the Constitution and declaration of Independence (or the philosophy that underpins the documents??) were essentially an attempt to create a Christian Nation- although that is pretty nebulous.

Undoubtably, there were Christians at the constitutional convention so I guess the debate might hinge around whether their ideas were the ones that ultimately led to the final draft.

So first, I guess we need to establish "who" were the founding fathers and rank them in importance relating to the writing of the doc's. Then we need to try to determine where their philosophical roots came from individually and whether they thought that the US should be a christian Nation.

Maybe then a score card that ranks the relative importance of each and their "christianity" level?

Anyone have any ideas?

It gets tricky because Tom Paine was very instrumental in developing the ideals that led to the documents as well as others who weren't part of the writing process.

Date: 2006/09/11 08:55:51, Link
Author: BWE
The lunchroom :p

Date: 2006/09/11 09:49:21, Link
Author: BWE
Quote (The Ghost of Paley @ Sep. 11 2006,14:04)
Quote
I think Wesley's turned off polls here, but I'd think the way to prove who won a debate would be who a majority of posters thinks won.

Somehow, I don't imagine Dave would accept that, since he'd have to accept the fact that he's lost every debate he's engaged in.


Well, you have to admit this isn't the most neutral audience around. Would you be willing to tell BWE that he lost a debate to a "panty-dancing tard"*, even if that were the case?

   
Quote
Good Question GoP, Any suggestions?


Nothing other than being very precise on what Dave would have to show. For example, on the Founders issue you could stipulate that if finds a private letter from Thomas Jefferson expressing a belief in Christianity, then he wins on T.J. unless you can find later declarations that overturn it. Of course, he's got his work cut out for him what with the Jefferson Bible, his love of Hobbes, etc......

*not my opinion

Jeeze, I hope no one would mind telling me I lost. I am setting this up the same way as before. I have done no real research at all. I just know that Davey is so stupid that he can't make sense out of his own excrement. I could be totally wrong.

Frankly, I don't care if they were christian or not. We aren't anymore.  :p  :p  :p
(And I won't debate that one)

Date: 2006/09/11 13:28:38, Link
Author: BWE
Swing Vote?

He11, I'll take the other side on this one too (like I offered on the portuguese thing) if DaveyDH can't figure out how to support his side. Go ahead DaveyDH, take the easy side. I'll try to convince them that the US was intended to be a christian nation by the founders.

Actually, I don't care which side I take. My hypothesis, based on the evidence so far, is that DaveyDH is too stupid to find his ass even though his head is buried in it.

One caveat: If I take the stupid side, er, Christian side, you all have to help DaveyDH. (to try to keep him honest).

Date: 2006/09/11 13:40:12, Link
Author: BWE
Yes, Tyre is the only thing keeping me from believing the Bible is the Inerrant Word of the Creator.  

Mmmm. except for the sheer, remarkable errancy of the rest of it. And the fact that we know what makes, oh say, seasons, rain, speciation, earthquakes, hurricanes, day and night, fire, lightning, skin color, the grand canyon, limestone, diamonds, coal, oil, velcro, the motion of the planets, sickness and disease, phosphorescence, things fall, how simple rules can lead to very complex systems, how religion is a holdout from a time when we didn't know those things, how your embarrassment of your small penis led you to pursue a life of promoting falsehoods to bolster your self-esteem and many other things too.

Date: 2006/09/11 14:20:16, Link
Author: BWE
Actually, I'm willing to be a little loosy goosy on this one. In fact, I would prefer it. :)

I feel like I shouldn't comment much before I know which side I am taking though. ???

I'd hate to ruin my own argument. :p

Date: 2006/09/11 14:23:08, Link
Author: BWE
And core samples provide that one date. (among a few othewr things :D )

Date: 2006/09/11 20:06:17, Link
Author: BWE
Quote
the Keynesian myth
???????

Ummm... Please explain. I can't wait to hear this one. Has it been replaced by, oh, perhaps Milton Friedman?

Or was it "Deficits don't matter anymore" Cheney?

;)

God DaveyDH, I'll debate you on whatever you think about that one.

SteveStory,
You were wrong. He is stupid.

Date: 2006/09/12 05:49:30, Link
Author: BWE
Quote (Ichthyic @ Sep. 12 2006,01:21)
@BWE:

did Cheney actually say that deficits no longer matter?

I need to record the quote for my archives, if you can remember where you saw that.

it goes a long way towards explaining to old-school conservatives like my pop just how different the neocon way of thinking really is.

edit:

nvm., i found it, Cheney said it about a year ago:

http://www.americanprogress.org/site/pp.asp?c=biJRJ8OVF&b=27156

It's been a few years since I slogged through Keynes but I read "Capitalism and Freedom" by Milton Friedman a couple years ago. (At the same time, an aquaintance was reporting from Chile on some environmental issues so it seemed relevant.) Cheney's quote reminded me of a line from C&F paraphrased something like "The purchasing power of the individual is always equal to his production into the economy. The number of shoes a miner will purchase will be commensurate with the amount of ore he extracts."

Let that one sink in for a moment.

I am always amused when one economist proclaims the "death" of a previous economist's ideas. It's like they define one cubic nanometer of a major phase transition and proclaim their new understanding to be the new physics of phase transition.

DaveyDH,
I wonder what you think of "On Liberty" (John Stuart Mill) DaveyDH. Is it dangerous? And I would really looove to debate you on keynesian macroeconomics being a "Myth"


See, I offer up these debates all the time even though I know next to nothing about the subjects because I know a secret: You are too stupid to win a debate. Even if I were wrong I would win. (But if you take the side you begin with, I will honestly try to be right).

And you are proving your nature by A) refusing and B) claiming victory without even having 1 keystroke of a debate.

As a chicken daveyDH, are you fried, baked or broiled?

edit*** You might want to start here with the "keynseian myth". It is reasonably well done and gives you a few points you can cut and paste and call truth even though you won't be able to explain why in any meaningful way.

DumbassDavey. Now, it's DumbassDavey.

cluck, cluck, bwaaaaaak!

Date: 2006/09/12 06:07:42, Link
Author: BWE
Well, Add "The Keynesian Myth" to the list.

I suppose, to be consistent, I should offer to take either side of that one too.

Debate would be the accuracy of the phrase.

DaveyDH, the man who loves the man behind the curtain. (like brokeback style)

Date: 2006/09/12 06:19:50, Link
Author: BWE
You think?

I still have a candle lit.  :)

Date: 2006/09/12 16:28:31, Link
Author: BWE
I nominate myself for the
**"Most confounding without ever having to supply a shred of evidence" award.

Very different from the
**"Most delusional about thinking they have presented evidence when, in fact, they have presented no evidence whatsoever" award.

And I think effort is is important. It's partly how hard you try.

As evidence to support voting for me I offer this:
   

Date: 2006/09/12 18:54:51, Link
Author: BWE
Quote
Quote (stevestory @ Sep. 12 2006,20:21)
the new "All" feature (thanks Wes)


How does that work?

P.S. DaveeyDickHead,,,,
You also claimed you won the portuguese debate. We never started. Not post 1. Nope. Nada. I'm the only one who took the bet (and I know very little about the subject) and you never responded yet you claimed to have won.

Not even after you lost. You claimed victory without even showing up on the field.

All I'm out to do here daveyDH, is to help you see that you are a moron in whatever you attempt. I thought that once you discovered that you really can't figure out the factors of 1 or the first 3 letters of the abc's, maybe you would take a step back and see that, although you are in fact dumber than your toenail, you still have a chance to learn to come to terms with that and live a happy life without causing all the harm that a fundy wants to do by nature.

So I thought that debating a neutral subject would be a good way to help you learn that about yourself. Public service is good but when you can help an individual, well you are really being a good human then. I am doing this for you davey. I really care. I do. But we have to start at the beginning. The beginning is where you say, "oh. oh, I see. Well. Sorry about that guys. I'll come back with evidence next time. Er. I'll admit that I don't know what that means but I will try to find out."

Then maybe you can get on with your life.
PS, you should use this for an avatar.

Date: 2006/09/12 19:02:06, Link
Author: BWE
Quote
June 3, 1997

American foreign and defense policy is adrift. Conservatives have criticized the incoherent policies of the Clinton Administration. They have also resisted isolationist impulses from within their own ranks. But conservatives have not confidently advanced a strategic vision of America's role in the world. They have not set forth guiding principles for American foreign policy. They have allowed differences over tactics to obscure potential agreement on strategic objectives. And they have not fought for a defense budget that would maintain American security and advance American interests in the new century.

We aim to change this. We aim to make the case and rally support for American global leadership.

As the 20th century draws to a close, the United States stands as the world's preeminent power. Having led the West to victory in the Cold War, America faces an opportunity and a challenge: Does the United States have the vision to build upon the achievements of past decades? Does the United States have the resolve to shape a new century favorable to American principles and interests?

We are in danger of squandering the opportunity and failing the challenge. We are living off the capital -- both the military investments and the foreign policy achievements -- built up by past administrations. Cuts in foreign affairs and defense spending, inattention to the tools of statecraft, and inconstant leadership are making it increasingly difficult to sustain American influence around the world. And the promise of short-term commercial benefits threatens to override strategic considerations. As a consequence, we are jeopardizing the nation's ability to meet present threats and to deal with potentially greater challenges that lie ahead.

We seem to have forgotten the essential elements of the Reagan Administration's success: a military that is strong and ready to meet both present and future challenges; a foreign policy that boldly and purposefully promotes American principles abroad; and national leadership that accepts the United States' global responsibilities.

Of course, the United States must be prudent in how it exercises its power. But we cannot safely avoid the responsibilities of global leadership or the costs that are associated with its exercise. America has a vital role in maintaining peace and security in Europe, Asia, and the Middle East. If we shirk our responsibilities, we invite challenges to our fundamental interests. The history of the 20th century should have taught us that it is important to shape circumstances before crises emerge, and to meet threats before they become dire. The history of this century should have taught us to embrace the cause of American leadership.

Our aim is to remind Americans of these lessons and to draw their consequences for today. Here are four consequences:

   • we need to increase defense spending significantly if we are to carry out our global
   responsibilities today and modernize our armed forces for the future;

   • we need to strengthen our ties to democratic allies and to challenge regimes hostile to our interests and values;

   • we need to promote the cause of political and economic freedom abroad;

   • we need to accept responsibility for America's unique role in preserving and extending an international order friendly to our security, our prosperity, and our principles.

Such a Reaganite policy of military strength and moral clarity may not be fashionable today. But it is necessary if the United States is to build on the successes of this past century and to ensure our security and our greatness in the next.

Elliott Abrams  
Gary Bauer    
William J. Bennett    
Jeb Bush
Dick Cheney    
Eliot A. Cohen    
Midge Decter    
Paula Dobriansky    
Steve Forbes

Aaron Friedberg    Francis Fukuyama    Frank Gaffney    Fred C. Ikle

Donald Kagan    Zalmay Khalilzad    I. Lewis Libby    Norman Podhoretz

Dan Quayle    Peter W. Rodman    Stephen P. Rosen    Henry S. Rowen

Donald Rumsfeld    Vin Weber    George Weigel    Paul Wolfowitz

Date: 2006/09/13 05:18:13, Link
Author: BWE
How about:
** Hardest to figure out what they mean Post**

It might make a good thread: Priceless quotes from ATBC or PT (as opposed to the thread full of priceless quotes on UD) with a weekly winner added via permalink to the first post in weekly edits.??

Date: 2006/09/13 05:57:52, Link
Author: BWE
Davey,

You just pulled a "My religion is better'n yours" answer to a question again.

And, for the record, mine is better because on the stupidity continuum, mine is less stupid.

In fact, I'm not sure if this is possible but if it is then you are even stupider than your religion.

How bout Macroeconomics? POrtuguese? Founding Fathers? World Religion?

:)

Date: 2006/09/13 07:40:37, Link
Author: BWE
Quote
As usual, you've just backed the wrong horse, and horses don't get much more wrong than young-earth creationism.

Isn't he backing a trojan horse?

See Davey, your inability to deal with me is the proof of what ericmurphy is saying. I'm only challenging your credibility. You need to first establish that you can make a coherent point. I am trying to give you that opportunity.

Date: 2006/09/14 05:47:22, Link
Author: BWE
Quote
Quote (afdave @ Sep. 14 2006,07:33)
Cedric...  
Quote
But how do numbers of people believing in something make that something true?

Ding ding ding ding!  Thank you! Thank you!  Thank you!

Go do a search of this thread and count the number of times that someone on this thread besides me has said something to the effect of ...

"Dave, 95% of the scientists believe in evolution ... how can it not be true ...?"

"Dave, 95% of all the world's scientists representing all the countries of the world believe that the earth is 4.5 billion years old ... how can this not be true ...?"


Hmmm. I like this discussion.

95% seems pretty low but it doesn't much matter because there is a quantitative difference.

Care to make a guess?

I'll give you a hint:
(one group is basing their observation on evidence, rigorously tested, and the other group is wanking in the pews)

Any guesses? What do you suppose might be the qualitative difference Davey?

By the way, core samples are a trap as I told you before but, now that ved here has let the cat a little way out of the bag, I'll let you in on the avenue I would have gone down. Core samples corroberrate each other and Rm dating. Conclusively.

AiG only deals with them individually rather than as a collection.

Earth is more than 10k years. You are wrong.

PS, You really should provide one or two pieces of evidence that the earth is 6k y/o.

Just tryin to look out for your best interests.

Cheerio :D

Date: 2006/09/14 08:51:04, Link
Author: BWE
Quote (afdave @ Sep. 14 2006,12:48)
Quote
I think it's a lot of superstitious numerological nonsense with no relevance to anyone's lives since the Roman Empire imploded, but that aside, I think if you insist on taking this stuff seriously, you have to go with the oldest manuscripts, as any educated historian of ANY religion would tell you.
Thanks.  I should have been more specific.  What did you think of the CONCLUSION of the article?  Do you agree or disagree?

Quote
And what logo are you guys looking at?
There are 3 long arms and 2 short arms.  The long arms could be viewed as 3 stacked sixes by someone with not even a very active imagination.

Do you know what they do at cern?

That logo is showing you.

Date: 2006/09/14 10:04:28, Link
Author: BWE
Dave,

I am going to try to be polite from now on. I am curious about one thing especially:

What is your evidence that Earth is 6500 years old?
How might you design an experiment to prove it?

And, not doggin on you here but Rm dating isn't your thing.
Let's just all make an assumption that Rm dating is a secondary method anyway. We have to establish methods to verify Rm dates. Let's please move on (if you are going to persist in destroying all of sciences advancements) to other, more obvious techniques.

My question is this:
If we could demonstrate that Earth is 10k y/o, would that make you wrong?

Let me be very clear with this. If we can find a way to count annual events and show that there is not methodological problems with the technique at least up to 10k years, would that do it?

Seriously, I would appreciate a reply.

Thank you in advance.

Date: 2006/09/14 12:01:07, Link
Author: BWE
Quote (Arden Chatfield @ Sep. 14 2006,16:11)
Quote (BWE @ Sep. 14 2006,15:04)
Dave,

I am going to try to be polite from now on. I am curious about one thing especially:

What is your evidence that Earth is 6500 years old?
How might you design an experiment to prove it?

And, not doggin on you here but Rm dating isn't your thing.
Let's just all make an assumption that Rm dating is a secondary method anyway. We have to establish methods to verify Rm dates. Let's please move on (if you are going to persist in destroying all of sciences advancements) to other, more obvious techniques.

My question is this:
If we could demonstrate that Earth is 10k y/o, would that make you wrong?

Let me be very clear with this. If we can find a way to count annual events and show that there is not methodological problems with the technique at least up to 10k years, would that do it?

Seriously, I would appreciate a reply.

Thank you in advance.

BWE, you are possessed of absolutely limitless reserves of patience.

I hope your spouse appreciates it.  :p

I forwarded that comment to her.

Date: 2006/09/14 17:59:46, Link
Author: BWE
Quote (Ichthyic @ Sep. 14 2006,15:04)
Quote
I do not doubt you. Did you think that I did?


not at all.  I just thought you might like a bit more detail, and to realize that these folks really DO think that they can spin reality itself, and are often pragmatically successful.

cheers

Witness the non-marginalized status of fundies. You can spin reality and gain converts. It works. They are using a very dirty playbook, no doubt. Look over at he afdave thread.

I don't hold out much hope for the future of the society we developed in the second half of the 20th century. You can't square the new media ownership patterns and consumer based philosophy with a society that learns how to weigh evidence and make conclusions from the evidence. And the extreme polarization of the left/right makes the ones who are somewhat capable unbearable. Witness normdoring and poppers ghost et. al. on the bathroom wall posts. Just miserable.

So we are ending up with the AFdave's and the Popper's Ghost types as leaders in our new culture armies.

Not a lot of hope. ???

Date: 2006/09/15 09:15:59, Link
Author: BWE
Barton's book. Ok, so the founding father's wanted a christian Nation? Is that your hypothesis?

We are talking Washington, Jefferson, Hamilton, Franklin, Tom Paine, John Adams, James Madison.

Who else do you want to include?

Date: 2006/09/16 13:49:00, Link
Author: BWE
Quote (Russell @ Sep. 16 2006,16:46)
Wow. 193 pages of this crap! Truly impressive. Kudos to all with the perseverance to keep holding afd's feet to the fire. But beyond a certain point, incinerated feet can't get any more incinerated.

Seriously. It occurs to me that the only reason sane people take the time to even confront this pre-medieval silliness is because of the scary political prominence of the would-be theocrats. So to those of us in the U.S. - let's resolve to devote at least as much time, energy and resources to the upcoming election as to diversions like Davey-doodles.

The other fundies run away after a few pages or get into subjective qualities when everyone goes bonkers. This one stays around and offers a very detailed look into a particular mindset.

I for one truly enjoy the often bizzare banter that develops when the difficult student (Dave) pops up with some Chickian response to the science teacher and all the good students have to say "No,no, no. You're gettin it wrong."

But the difficult student sticks to his (fluid ) ideas and the class moves on. I can't wait to get to various core samples personally. I learned a bit about various Rm techniques and now I'm off to another topic.

Hopefully, we can squeeze in a discussion of the founding fathers if we get lucky. I offered Dave to discuss his book on Dave's blog (I even bought the wretched thing) but he petered out there. I would love to have a one on one debate with him on the idea that the founding fathers wanted a christian nation but, since I appear to be sidelined by Dave at the moment, I will have to be content with a quick comment now and then.
:)

Date: 2006/09/17 19:54:12, Link
Author: BWE
Absolute Power = Absolute corruption.

War is a Racket.

We have some folks out there who do not notice the carnage in their wake. They should not be in power perhaps.

The new constitutional ammendments could say that all campaigns are public funded and corporations can have their charter's revoked by vote of the state where they are incorporated. ??

Problem we have now is that it is pure thieving and it's not even covered up. Borrow the money, put the bill on others and take the money. Just take it. That's it.

That is what we have now and it is the weakness in our system. None of the framers had heard of Freud. You can sell people their own sex appeal and they roll over for you.

Meet the new boss. Same as the old boss.

I think Lenny's right. It's not a conspiracy. It's all out in the open.  ???

Date: 2006/09/18 08:27:37, Link
Author: BWE
Dave,

The problem with the isochron method deconstruction you are using is isolation. Anyway, Rm dating is not normally done in a "vacuum" (That genesis could step into). Dating is not any single discipline. Besides missing the point of peer revue, you are also missing the forest for the trees. Rm dating is a laboratory issue. A well managed lab can show you results and tell you what they mean and how they got them.

i.e. I send my rock over to a lab here in town. I say something like, "I need you to do a date on it and tell me if x, y or z are present."

They say something like "Sure we have the equipment for dating method x and we will use method a to determine the presence xy or z."

"Great, thanks. What are the tolerances?"

Then we go through it all and it turns out that knowing the date becomes really important. Then, I will go back to the place I got my sample and try to see if lots of other methods agree. If one doesn't, and I ignore it when I include the "date" in my report, I will get called on it and have to go back and do it all over again until I get dates in agreement. Doesn't matter what my answer is, just that I have double checked my work. True, I would check the one that didn't agree first, but if I couldn't get it to agree, I would have to find out why. This could quite possibly lead me to check all my other dates too. (I actually would be likely to be checking sediment rather than igneous rock but that just changes a few of the techniques and methodologies.)

Core samples are also pretty good dating methods. Want to talk about core samples? I'm really tired of Rm dating.
:)

Date: 2006/09/29 07:27:07, Link
Author: BWE
Quote (Occam's Aftershave @ Sep. 29 2006,11:21)
I was the one a few months back who asked Dave questions about ANY businesses based on YEC models
   
Quote
Why are there so many profitable companies that use the Old Earth paradigm as the basis for a successful business case?  

Why is there not a single company anywhere in the world that uses your 6000 year old Young Earth paradigm as the basis for a business case?  

and
   
Quote
If the YE model is the ‘truth’ and is so superior to the OE model, why has no YEC figured out a way to make money from it?  Why aren’t you, the super-duper businessman, making money from it?  Looks like you would have no competition IF you could figure out a good business case.  AFAICT, the only way to make money from YE is to sell pseudo-scientific books and videos to boobs like yourself who are desperate to have their delusions reinforced


As you note, Dishonest Dave never could come up with an answer.

Are you serious?

Snake oil peddlers the world around use YEC models to make money. Dr. Dino? Tent revivals?

Hmm. Interesting that they are all making money by asking for donations from those who believe them isn't it?

Dave, Core samples? Let me know.

PS:
Quote
afdave  
Quote
Posted: May 18 2006,22:21    

...Yes.  I knew about the planet thing.  I actually speak quite a bit of Spanish and Portuguese (which of course is Spanish and French mixed).

afdave  
Quote
Here's the specific statement that I am defending:

1)  AF Dave says that Spanish and Portuguese were essentially the same language until 1143 AD when Portugal broke away from Spanish control under a French nobleman by the name of Henry of Burgundy.  From this point on, the languages diverged into the modern situation.  The primary influence on the linguistic divergence was the French language.

2)  Rilke and Toejam say I am wrong

How much are you willing to bet?  



afdave    
Quote

Posted: May 19 2006,08:37  
Rilke--

You keep saying I'm wrong, but you haven't put your money where your mouth is.  Just tell me how much money it's going to be ...

$500 says I can prove my statement (my later, more specific statement).  Are you willing to put up $500 and prove me wrong?

You know the wager ... it's as clear as a bell ...

Now are you going to back up your claim?  Or are you going to retract it and apologize?  Or shall I embarrass you publicly in front of all your friends?

Your choice, sweetie.

BWE    
Quote

Posted: May 19 2006,14:22  
Davey-dog. You are an idiot. Define Spanish. Be careful, that's a trick question. Next Define spanish around the time of song of roland.  

I'll take your bet. But the stakes are different. If I win, I get to write a post on your blog, if you win, you get to write a post for my blog. and one more thing, please answer some age of the earth questions.


Just because I think you are stupid, I am not going to do any preliminary research.

And I am making some assumptions about your claim:

1) the portuguese language substantially changed beginning in the year 1143.

2) The Spanish you are referring to is Castilian

3) The french language and the Castillian language are the major components of modern Portuguese.

4) the dialect of Portuguese you are referring to is the one spoken in Lisbon.

5) That you are making an all or nothing claim similar to  your others (there are no gray areas)
link
link here

So you see, when you say that you didn't lose the portuguese thing, you get responses that disagree.

Date: 2006/10/02 08:39:34, Link
Author: BWE