AE BB DB Explorer


Action:
Author:
Search Terms (separate with commas, no spaces):


form_srcid: Amadan

form_srcid: Amadan

form_cmd: view_author

Your IP address is 54.204.215.209

View Author detected.

view author posts with search matches:

Retrieve source record and display it.

form_author:

form_srcid: Amadan

q: SELECT AUTHOR, MEMBER_NAME, IP_ADDR, POST_DATE, TOPIC_ID, t1.FORUM_ID, POST, POST_ID, FORUM_VIEW_THREADS from ib_forum_posts AS t1 LEFT JOIN (ib_member_profiles AS t2, ib_forum_info AS t3) ON (t1.forum_id = t3.forum_id AND t1.author = t2.member_id) WHERE MEMBER_NAME like 'Amadan%' and forum_view_threads LIKE '*' ORDER BY POST_DATE ASC

DB_err:

DB_result: Resource id #4

Date: 2007/02/22 10:50:21, Link
Author: Amadan
Rebuffed, rejected, and no longer welcome to nuzzle at the hairy teat of Intelligent Design that is UD, I slope dejectedly, like a newly minted drunk to the gutter, into this forlorn forum. My efforts as the resident atheist on UD failed to seduce the Stormtroopers of the New Dawn of Science, though it was fun seeing how many 'Tards' I could get past the never-vigilant Dave.

But let me introduce myself. I have a certified IQ somewhere north of an ox but I carry it concealed. I was taught to think by the world's most efficient brain-killing machine, a Baptist Seminary. I live in an ivory houseboat and women scream at me that they want me to have their babies, or at least endure some comparable pain. I am a self-made bankrupt, courtesy of an option to leave Dell which friends, colleagues and my lawyer urged me to accept before charges were filed. I keep up with the cutting-edge of science by reading the 'Strange But True' section of Readers' Digest and hard-core colouring books.

Ah Dave! How I shall miss you! How I resent the way you ignore my comments, even when I don't poke unsubtle sarcasm into your eye! To compress so much wit, knowledge, and experience within the confines of a mere human skull suggests an astonishing cerebral molarity. Your humility, your understated learning, your natural sense of fairness – well, what can I say? And then, there are those manly curves...

It was a pity we didn't pursue the possibility of the Theologically Attuned Radio Detector, or Transcendent Administrative – Religious Dialogue, or the other TARDs you were kind enough to let me adorn UD with. Not to mention Bustenhalter's Front Loading (The Germans usually just abbreviate it to 'BH', Dave). And I hope your contributors will continue to see themselves as belonging to the ID Tardis – it's such a fitting metaphor.

Dave, I just wish I could drop a penny into the well of your ignorance and wait to hear it go





           *plop!*

Date: 2007/02/22 13:07:58, Link
Author: Amadan
Quote
Send him down the river.


Hang on! What happened to the spirit of Natural Selection? Should not those who follow the Tard die by the Tard?


Quote
Dude, you rule!


Quote
Well written young man!


Why thank you!


(Blushes, simpers. Strangles another kitten)

Date: 2007/02/25 20:28:10, Link
Author: Amadan
Part the First of An Occasional Series Featuring Snippettes from Unwritten Litter-ary Wurkss...


An indignant groan issued from the ancient oaken door of of the vault, deep in the obscure bowels of the Southwestern Baptist Theological Seminary. Cloaked in his professorial robes, the Astrologer Guilermo Scorregia heaved his lofty form once more, his aquiline features, his lofty brow distorted by the unaccustomed effort. “A bloody pox on this benighted barrier!” hissed the great sage - “It resists my efforts as if 'twere peer-review itself!”

The Prophet of Profound Prestidigitation thoughtfully rubbed the bruised flesh under his gown and turned to the stooped and bedraggled figure hunched in the gloom of the crepuscular souterrain.

“Scotus!”

A snivveling ingratiating whine issued from the shapeless bulk in the shadows. “But . . .  Master, it isn't my fault, there's no ....”

“Shut your blubbering gob, you feeb!” The distorted frame of the mage's lacky shrank back at the savagery of the doctorial execration. “Do you think I could mistake anything caused by you as being intelligently designed? This door is jammed shut by the weight of Evidence, not anything you did, you dolt! Now use your god-given attributes!”

The lumpen one pondered. And pondered. And pondered. And pondered. And pond.... Until, interrupting the narrative, he looked up, the novelty of an idea subducting a beatific radiance into his physiognomy.

“My ... my intellect, Master?”

The Great One, beset by the bedevilment of circumstances, patiently folded his arms.

“Not quite, Scotus. Nearly, but not quite. No, Your skull. If you please.”

The familiarity of of the order left no need for elucidation. The bulky drudge bowed down and charged; the venerable timbers had no chance, the supporting Evidence was as nothing to the molarity of that cranium.

The Doctor swept in. On a table in the crypt, a microscope focused on a slide. The Prince of Pre-Cooked Probability peered at it and exclaimed “A flagellum! The Evidenciarists have sought to undermine us with a pathetic detail of a paramecium's parasite! But they defeat themselves with their random choice: look at its sheer complexity, its ineluctible machinery, at how it is utterly  in.. in.......

A commanding voice spoke from above: on a high balcony, the Cardinal Cordova completed what Scorregia could not:

“Yes, at how it is ineffable, or in other words, incapable of surviving the EF. Scotus!”

The cringing lacky shrank from the harsh tones of his master's inquisitor.

“Fetch ... The Explanatory Filter!”

Date: 2007/03/07 19:30:47, Link
Author: Amadan
Snippette™ the Second...

After quidditch practice, Harry rushed back to classes. Passing through the tall entrance hallway of the South-West Texas Wizarding Academy, he almost bumped into Ron and Hermione.

“Harry!” exclaimed Hermione “Hurry up! We're going to be late, and the new Defence Against the Dawk Arts teacher is starting today!”

Ever since Professor Hovind had mysteriously vanished, the school had been humming with speculation about where he had gone and who might succeed him. There had been rumours that Professor Davison might come back, but it seemed the other staff members threatened to resign if he did. Professor Behe, who taught Astrology, had taken a few classes, but nobody had paid any attention. So now at last the school had found someone to teach the most dangerous and necessary of subjects.

The three arrived at the class and scurried to take their seats before they were caught for being late. But a prim voice scolded them as they sat down.

“Don't you three realise there is a war on? Do you expect the enemy to wait patiently for you before he starts obliterating us?”

Harry started to mumble an apology, but stopped in mid-sentence on seeing the new professor. Sitting on the desk at the top of the class was a squat purple toad wearing ridiculously large glasses.

“Ah, the famous Mr Potter. I shall be keeping an eye on you.”

The toad continued, addressing the young witches and wizards.

“I am Professor O'Dreary, and I shall be instructing you not only in how to defend yourselves against the Dawk Arts, but in how we shall prevail against them and all manifestations of He Who Must Not Be Named. If, like Mr Potter here, you are surprised by how you see me, I must point out that I have mastered the art of transforming my appearance as a means of defence. I shall now resume my normal form.”

A flash of light and a puff of smoke issued from the desktop. As the air cleared, the students saw that the toad had changed colour to a dull muddy brown.

“Now please open my book 'Divine or Dense?' at page 72. You will each find a copy in your bags, and your parents have been billed the full retail price. Miss Granger, will you please read?”

Hermione began: “Because nothing comes from nothing, everything must come from something. Therefore, nothing must come from something. And because nothing can produce only nothing, all nothing comes from nothing. Materialist scientists try to trick people by saying that everything is 99 percent empty space, or nothing. But this means nothing, even if they say there's something to it. “

Under his breath, Ron muttered to Harry “Bloody ####...”

Hermione continued: “Materialism is bad. Bad, bad, bad. It can only lose things, which is bad. Materialism makes jeans lose information, or mutates them, which is always bad. It makes wizards lose their faith in magic, and worst of all, it can make witches lose their virginity, which is very very bad indeed. He Who Must Not Be Named was obsessed with reproductive success, which means losing your virginity, which never happens in good families.”

Harry could take no more. “Professor, surely you don't think that this sort of thing features in anything written by Charles Darwi...”

A bolt of lightning scorched from Professor O'Dreary's wand, knocking Harry out of his desk and clear across the room.

“NEVER mention that hated name!” shrieked the toad. “You have spent too long among the Muggles, Potter! You fail to see how magic fills the gaps that materialism opens!”

Stunned, Harry struggled to his feet.

“You can explain yourself to Professor Dembskidore. Go now, Potter!”

Inwardly, Harry shuddered. He always liked meeting the kind and wise Head Wizard, who never actually taught anything. But to see him, he would have to get past DaveMulch, the sullen, misshapen gatekeeper. A squib – that is, with no magical powers even though he spent all his time among wizards - DaveMulch was resentful of those talented where he was not. A  mean and vindictive tin-pot tyrant, he delighted in exercising his petty powers in excluding people for no good reason.

Dreading what was to come, Harry set off.

Date: 2007/03/07 20:09:25, Link
Author: Amadan
Scrotus was never - and never will amount to - more than a minor, incidental character. He met a sticky end attempting to cook rice in Superluminal Transmogrificator in Scorreggia's laboratory. Cremation of his remains was expected to provide light, heat, and power to the Seminary for the forseeable future, but the resulting emissions were deemed too likely to increase global warming. His skin, which was remarkably thin, was used to provide cover for the Big Tent.

Date: 2007/03/29 12:15:01, Link
Author: Amadan
Hmm. I feel a Snippette™ coming on.

Any of you lot have any suggestions or requests?

Date: 2007/04/18 03:58:34, Link
Author: Amadan
My onw favourite is the idea that The King James Bahbble of 1611 proves that English is the Lawd's Chosen Langwudge.

http://members.citynet.net/morton/kj-outline.htm

Other delights include the dribbling lunacies perpetrated by British-Israelites ("Saxon" is derived from "Isaac's-son") and their ilk;

http://www.orange-street-church.org/text/lost-tribe-migration.htm

http://jahtruth.co.uk/ireland.htm
The second one isn't really about liguistics etc but it's so daft I had to share it with this august company.

Date: 2007/04/20 06:50:05, Link
Author: Amadan
Quick! Someone fetch the Exploonaturdy Felcher!!

http://www.huliq.com/18859/tunguska-meteorites-undeciphered-artifacts

Once we show that Tunguska was an intelligently designed accident that caused a big bang, we can refute all those Big Bang believing accidentalists!

Date: 2007/04/24 18:13:20, Link
Author: Amadan
http://www.orwelltoday.com/doublethink.shtml

"Doublethink means the power of holding two contradictory beliefs in one's mind simultaneously, and accepting both of them."

Further comment would be superfluous. And redundant.

Date: 2007/08/01 15:48:58, Link
Author: Amadan
* sniff *

After all my hard-earned efforts to tardiculate UD and have myself banned there (de facto, de jure, and de Seven Dwarves), I now suffer the indignity of being overlooked in this Canon of the Castaways.

Expect to feature unfavourably in my next Snippette...

Date: 2007/09/19 06:44:10, Link
Author: Amadan
I think you're being very mean to poor Superspurt. The fact that Jewish boys still require circumcision doesn't disprove Lamarckian evolution at all. In fact, it supports it.

Judaism is matrilineal, and in its orthodox form is very strict about pre-marital whoopee. Leading authorities such as Sigmund Freud and Woody Allen make it clear that Jewish men are psychologically repressed and constantly obsess about pleasing their womenfolk, especially their wives and mothers. It follows logically that:

1.Jewish women seek to marry men who have been circumcised according to the law, but cannot verify that this is the case until after the wedding;
2.A good bris (ie circumcision ceremony) is a perfect way for a proud young mother to show off her new son and impress the in-laws with her decor, cooking, etc;
3. Jewish women therefore show a preference for mates who will allow for the possibility of being circumcised;
4.Jewish fathers, though themselves circumcised, repress this trait in their male offspring so that their wives get a chance to push the boat out a bit and show off the new dress.

Einstein recognised the transference of mind that SoupieSales describes. The audacity that permitted him to make his revolutionary claims is a trait inherited from his mother, a notably sparky young thing in her day. He acknowledgers this in his famous equation E=MC^2, which roughly translates as “Einstein has Mama's Chutzpah Squared”.

Not many people know this.

Date: 2007/11/24 19:48:32, Link
Author: Amadan
Harry was surprised, on arriving at Professor Demskidore's office, to find his way unbarred by the lurking presence of DaveMulch. He hope that the hated, untalented caretaker had finally been got rid of. But perhaps that would be hoping for too much.

Harry thought hard for a few moments, trying to remember the password that would open the door. It was always the name of some sort of sweets , , , “Hayseed suckers” he said after a few moments. The door swung open.

Inside, Harry found the the study deserted. He paced around, examining the familiar articles he had wondered at on previous visits here. There, on a perch behind the desk, was Yec, the headmaster's pet phoenix who rose from its own ashes every time it went down in flames. By the window he could see the Obliviator, which Mulch was rumoured to use to get rid of all traces of students who were expelled. On the walls, portraits of previous headmasters snored, the unchanging drone of the school's curriculum giving them nothing new to wake up for.

A quiet pop sounded behind Harry and he spun around to see the familiar tall frame of the headmaster. He seemed to be pushing some coins into his pocket, and Harry though he heard him mutter something like “Dumb redneck rubes...”

“Harry!” Professor Demskidore said, “you gave me quite a start! For a moment there, I though you might be a lawyer for Harvard! So tell me my boy, what brings you here?”

Harry explained he had been sent from Professor O'Dreary's class. “It's not fair, Professor! She teaches second-rate magic, she has absolutely stupid notions about the Dawk Arts, she doesn't understand anything! She's so bad I think . . .”

The headmaster raised a quizzical eyebrow. “You think what, Harry?”

“I think she might have been planted here by He Who Must Not Be Understood to make us all look ridiculous!” Harry was shocked that he had actually said it.

The Professor was quiet for a long time. “Harry,” he said kindly “you have to understand that what is important is not what Professor O'Dreary says. It's what she is that you have to focus on.”

Harry looked back at Demskidore blankly. “I don't ...”

The Professor took out his wand and waved it briskly. A complicated series of formulas, symbols and equations appeared in the air between them. Demskidore said triumphantly. “You see?”

“Nnnnnnnno?” Harry answered.

The headmaster sighed resignedly. “What this means is that it is impossible for nature to produce anything with a negative information content. Agreed?”

Harry nodded.

“So could Professor O'Dreary have happened by merely natural processes? No. Even the most extreme genetic malfunction couldn't produce an entity that can actually suck the intelligence out of a room. So she is living proof of the validity of magic, and we are very lucky indeed to have her here in Hogwash Baptist Academy.”

Professor Demskidore was beaming, but Harry still looked glum.

“Harry? Is something bothering you?”

“Well Professor, I don't know how to say this. . .  It's just that there has been a rumour that, you are, well . . . someone called J.K. Rowling said that you're . . . gay.”

Demskidore threw back his head and laughed. Tears streaming down his face, he pounded the desk with mirth.

After what must have been two or three minutes of hysterical laughter, he controlled himself enough to say “Harry, what I said to her was that when you take away all the statistical spellcasting and philosophical finagling, at bottom I'm a Poof man!”.

Date: 2007/11/24 20:20:37, Link
Author: Amadan
Quote
All of them


As a scientist, I demand evidence, dammit!.

Date: 2007/11/25 19:49:53, Link
Author: Amadan
Why is it, whenever I read Densye's posts, I think of Kliban?

Date: 2007/12/06 04:27:23, Link
Author: Amadan
Oops! Thought the title of this thread was 'Boob Club...

(Closes stained macintosh, shuffles off)

Date: 2007/12/06 04:32:49, Link
Author: Amadan
Akshully, just finished Empires of the Word by Nicholas Ostler, a history of languages. Very good, and comprehensible by mere mortals such as meself. It helped to amplify my hysterics over recent comments I saw somewhere by (I think) FL about how the Tower of Babel story was confirmed by modern linguistics, which he had just discovered.

Date: 2007/12/06 04:47:16, Link
Author: Amadan
Quote (Hermagoras @ Dec. 01 2007,19:01)
Reading Joyce's Ulysses again, for the umpteenth time.  But for the first time I'm reading it out loud.  ...

I have finally convinced her that Ulysses is actually a hilarious book.

I strongly recommend the Ulysses audiobook, particularly because Joyce put so much effort into crystallising Dublin accents.

I used to play it in the car and ended up bellowing "Shoite 'n onions!" at drivers who offended me.

Date: 2007/12/19 08:45:25, Link
Author: Amadan
In anticipation of a special anniversary tomorrow...

I Am the Very Model of a C-Design-Proponentsist

[Note: Malicious allegations have been made that this work somehow plagiarises something by W.S. Gilbert. Nothing could be further from the truth and I emphatically state that I have nothing to apologise for. And I'm really sorry. Comments on this subject are now closed.]


I am the very model of a c-design-proponentsist
The diametric opposite of all that is materialist
My engineering cert allows me call myself a scientist -
We won't discuss those classes in Biology I might have missed

I work in a diploma mill I call a university
And there I struggle long and hard to teach the controversity
I welcome all opinions notwithstanding their diversity
I just reject the fact-based ones as atheist perversity

He just rejects the fact-based ones as atheist perversity
He just rejects the fact-based ones as atheist perversity
He just rejects the fact-based ones as goddam pervertersity


My publication record is quite pre-dispen-sensationalist
I regularly top the polls of books that are salvationist
Applause in the reviews keeps copies flying off the bookstore shelf
I couldn't be more pleased if I had written the reviews myself

He couldn't be more pleased if he had written the reviews himself
He wishes Amazon would keep his IP numbers to itself


When I go up for tenure I'll submit my publication list
And if they ask for science then I'll scream “Discriminationist!”
Religion has no place within the quest for natural knowledge
At least until I am the one who's put in charge of college

I'm waiting for the day in court when Darwin meets his Waterloo
Though I might find that testifying isn't what I ought to do
I know that what's in Genesis is strictly and completely true
It's just a shame it's stuck in a six-thousand-year-long peer review

He knows that what's in Genesis is strictly and completely true
He knows that what's in Genesis is strictly and completely true
He wishes that the IRS would let him see his research through


I claim that Dover came about because the judge was activist
I dazzle congregations with my jargon that's distractivist
I never answer awkward questions even if you do insist
I really am the model of a c-design-proponentsist

He never answers awkward questions even if you do insist
He really is the model of a c-design-proponentsist

Date: 2007/12/19 10:06:12, Link
Author: Amadan
Quote (Mister DNA @ Dec. 19 2007,09:32)
 
Quote (Lou FCD @ Dec. 19 2007,09:09)
 
Quote (someotherguy @ Dec. 19 2007,10:01)
Post of the week right here!

Seconded.

I agree, only on the condition that he go back and add a gratuitous edit.

Ah, but I did! In the first stanza I changed "may have missed" to "might have missed".

Can I have my complementary doctorate in Divine Obfuscation now?

Date: 2007/12/19 12:29:28, Link
Author: Amadan
Quote (Rob @ Dec. 19 2007,12:19)
Fafarman:      
Quote
IMO anyone who has read several of the popular books about evolution should consider him/herself to be fairly expert in the field.

I'd love to watch Larry in court, especially when he brings in his "expert" witnesses.

Honest, that pome was intended as a parody!

Well, that makes me fairly expert on ... no hang on a minute, those are magazines, not books.



Date: 2007/12/19 14:29:54, Link
Author: Amadan
Quote (Bob O'H @ Dec. 19 2007,13:23)
  Can I have those magazines when you've finished with them?

Hmmm. You sure? I have a hell of a time getting the pages apart.

Date: 2007/12/20 04:05:36, Link
Author: Amadan
Quote
19

William Dembski

12/19/2007

7:01 pm
ChristopherSaint: Give us more credit, please. My dad got his PhD in biology at the the University of Erlangen and my parents live in Germany. My uncle was a professor of ergnomics at the Technische Hochschule in at the time West Berlin. I know the scene in Germany and elsewhere in Europe . . . In any case, I’m fluent in German . . .


...which is why, when my first post on your blog referred to "Büstenhalter front-loading" you nodded sagely, and Scrotus complimented me on a "great post"!

Arschloch


Date: 2007/12/20 04:50:02, Link
Author: Amadan
They're recruiting at the Evolutionary Informatics Lab!

Somehow, the late lamented B. Kliban always has something relevant to add to the ID Tardis:



PS: Having trouble posting some images, can someone PM me about URL lengths & format rules? Mucho thanko

Date: 2008/01/11 04:15:23, Link
Author: Amadan
Not entirely on topic, but too important not to share with you good people.

A recent encounter in a different forum (yes, my dear, I have been unfaithful) has revealed to me a wonderful way of giving fundies a brain-fit: assert that the Rapture has already happened.

They will instantly spew loads of reasons why it couldn't have (three-headed lesbian pope not yet elected, Jerusalem still got Ay-rabs in it, etc). But a passing familiarity with Bible-babble will allow you to rebut these.

But most importantly, you should point out that it means that your correspondent wasn't holy enough to catch the sky-train. That should prove impossible for them to accept. Ever. Humility, after all, is a christian virtue. [/sarcasm]

Date: 2008/01/11 04:21:32, Link
Author: Amadan
I

Date: 2008/01/11 04:21:57, Link
Author: Amadan
hope

Date: 2008/01/11 04:22:21, Link
Author: Amadan
i'll

Date: 2008/01/11 04:22:38, Link
Author: Amadan
have

Date: 2008/01/11 04:22:57, Link
Author: Amadan
enough

Date: 2008/01/11 04:23:30, Link
Author: Amadan
posts

Date: 2008/01/11 04:23:50, Link
Author: Amadan
to

Date: 2008/01/11 04:24:10, Link
Author: Amadan
contribute!

Date: 2008/01/15 20:12:10, Link
Author: Amadan
The greatest rhetorical strength of YEC argumentation is the certainty it asserts in debate. It damns science by its inability to state as a fact that X always follows as a consequence of Y. It plays on the provisional nature of deduction in scientific discourse: "So you can't state as a fact that this fossil is a direct descendant of that one?" And this is done before an audience whose system of understanding is based on a strict division of right from wrong and fact from supposition.

It's important to bear in mind that the purpose of these debates is, from the YEC perspective, to preach to the converted. The unstated subject matter is the compatibility of the audience's flavour of Christianity with science. As a result, point-by-point refutation is only going to yield a crop of glazed eyeballs. They are using rhetoric tailored to their audience, and to win you must do the same.

My preference would be to highlight the provisional nature of science. Your audience is accustomed to classifying secular human judgement as fallible. So you could say, for example, that every conclusion asserted by science is qualified by an implicit "This may not be correct..." or "As far as we can tell..." or "The explanation that best fits all the available evidence is ...".

But this is not to say that facts are relative or provisional. You can rightly point to the myriad data relied on by scientists, and you can attack your opponent for ignoring it, or for cherrypicking. (Remember, the audience has very strong opinions about deceit). So yes, the fossil record alone does not lead inevitably to my conclusion, but how can you reconcile your position with the biochemical, geological and physical data? They are objectively there: I can accomodate them, can you?

But to be honest, it's all about apologetics and politics. The scientific argument is not going to be influenced by the likes of AIG. As a Southern Fenian Bastard, my opinions on politics Up There are unreliable, but I get the impression that the hard core of DUPers (that's osculospumatory fundies, for the benfit of youse lot in Murka) who want their kids to have their ignorance refined in school are a lot less influential than the main body of the vote. Highlighting the broad acceptance of science among Reformed churches will probably get you more traction than associating yourself with Dawkins, the Devil's Acolyte. And it is worth considering that all those biotech firms that flourish in the Papish Republic will be less than impressed if the North's science grads are pig ignorant. Remember the old cliche about loyalty to the half-crown more than the Crown...

Sin mo cuid.


Edit: Because I'm worth it

Date: 2008/01/18 10:06:26, Link
Author: Amadan
My inner geek was drawn to their Instructions to Authors pdf, and I found this amusing bit in it:

Quote
The following are some general questions which, if answered, will aid in the development of the body of the
paper:
a. Does the body provide enough information to convey the intended point(s)?
b. Is unnecessary material included?
c. Has the material been divided into main headings and subheadings, and do these
divisions emphasize the important points of the paper? Do the subheadings support the main
headings?
d. Is the subject matter developed logically? Is it free from gaps and discontinuities?
e. Has the best possible use been made of graphs, charts, photographs, and line drawings, and are
the illustrations well prepared for reproduction?
f. Do the facts presented adequately support the conclusion?



But a truly bizarre and disturbing gem occurs in the section on Common Style Issues:

Quote
Foreign Words and Phrases—Italicize uncommon foreign words, but regular font for common words.
Foreign words and phrases should be italicized only if they are uncommon to our readers:
Lebensraum (italicized)


Lebensraum??? What kind of science journal thinks it's likely to have to deal with that term?

Please help me here: what is going on in these people's minds?

Date: 2008/01/18 18:30:04, Link
Author: Amadan
Yes, these are the people who put the 'fun' into 'fundamentalist'.

Mind you, they're also the ones who put the 'mental' in it.

Date: 2008/01/20 18:14:23, Link
Author: Amadan
Ah, Texas!

The wide, empty spaces,





surrounded by teeth. . .

Date: 2008/01/23 10:47:30, Link
Author: Amadan
Evolution in action:

From this...




to this...



to this?



Happy Birthday Wes!

Date: 2008/01/24 15:42:57, Link
Author: Amadan
[quote=Bob O'H,Jan. 24 2008,11:13][/quote]
Quote
You should also read his other book, "Them".  It's about people who believe that there is an international conspiracy of silence and control of the masses.  What this has to do with UD you can decide.


Don't be silly. If there was a sinister international conspiracy operating through UD, they would have moved long ago to silence contributors boards like this that hold them up to ridicu

Date: 2008/01/29 15:05:50, Link
Author: Amadan
It makes me really ANGRY wqhen CARPENTERIST'S make a mokery of the TRUETH that Evolution revealed to the world, these guys are so dumb they say that their only doing religious stuff but thats A LIE!!!! CARPENTERISM IS A SCIENCE JUST LIKE ANY OTHER SCIENCE, !!!

Anyboddy can see that CARPENTERISM needs whole lot more EVIDENCE then Evolutionary SCIENCE, when Carpentersists say “Oh, you cant prove that the worl was made by a guy in the sky, you just got to hvE FAITH” their LYING, they realy mean “We have lot's of EVIDENCE that we can use to proofe to you how the Universe came about frm a snigularity and people evolved from older species, but we cant show it to you or youll say we havint got no FAITH”!!!! All those Theologians say that PING one day they just got a load of faith, but if you look at what they say youll see they all had to use som EVIDENCE to get it, like looking at books and stuff that show what poeple said and did and thought and stuff like that.

If Carpenterism was true, the Faith record shuld show a continuous series of GAPS in Evolution that COULD NEVER BE EXPLAINED EXEPT BY BLIND FAITH. But what did we get instead? A whoal load of TRANSITIONAL FOSILS that make faith look kinda stupid!!!!

Most CARPENTERISTS are DUELISTS, they think they're bodys and soles are different. They don't like methodological materialsm, maybe their momma spankd them to hard with a MATERIAL paddle. LOL.  Well we Evolutionists know whats in store for them, an ETERNITY in PEER REVIEW.

Date: 2008/01/30 08:44:15, Link
Author: Amadan
Quote (Mr_Christopher @ Jan. 29 2008,13:37)
That's what's lacking in the atheist religion.  We need some canibalistic rituals.

[Dum ti dum ti dum . . ]

Those dang Christians get all the cool stuff in their mythology and we aint got jack.


Akshully, what's missing is HYMNS!!

Now, as it happens, fumbles in pocket . . . just hang on 'till I whip this out . . .


Wander, Atheist soldiers, anywhere you may,
With the book of Darwin leading you astray.
As our moral compass swings an aimless arc,
We shall strive to lead the world into the Dark.

Refrain
Wander, Atheist soldiers, anywhere you may,
With the book of Darwin leading you astray.

Barbecuing babies, crossing ‘gainst the light;
No deed is to heinous for our evil fight.
Our big problem is, though, with no moral stuff
We can’t tell which actions are evil enough.

Refrain

So we’re left with Darwin, Evolution’s source;
But nat’ral selection’s an unguided force.
Chosing Bad o’er Good we must therefore defer;
Let our motto be, then, “Like, man, whatever...”


[Edit: Because you're worth it]

Date: 2008/01/30 10:04:52, Link
Author: Amadan
Seconded and thirded: never argue with a drunk or fundy.

In any case, who are you trying to persuade? Our hero isn't going to roll over on his livelihood or core convictions, and your audience is only there to have their Bible buttons pushed. As I've said before, the only way into their heads will be to show that your opponent is breaching one of their basic principles, e.g. by spouting heresy, or lying, or such like.

Date: 2008/01/31 04:13:10, Link
Author: Amadan
Has Mensa ever rejected a membership application? Given that their main saleable commodity is support for those with self-esteem issues, you'd have to be sceptical.

But in case there exists a group of such people, I propose a new association for those who didn't quite make it but who whose lives would be enriched by celebration of their  aspiration to mediocrity.

As 'Mensa' can mean either 'mind' or 'table' in Latin, the new group of those who don't quite make it all the way up could be called 'Sedecula'. That means 'stool', which has another equally appropriate meaning.

For fearless defence of ignorance in the face of ridicule, Honourary Life Presidency to DaveScrot, but who else belongs?

Names and full citations please.

Date: 2008/02/05 17:07:05, Link
Author: Amadan
Louis,

Very well put. Wish I'd said that.


("You will, Oscar, you will...")


[/jealousy]

Date: 2008/02/07 03:36:53, Link
Author: Amadan
Or submitted papers could be read only for as long as it takes to empty one's bladder, and so be pee-reviewed.

Date: 2008/02/15 05:00:57, Link
Author: Amadan
Quote (okboy @ Feb. 14 2008,17:22)
doh, i just got my first comment through moderation and the whole thread gets obliviated. i would have thought all that bible code training and thinking up acronyms would have made my hidden message easy to spot.

   
Quote
That's absolutely right. Don't they all realize? Do they all really deny that atheism = rigid dogma? Think about Richard Dawkins: he says the atheist's raison d'etre is to abolish religious doctrine, but they all revere darwin!


There ought to be a name for that sort of thing: a horizontal acrostic? Or, more elegantly, a WADScrot? Yes, I like the ring* of that. . .

Very nicely done, sir.

And remember kids, True Atheists Reject Darwin!





* ahem

Date: 2008/02/15 06:09:06, Link
Author: Amadan
How would anyone here like to get involved in writing the Epic Surging Saga of the Evolution Wars?

Date: 2008/02/26 06:11:12, Link
Author: Amadan
Is it relevant somehow that Salamanca is where Franco was proclaimed Generalissimo? Are we on the verge of a power struggle within Creationism? Is Dr Dr D. no longer to be The Wizard of ID?

Apropos nothing in particular, the names of the Chancellors of the University of Salamanca are painted in large red letters on the walls of the cathedral there. They fade over time, but that of the dear Caudillo is kept in mint condition.

¡ Cara al Sol!

Date: 2008/02/28 03:49:55, Link
Author: Amadan
I find it significant that all revealed religions seem to include miracles as part of their mythology. As I understand it, psychologists attribute this to an economy of mental processing: given a world-view that includes an actively interventionist supernatural power, the simplest explanation of counterintuitive events is to attribute them to supernatural causes. This works for both 'good' miracles ("I can see again!") and for 'bad' ones (e.g. plagues, tsunamis, and other ahem Acts of God).

In the end it comes down to epistemology: are you prepared to count as true or factual a statement that is, on the available evidence, incapable of being falsified? If so, you are making an exception to the general rule of human conduct and discourse, and in my opinion you shift the burden of justification onto yourself.

Not altogether facetiously, you could argue that some miracles are arguments against theism. I have read that the spontaneous appearance of particles from the quantum foam can be shown to occur. Does this not militate against the need for a Creator?

There y'are, and €0.98 change.

Date: 2008/03/02 18:11:46, Link
Author: Amadan
As I read it, that puts you in the agnostic camp, at least as far as the phenomenon of miracles is concerned. If I can presume to summarise your position, you maintain that as long as a rational explanation is at least conceivable, there is no reason to impute supernatural intervention. Hence, miracles (so called) are not evidence for theism, because rational explanations are (usually) available.

Which leads me back to a point I made earlier: revealed religions have a strong tendency to invoke miracles in their scriptures. I'm no expert, but my understanding of the Abrahamic religions, of Zoroastrianism, of various forms of animism, European paganism and mystery religions, is that they all make counterfactual claims involving resurrection from the dead, intervention in the weather, striking the bad guys dead, or the likes. All attribute these to supernatural forces, be they Odin, or the god of your choice acting through the prophet of his choice.

The message of these are all the same: my sky-daddy is bigger than the other bloke's sky-daddy. So the thesis of this thread has missed half the point: miracles (so-called) are not 'arguments' for theism, they are the strongest  'evidence' they can claim.

This is why ID chimes with the faithful: it expresses incredulity in terms of probability. That it does so in a way that provokes real mathematicians and scientists to giggles is irrelevant. Its purpose is to present reality as a miracle.

Date: 2008/03/02 18:49:14, Link
Author: Amadan
Quote (George @ Mar. 02 2008,12:21)
 
Quote (oldmanintheskydidntdoit @ Mar. 02 2008,07:08)
I think DS might be having some sort of brain-fart

     
Quote
Shu-Kun Lin’s statement about interchanging thermal order for other kinds of order being non-sensicial described my immediate reaction to the “canned” response from Darwinists that the earth is an open system. That it’s nonsense to willy-nilly exchange thermal order from the sun into chemical order in living systems should be obvious. It isn’t obvious to them and it’s frustrating when careful explanation fails to get the concept across.


a) non-sensicial? Is that some sort of Japanese wine?
b) DS' "I violate SLOT" comment obviously still burns him up.
SLOT

Someone should tell the tomatoes so they stop relying on photosynthesis.



The Tard is powerful in this one . . .

Date: 2008/03/02 19:30:03, Link
Author: Amadan
I have paid my dues.

I tardificated UD for some time before being obliviated. I have shouted in the leaden ears of nitwits. I have expended in long and fruitless debates electrons that could have been used to view naked ladies.

So why are we devoting so much time and effort to Uncommonly Dense?

It's not as if it was the focus of some potent conspiracy: if anything, its a refuge for the mediocre and insignificant.

It's not the fulcrum of fundie fulmination: that distinction goes to AIG and the likes. There is far greater scope for sock-puppet tomfoolery there.

Dembski, Densye and Davetard, the Three Stooges of Intelligent Droolery, are simply boring. They have exhausted their potential for scientific ridicule, political pummelling, and even for satire. There is a wealth of talent and intelligence in this forum that could be put to use elsewhere.

I propose that the focus of this establishment be moved to places more important to the culture wars (I nearly typed 'wards', which was serendipitous), and which provide far more scope for entertainment.  

Certainly, UD harbours a few nuggets of anti-talent whose exploits can and should be exploited. But this could be done more fruitfully in the wider context of the creationist family, of which ID is merely the Son We Sent To College But Who Ended Up A Bum Like The Rest Of Us.

Und?

Date: 2008/03/02 19:54:51, Link
Author: Amadan
Point taken.

Favourite haunts are usually lurkeries suggested by FSTDT.com, though I have resorted to the odd manumanekin.

More tomow: bed beckons; Sleep, sleep, that knits the ravell'd sleeve of care...

Edit: 'a' for an 'e'. Not that enyone cares.

Date: 2008/03/03 02:34:00, Link
Author: Amadan
To summarise:

1. Observations of the brain doing what the brain does show that the brain is not doing the doing.

2. The immaterial doer doing the doing is by definition unobservable and distinct from the brain. Observations confirm this and suggest relevant sites in the brain.

3. Now that you've bought my book, buy my book.

A good review, Bill. Thanks.

Date: 2008/03/03 02:37:43, Link
Author: Amadan
Gnash. S'pose you're right.

I'm off to Amazon to pick a fight. They won't let me back onto Rapture Ready.

Date: 2008/03/04 16:01:26, Link
Author: Amadan
Is this what Americans refer to as 'taking one for the team'?

Date: 2008/03/06 10:41:53, Link
Author: Amadan
I think we’ve hit on something here. God is an object-oriented programmer!

1. Class: Religion is, after all, the opiate of the masses (though personally I prefer beer)
2. Inheritance: Hey, what do you think all that stuff about the Father and the Son is for anyway?
3. Message passing: Also known as ‘prayer’. Java programmers refer to this concept as ‘method calling’, perhaps because fundies in full flow look and behave like bad overacting
4. Encapsulation (i.e. concealment of an object’s methods from the entity that calls it): Or in other words, ‘Strange and mysterious are the ways of the Lord’. The fact that God appears to do nothing when called on simply proves that He exists.
5. Abstraction (i.e. simplifying reality): Well, isn’t it true that nothing makes sense without religion? (For more on simplified real-world entities, see the entry on Denyse O’Leary)
6. Polymorphism (i.e. the ability to treat child objects like their parent objects): This is closely related to the Xtian concept of treating grown adults as if they were children, e.g. by feeding them fairy stories and threatening them with Eternal Grounding and no [Last] supper. “And just wait till your Father gets back here!”

QED

Date: 2008/03/06 11:11:50, Link
Author: Amadan
Oh I get it!

It's Stag party!

Date: 2008/03/06 13:14:03, Link
Author: Amadan
Check out some of Sandin's stuff:

http://www.scipool.com/doc/doc200304010401.html

Lots of cultural critique of poor old Darwin, but not much by way of scien . . . hang on, is that ... YES!

"Quantum Nature" !!!

"Bacteria: "Quantal Life" "!!!

We have hit the Quantum Jackpot! This guarantees Sandin a place in the hallowed halls of Woo!

He'll feel right at home in UD.

Date: 2008/03/07 15:53:00, Link
Author: Amadan
I'm with the nay-sayers on this one.

Here in Ireland the Constitution recognises parents as the primary educators of their children. Now while that is historically grounded in Catholic doctrine, it is a position I support. In fact, it simply recognises reality.

Legally, it doesn't mean that parents can just opt their kids out of education. In fact, home-schooling here requires approval of standards etc much as the California judgment seems to. However, that is not assessed simply by reference to a teaching qualification, which would be a disproportionate barrier. Instead, the parents have to show that the curriculum and methods they use are good enough, and the kids are periodically assessed by the Dept of Education.

Date: 2008/03/11 06:11:36, Link
Author: Amadan
Using the Discovery Institute Quote-Extraction Algorithm, I found the following statement by Casey Luskin:

     
Quote
I . . . like . . . a long muscular body. . . a pelvic paddler


Source: http://www.evolutionnews.org/2007...._k.html

So now we know.

Date: 2008/03/12 09:55:16, Link
Author: Amadan
Quote (J-Dog @ Mar. 12 2008,09:23)
 
Quote (stevestory @ Mar. 12 2008,01:48)
Did Paul ever provide a single example of any argument in his dishonest little book that isn't decades-old creationism with the word creationism strategically deleted?

HaHaHa!   As if...  Not in this multi-verse.

I would at least like to hear about the turtles!

Michelangelo, Donatello, and I forget the other two.

Egad man! I do believe you have just disproven the entire modern evolutionary systhesis!

1. The teenage turtles are mutants
2. They do good by fighting crime, etc etc
3. Everyone knows that mutations are either neutral or harmful
4. Therefore they must have been divinely created during the Cambrian period.

Nobel prize fer shur. I might even get you a few tickets to Expelled. If you want.

Date: 2008/03/13 11:13:17, Link
Author: Amadan
Oh don't get your panties in a bunch...

Date: 2008/03/14 03:44:32, Link
Author: Amadan
Democracy in Turkey has had a chequered history. Although Attaturk led a secular republic, it was not particularly democratic. Joining NATO led to improvements, but parties taking a non-secular line, all shades of red, and "divisive" groups (i.e. supporting Kurds & other such) were streng verboten.

The military have traditionally supported the secular republic, rattling sabres whenever mere politicians deviated from the approved line, and occasionally taking over themselves when they considered it necessary. Nice guys. The Army stepped back in (ummmm) 1980, and the current govt is led by a party that describes itself as the Muslim equivalent of the German Christian Democrats. The Army can be heard clearing their collective throats loudly whenever a new pro-Muslim measure (e.g. headscarves) gets passed. In fact, Condi Rice invited them to 'demonstrate their traditional leadership role' when the parliament had the bad judgement to vote against supporting the Iraq war.

Malaysia is a better example of Islam working in a democracy. Indonesia still hasn't got the knack of the 'free and fair elections' thing. (Not that Malaysia is great at it, but Indonesia makes the point with an AK-47.) And there are millions and millions of Muslims in India which, despite Hindu fundie agitation, is a strong democracy.

So eat shit, DaveTard.

Date: 2008/03/14 18:28:59, Link
Author: Amadan
Edinburgh. Swansea is a dive.

Date: 2008/03/16 19:00:28, Link
Author: Amadan
Pharyngula featured this gem the other day:

Quote
Really do you believe both human eyes evolved with 3d focusing... at the same time- TWO SIMULTANEOUS randomly formed eyes? The evolution theory is even more weird as each male AND female 'randomly' developed the same two type eyes, That's four SIMULTANEOUS randomly formed eyes, dual random simulataneousness/duplicated!



...not to mention the probability of his evolving the ability to type without the need for a brain.

Date: 2008/03/18 18:48:35, Link
Author: Amadan
Yeah, right.

But when you see Chuck Norris doing push-ups, that isn't him going up. It's the world going down.

Date: 2008/03/21 12:28:20, Link
Author: Amadan
The Ballad of PZ Myers and Richard Dawkins
(To the tune of ‘The Mountains of Mourne’)


They say that Expelled is a wonderful flick
With its tales of shenanigans academic.
It shows evolution is really the cause
Of Hitler and Stalin and no Santa Claus.
It tells of the virtues of freedom of speech -
Professors should feel free to preach when they teach;
But the best bit occurs just before it begins
When PZ gets chucked out but Dawkins gets in.

Ben Stein is the picture’s amazing compère
He interviews Dawkins without being there!
He’d never go mining for quotes or mislead -
They have a scriptwriter who’s paid for that deed!
As a Nixon appointee, you’d think that Ben Stein
Would know that the cover-up’s worse than the crime.
But it seems that hypocrisy isn’t a sin,
So PZ got chucked out though Dawkins got in.

On the Last Day a trumpet will waken the dead
We’ll account then for all that we did and we said.
And the Lord will say “Ev’ryone who saw Expelled,
For supporting that rubbish, in Hell will be held!
But the rest of you people, untouched by its slime
Can join me in Heaven and have a great time.
Our movie tonight is Inherit the Wind:
So for Dawkins, damnation, but PZ, come in!”





Date: 2008/03/24 07:44:52, Link
Author: Amadan
Lesson: How to clear a (virtual) room quickly:

1. Bachelor of Civil Law
2. Solicitor, Republic of Ireland
3. Solicitor, England and Wales


Hello? Is there anyone . . .

Oh never mind.

Date: 2008/03/24 14:32:22, Link
Author: Amadan
Quote (Ra-Úl @ Mar. 24 2008,12:30)
 
Quote (Amadan @ Mar. 24 2008,07:44)
Lesson: How to clear a (virtual) room quickly:

1. Bachelor of Civil Law
2. Solicitor, Republic of Ireland
3. Solicitor, England and Wales


Hello? Is there anyone . . .

Oh never mind.

What is a BCL? I'm not familiar with British jurisprudence and Law studies, and what I do know is based on reading way too much Dickens, in Spanish translation, as a 12 year old. I see you are a solicitor; what kind of practice do you have? As a solicitor, do you deal with criminal matters? And what do solicitors drink?

Ra-Ul

The 'Civil' refers neither to manner (lawyers have no need of them) nor to Napoleonic legal systems. It just points out that the degree course is centred mainly on non-criminal law.

I no longer practise law, but before I got better I used to practise commercial law, specialising in European Union law and Competition. I never did any criminal work.

Date: 2008/03/24 14:33:50, Link
Author: Amadan
Solicitors drink whatever you can afford.

Date: 2008/03/29 13:48:54, Link
Author: Amadan
And don't forget

Oxygen Dihydride! - an essential, natural substance used by NASA and found in abundance in healthy, youthful skin.


Special TardMart discount offer: just $19.99 per tube*!



* Sold in easy-to-handle dessicated form - Just Add Water!

Edit: I really don't know what Louis is on about. Imagine not knowing that!

Date: 2008/04/01 20:01:34, Link
Author: Amadan
The promise of a Huckabee Administration may have gone. The hope of Secretary of Defense Chuck Norris delivering a roundhouse kick to the Bad Guys may have vanished like whatshisname’s weapons of whatchamaycallit .

But don’t let the True Believers down, guys.  Let’s give heart to the heartland! The faithful need facts! I give below some important True Facts that will sustain the core contsitune . ..  contistuentce . . . people who vote the right way.

1. Dr Bill Dembski’s cardigan isn’t really that long. It’s gravitationally lensed by the mass of his intellect.
2. DaveScot has banned more people than he has had sexual congress with. He is proud of this.
3. When Dr Bill Dembski considers a problem, it solves itself rather than face the force of his logical powers.
4. Intelligent Design has reversed the extinction of 69839 species killed off by evolution.
5. When DaveScot does push-ups, the Earth doesn’t let him rise up all the way because he’s so important and it needs  to stay close to him. This also prevents him doing too many.
6. The English language has a special section for Denyse O’Leary that only she is allowed to know about.
7. Kent Hovind is on an undercover mission. I can’t tell you any more.
8. “Richard Dawkins” has just two characters less than “I’m an atheist”. Go figure.

If your security clearance permits, you should let the people know those important True Facts that you know. C’mon people! Let’s keep the meme motile!

Edit: L'espirit d'escalier . . .

Date: 2008/04/02 18:54:16, Link
Author: Amadan
10. DaveScot was an A student all through High School. He looks forward to learning the other 25 letters in the future.

Date: 2008/04/07 06:58:01, Link
Author: Amadan
I was surprised and disappointed that Dr^3 WAD. failed to get a credit for this.

I mean, if the Bible Code is his sort of thing, shouldn't the Eggsplattertory Filter work on quotations from the Old Testament? Or does it depend on [kof kof] not taking the quote out of context?

Date: 2008/04/10 08:42:25, Link
Author: Amadan
Though I am a bit out of practice at that lawyer stuff, I  enjoy excellent digestion, and therefore have expert insight into the biological issues covered in Excreted – No Feculence Allowed.  I am moved by my sense of public service to suggest the following scientifically supported arguments in support of the film’s producers:

1.  XVIVO’s claim rests  - and fails  - on the assumption that the similarity of the clips could not have arisen by chance – in other words, that a so-called “Indelible Refiner” must have adapted the XVIVO clip in a way that left his inky fingerprints all over the place. In rebuttal, the producers maintain that the Excreted clip is by no means “refined”, and could have arisen by combination of (a) chance arrangement of pixels and (b) selection for fitness to include in their film. Given the standard of fitness required, this is perfectly possible.

2. XVIVO’s claim is premised on the pseudo-legalistic notion of “Irrefutable Complicity”. This is a post hoc argument to the effect that, because the two video clips are so clearly similar, taking away even one element of that similarity would destroy the frame-for-frame symmetry, and so undermine the derivative nature of the one in Excreted.  This is clearly false, as the Excreted clip retains its derivative nature even when (poorly) edited.

3. XVIVO seeks to make use of an “Exclamatory Guilter”, in other words, asserting that the producers must be in the wrong just because XVIVO says so. Basic justice, however, demands that the producers receive a fair hearing in a debate before a jury of their fellow believers.

4. The theory of Copyright is incomplete. Though it is supported unquestioningly by courts and followed slavishly in “peer-reviewed” articles by ivory-tower academics, it has never been observed in the laboratory, and has no identifiable source or agency in nature. What part of a cell does XVIVO suggest controls  ‘fair use’? Are giraffes supposed to register the pattern of spots on their necks in order to assert their identities? Copyrightism is at best a hypothesis, certainly not a “theory”, let alone a “law”.

5. Copyrightism fails to account for a huge variety of widely observed legal phenomena, such as food-labeling regulations, Section 21 of the Miscellaneous Provisions of the Florida Constitution,  pygmies, dwarves, or stuff like that.

6. Legal scholars and lawyers who present alternatives to “orthodox” Copyrightism are excluded from prestigious publications and are subjected to the humiliating experience of being “laughed out of court”. Further, those supporting Copyrightism openly base their arguments on textbooks and journals that all display the © Copyright symbol – a plain case of circular logic.

7. XVIVO claims that the producers are “bound” by the provisions of so-called “laws” (see # 4 above) of Copyright, and should be “punished”. However, the practices of “binding” and “punishing” are notoriously part of deviant sexual behavior that are not and should not be countenanced by the courts of a Christian nation. For the avoidance of any doubt, the producers unreservedly condemn such practices and have never, ever, ever been caught practising them.

Further advice available at reasonably competitive rates.

Date: 2008/04/10 10:29:55, Link
Author: Amadan
It seems you are mistaken. NFC stands for Nature Favours Christianity. The argument is related to those that support the view that gravity is at precisely the right strength to prevent missionaries in less fortunate lands from falling off.

NFC relies on the non-materialist doctrine of copywrong. This permits gene duplications to occur without increase of information. Legally, it is quite interesting. Simply put, the fee-simple copyholder can claim in rem that a non-repudiatory rescission is moot, given that the locus standi of notice parties at the interlocutory stage of interrogatories vitiates quasi-judicial application of the equitable doctrine of estoppel. Of course, this leaves open the availability of a plea in laches (subject to novation by the interceding party). But I'm sure you knew that.

Date: 2008/04/16 07:03:12, Link
Author: Amadan
I wouldn't be as positive as Louis and the other long-viewists. Nobody, least of all the ID hierarchy, doubts that the scientific argument is done. The battle is a political one, and where you have a large bloc of voters, you have politicians agreeing with them.

The theocrats are very unlikely to get their way, but an effect of their campaign's momentum is to move the agenda to the right. (Consider that Obama's politics are in many ways more conservative than the British Conservative Party's - when was the last time a 'liberal' in the FDR mould gained national prominence in US politics?)

So while you are not likely to see the Established Church of God's Own Country, we already see the economic and political consequences of pandering to the fundies.

It's not just scientists who need to be alarmed, it's everyone who disagrees with the Bushites and the politics they smuggle in under the camouflage of 'values', 'patriotism', and 'freedom'.

As I've said before, the only way to undermine the cheerleaders who bring in the votes is to expose them as deceitful and hypocritical. The Core Vote isn't interested in statistics and test tubes, but they most definitely frown on ungodliness, especially in those who lead them.

Date: 2008/04/17 09:13:35, Link
Author: Amadan
Quote (Peter Henderson @ April 16 2008,18:39)
I think the only positive thing (as I see it anyway) is that YECism is unlikely to spread outside of fundamentalist Protestant church circles.


Peter, don't forget the (ahem) tribal element: biblical literalism and its offspring are generally viewed as belonging to Paisleyites, so no Taig worthy of the name is likely to go for it. Also, I suspect there might be a class thing to it: even if they all vote DUP, Gordon and Deborah will cringe into the inner recesses of their BMW at the thought of being so closely identified with Sammy and Natasha from Tatoo Central.

 
Quote
Don't forget that Flat Earthism and geo-centrism both had their days. Yet, despite all we have learned over the last few hundred years there are still flat Earth and geo-centric creationists around.


A word of caution: just look at the damage that those types can cause when whipped up by Daily Mail style hysteria over vaccines and autism. Politics isn't just about majorities, it's also about momentum.

 
Quote
But then, I've had a good day. It was suuny yesterday (it gives you a lift when the sun appears in these parts) and dry today so I managed to get my grass cut for the first time this season before tomorrow's expected rain!


There's another garden to be done down here in Dublin when you're finished. OK?

Date: 2008/04/18 10:10:38, Link
Author: Amadan
Dr Wankenstein?

Date: 2008/04/20 10:32:47, Link
Author: Amadan
Speaking as a trained lawyer, I must endorse this remark. Lawyers are mendacious putes. Most probably think scruples are some sort of new breakfast cereal.

Date: 2008/04/20 10:36:03, Link
Author: Amadan
Speaking as a trained lawyer, I must object to the above libel of my learned and noble colleagues. Their commitment to the higher virtues and their selfless work in defence of those in adversity is universally admired.

Date: 2008/04/20 10:37:43, Link
Author: Amadan
Either of the above arguments is available for use for a reasonable fee, plus expenses and outlay.

Credit cards and pleadges of child labour now accepted!

Date: 2008/04/24 05:18:11, Link
Author: Amadan
How about this? Say CERN zaps enough particles to uncover evidence of the additional 6 (or whatever number of) dimensions that string theorists suggest are needed to give a complete account of gravity etc.

Say that intelligence exists in those dimensions and, through a counterpart of CERN's work (or maybe their equivalent of interference on their TVs), that intelligence becomes aware of our poking at their shell.

Communication is (somehow) established. The other side makes us aware that they have unequivocal proof that 'their' universe was deliberately and explicitly created for XYZ purpose. It becomes evident that 'our' dimensions exist as a work-around to accommodate the deliberately intended features of the 'their' universe. Our existence and actions are a matter of indifference to 'their' creator.

I'm just trying to work out how to fit in the love interest and a topless shot in the third reel.

Date: 2008/04/25 03:16:10, Link
Author: Amadan
This was so good I had to link to it here.

A very persuasive argument that ID most strongly supports our charitable friends in the Unification Church.

Date: 2008/04/28 06:55:31, Link
Author: Amadan
Quote (k.e.. @ April 27 2008,21:06)
 
Quote (J-Dog @ April 28 2008,03:59)
   
Quote (Maya @ April 27 2008,19:11)
     
Quote (k.e.. @ April 27 2008,11:01)
     
Quote (Bob O'H @ April 27 2008,18:44)
It's gone quiet here, all of a sudden.  Was it something I said?

Louis farted

k.e. is English?

I think he is from New Zealand.

Correct. I am a South Sea Pom. with dual nationality the other being shaoránaigh na hÉireann, to which I have never been.
An expatriot for 34 years and permanent resident of Oz.

Edit: saoránach na hEireann, unless you suffer from acute schizophrenia.

No wonder the First National Language is in danger of extinction.

(Nothing to do with the crappy way it's taught in school or the fact that its only practical use is to discuss the physical attributes of foreign ladies in their presence, of course)

Date: 2008/04/29 06:58:16, Link
Author: Amadan
Quote (Reciprocating Bill @ April 29 2008,06:53)
The Cleveland Museum of Art has a beautiful lagoon on its property that is plagued by Canadian geese. The walkways around the lagoon are often slippery with goose shit.

One recent measure was the installation of several extremely lifelike (deathlike?) models of dead geese anchored in the lagoon, heads down and feet up.

I've always wondered if that worked. I would have thought that avian intraspecies recognition would depend upon much more than visual verisimilitude (e.g. behavioral, auditory and olfactory cues).

Ftk?  (The bird is dead).

It wouldn't work for FTK. Just look at the way that Creo Fundies are drawn to a dead duck like ID.

Date: 2008/05/02 14:32:25, Link
Author: Amadan
Forgive me serving up reheated electrons, but this is a retelling of an old tale that I recently posted at my blog. It seemed germane (and just a little frenche).

Father Jerome's Miracle

Father Jerome grew up in the city. In school, he would explore the realms of perfection revealed by music and mathematics. He preferred the lives of the saints to the earthy exploits of his classmates on the sports grounds. He was a solitary boy but content in his world of ideas and abstraction. In the seminary he excelled in philosophy and theology, and a career as an academic, or maybe even the Curia, seemed to await him.

No one's surprise could have been greater than Father Jerome's when he was posted to a lonely parish in the wind-swept hills. Where was Aquinas when Father Jerome heaved one muddy boot after another to visit a sick shepherd in his hovel? What chance had Palestrina among jostling, mischievous choirboys who could scarcely read their schoolbooks, let alone music? But Father Jerome found strength in the faith that his great learning told him was true. The months became seasons, the seasons years, and Father Jerome grew to love his simple people just as they loved him. He smiled when they ploughed carefully around a patch in a field so as not to disturb the fairies who lived there. He blessed their lambs against the evil eye. He knew the Lord was a man who worked with His hands, who came from people like this, and He would understand. Even if the country folks' heads were full of magical creatures, their hearts remained open to God's love.

Father Jerome was walking to a dying woman's house when he first heard the voice. “I can see you, Father Jerome, but you can't see me”. Father Jerome was no stranger to pranks. How often had he left the school and found that a toad had taken up residence in his hat? He would join in the laughter and solemnly name the toad after the conspiracy's ringleader. But this was different. The speech seemed to come from everywhere but nowhere. It whispered with an aetherial hollowness as if it was the voice of the mist itself. His duties and the darkness precluded investigation, so Father Jerome continued down the winding track, a puzzled frown creasing his brow.

The old woman's struggle ended late in the night, and it was nearly dawn when Father Jerome returned home. When she arrived for burial two days hence, he would place her rosary beads around her rough cold fingers and pretend not to notice the three stones and a feather secreted in her mouth. Weariness overcame him and he sat down to doze before first Mass. But then that same voice: “I can see you, Father Jerome, but you can't see me”. Father Jerome sat up startled. No, nobody but he was in that still and austere house. Had he been dreaming?

As Father Jerome went through his day's work and devotions, the voice followed him. Anxiety seeped into his usually placid being. Was he ill? Why did nobody else seem to hear it? Was God taunting him, mocking some part of Father Jerome's mind that disdained the humble faith of his flock? Prayer brought no answer or respite, and Father Jerome began to despair at the thought of his torment continuing.

That evening, exhausted, he merely poked at his frugal supper and retired early. Despite his weariness, sleep eluded him as he waited, dreading the return of that voice. And return it did. Father Jerome closed his eyes, tried to turn his thoughts to the glories of high reason and not admit defeat to mere superstition. But the dark hours of the night can be Gethsemane for a soul thrown into doubt. Before he knew he was doing it, Father Jerome found himself speaking to something that all his learning told him could not be there.

“Who are you? Why are you tormenting me?”

A long silence filled the small bedroom. And then an answer:

“I have forgotten who I am. But you can help me be myself again”.

“I minister to the living and dying of this place” the priest cried, “How can I help one such as you?”

The chill and empty voice replied: “A soul can lose its body just as a body can lose its soul, holy man. Will you not help me to walk the earth as a body and soul again?”

Father Jerome sat bolt upright. “I am a priest, not a witch! You ask too much of me, spirit!”

“Then can you not ask Him who is almighty to do what you cannot?”

The sharp answer in Father Jerome's throat stopped short as he thought on what the voice asked. Surely God would never object to prayer? If it put to rest the spirit, or at least silenced it, well and good. And if it did not, what harm? So Father Jerome knelt down on the cold stone floor and began to pray.

As the long night wore on, Father Jerome pounded Heaven with prayer. He beseeched the Lord to hear his plea for the spirit who had visited him. He begged the Lord to forgive his arrogance and pride. He cast aside reliance on learning and books, and abandoned his very being to hope in his creator's unfathomable mercy.

As the grey tinge of the emerging day began to dispel the night, a euphoric calm settled Father Jerome's troubled breast. A profound, unshakeable reassurance touched his being, as if a strong gentle hand had caressed him. Was it a dream, or did he hear a deep voice that knew every fibre of his being say “Well done my son, your faith is precious to me”? And prostrate on the stone floor, Father Jerome fell into a deep dreamless sleep.

The insistent knocking of the village woman who cooked and cleaned for him woke Father Jerome. Startled, he stood up to answer the door, the night's events a confused collage of memories. But a sound made him turn around. Looking at the bed, not daring to credit what his eyes saw, he pulled back the thin blanket. And there, curled up in the golden light of the rising sun, was the perfect form of a boy, no more than twelve years old.

Ladies and gentlemen of the jury, that concludes the case for the defence.

Date: 2008/05/19 18:35:00, Link
Author: Amadan
Lemme see . . .

Is it the seat from which Billy Three-Docs expostulates ex cathedra?

Or is it proof that the satanic darwinian tree of life has only fictional branches?

Has it something to do with armchair scientists?

No, hang on! I've got it! Those wavy bits at the top have buds on them . . . that means that beleaf is superior to mere root-and-branch empricism.

See? The answers are all in the Bible.

Date: 2008/05/20 06:38:16, Link
Author: Amadan
Quote (PTET @ May 20 2008,05:55)
Don't the French have a saying like "I thought of it on the stairs". It's always after the fact that you realise how good you almost had it...


French: L'espirit d'escalier.
German: Treppengeist
Homo eblanus: "Feck!"

Anyone visiting for rugby internationals, ethanol therapy, or the unique tribal events that are GAA matches please PM. Stalkers by arrangement only (there may be a queue).

Date: 2008/05/20 08:05:13, Link
Author: Amadan
Europe approaches its cultural perigee on Saturday evening in Belgrade.

Those of youse who have a vote are expected to use it (repeatedly, you all know how) the right way, or I shall be obliged to make use(*) of these most interesting negatives that have (ahem) somehow come into my possession.

Animal husbandry indeed . . .

(*) subject to permission of the goat's parents or guardians

Date: 2008/05/21 02:48:04, Link
Author: Amadan
*sigh*

Such a senseless waste of talent. Such aesthetic numbness.

Oh well.  Anyone who wants their goat pictures back just add a response here to let me know.

(J-Dog, are those ones twins?)

Date: 2008/05/21 04:46:22, Link
Author: Amadan
Here y'are:



How did you breathe in there, Louis?

Date: 2008/05/21 17:51:53, Link
Author: Amadan
For those who have no idea what the hell this is all about, I present Eurovision for the Uninitiated.

Date: 2008/05/22 18:00:43, Link
Author: Amadan
Quote (George @ May 22 2008,15:57)
Speaking of the most appalling collection of noise that calls itself music . . .Billy and the Evolanders would make a pretty good name for a band.


Depends on the type of music. That would suit a 60s beat group, but if they were going for a Summer-of-Love psychadelic Fillmore West kind of thing, something like Dr Bill's Design Detection and Salvation Confraternity would be more the thing.

More:

-    ID-Rap: XPlanetRy Philtr

-   Grunge: TARDbomb

-   Punk: The SLoTs

 
Quote
. . .stuck in traffic on the M50


Sympathy. They made a parking lot and called it a motorway.

Date: 2008/05/26 10:02:42, Link
Author: Amadan
Just came across this, apologies if anyone has encountered it before.



Like evolution, it organises and explains all that confusing data.

Quasi-edit (i.e. added after preview): My creaking recollection of Venn diagrams suggests that the circles should be enclosed in a rectange U representing the universe of ideas. Or perhaps UD representing the universe of Tard?

Date: 2008/05/27 10:36:02, Link
Author: Amadan
Thanks for the links to the fresh meat.

I have to say, I've gone off UD ever since it lost its sense of ambition. At least the YECs are still in militant evangelical mode. UD is like a knitting circle where everyone is waiting to see who'll be next to drop off.

As regards the future of this gibberish, one option they seem to have kept on the back burner is the 3rd world. Just think - weak education policies, strong religious cultures, declining Catholic influence. At the moment, fundagelicals in S. America (and to a lesser extent in sub-saharan Africa) tend to operate in anti-establishment mode, but it wouldn't surprise me if they tried to wedge a few of their own into the power structure. It would make for a hell of a base, and would soak up support from the megachurches in the Heartland.

Date: 2008/05/28 10:34:54, Link
Author: Amadan
* sneer *
Ken Ham may have animatronic dinos and the Fall of Man Bungee Jump, but we've got teh real Hi-Tech!

Date: 2008/05/28 19:05:55, Link
Author: Amadan
Nah, I only go there to make sure that the local boys are maintaining standards. (They do). Besides, my handle has already been nabbed there, so I have to post as Crocoduck Rex.

The One True Tardlode is in Murka, not Yurrp. There are very good reasons for this.

Date: 2008/06/04 08:51:41, Link
Author: Amadan
Quote (Annyday @ May 17 2008,10:14)
GASP! God's a Chinaman! We've been wrong about it being Jesus all along.

Stop spreading confucian among the faithful.

Date: 2008/06/04 15:37:12, Link
Author: Amadan
Quote (k.e.. @ June 04 2008,09:18)
 
Quote (Amadan @ June 04 2008,16:51)
   
Quote (Annyday @ May 17 2008,10:14)
GASP! God's a Chinaman! We've been wrong about it being Jesus all along.

Stop spreading confucian among the faithful.

Man who lay woman on ground gets piece on earth.

<Brooklyn Accent>
Hey, if Jesus was a Jew, how come he got a Mexican name?

Date: 2008/06/15 10:19:04, Link
Author: Amadan
Quote
Dr Dr Dumbskidore

A Catholic priest friend of mine attended Yale as an undergrad in the late 40s / early 50s. He found that the secret to getting an A on a paper was to assess four competing positions, sniff skeptically at three of them and then make sure to sneer at the remaining one.


Funny, that's their approach to altarboys too.


Dembski - the man who puts the anal in banal.

Date: 2008/06/16 15:17:37, Link
Author: Amadan
Kindred spirit

Date: 2008/06/24 09:15:48, Link
Author: Amadan
I'm in for €25.00.

PayPal?

Date: 2008/06/25 10:42:38, Link
Author: Amadan
This is how you explain ID in plain language!

(Not sure if I've got the hang of the slideshow stuff yet, hope it works).








Date: 2008/06/25 16:25:45, Link
Author: Amadan
Nope, didn't contact him at all.

Do your good works by stealth, etc etc.

And thanks to all who made nice noises about it.

Looking at it again, I see lots of little mistakes to be tidied up. (Post-hoc editing, an AtBC tradition.)

Any suggestions/requests for further works of litterature?

Date: 2008/06/26 03:52:21, Link
Author: Amadan
Quote (Bob O'H @ June 26 2008,03:05)
Could The Very Hungry Caterpillar be done solely with cheesy poofs?

Perhaps. Unfortunately, Ms O'Leary's legal advisers are proving difficult about an adaptation of My Pet Goat.


Edit Yadda yadda yadda

Date: 2008/06/26 04:08:34, Link
Author: Amadan
Photobucket seems to cause major problems for a lot of browsers, so I've rejigged the slide-show to run under Picasa, which works much better.

The Definitive Version (until the next one).

Date: 2008/06/26 04:51:32, Link
Author: Amadan
Quote (stevestory @ June 26 2008,03:55)
http://s283.photobucket.com/albums....ideshow

why am i just hearing about this? why am I hearing about it through PZ instead of here?

http://scienceblogs.com/pharyng....ree.php

A better (if that is the appropriate word . . .) version is available through my blog.

Date: 2008/06/26 06:20:18, Link
Author: Amadan
Quote (Steviepinhead @ June 25 2008,20:26)
I did a couple of summer things early--Grand Canyon backpack in mid-April (ya don'ts want to do it in mid-summer, too frickin' HOT!)

So guess when Yr Humble Corrspt. is going to visit the aforementioned aforementioned?

Correct.

However, seeing that the Atlantic Ocean is currently trying to transplant itself into my back garden, anything involving sun would be welcome, Club Gitmo not excepted.

Also taking in SF, bits of National Parks, Vegas, driving down the coast, and gawping at LA.

Given the lax state of US laws on divorce, I have been careful to remove one potential ground for it by reserving a car with SatNav.

Yippee for the strong Euro/Dollar-up-the-Swannee!

Date: 2008/06/26 12:11:00, Link
Author: Amadan
Has anyone seen this?

This looks like something dreamt up by
(a)  a bored columnist with an April Fools' deadline approaching
(b)  a creationist troll
( c) Fox News

The rationale (if that is the word) seems to be that Cheetah shares [insert some impressive number here] percent of his (her?) genome with us. Or vice versa.

To which I answer: So bloody what? Does that give apes rights? If the closeness of their relationship has moral implications (and I don't think it does), those implications affect how humans (who are moral actors) deal with apes (who ain't).

Now you could say that you can't enforce morality, only punish its breach, and that rights give a means to prevent those breaches happening. But in this case, that only adds up to allowing some third party to call in the animal welfare people. It hardly needs to be dignified with the term rights.

Anyone?


Buehler??

Date: 2008/06/26 12:19:12, Link
Author: Amadan
[Graffiti moved to Bathroom Wall. -Admin]

I take your point, but I was referring to the (apologies for correct spelling) "If we're related to monkeys, why don't you marry one, huh?" line of argumentation.

Plenty of that about.

Date: 2008/06/26 18:04:25, Link
Author: Amadan
Quote (Steviepinhead @ June 26 2008,15:54)
And then there's our current president.

Where's he gonna be once executive privilege expires, without rights for great apes...

Well, he may need a waiver to even make the cut, but still.

Gotta agree, it's a close thing

Date: 2008/06/27 05:40:39, Link
Author: Amadan
Quote (Reciprocating Bill @ June 26 2008,21:34)
When I was a boy, we walked 20 miles to school up hill both ways barefoot in the snow for SEX, DRUGS and ROCK 'N' ROLL. And we LIKED it.

None of this newfangled tardaholism.

In a words: Boarding school

- A tinny cassette recorder cranking out a 3rd generation copy of Zep III (subject to vanishification by priests/rapacious 6th years/invisible felonious phantasms) covered the R 'n Roll bit.

- Someone once sneaked in a doobie but I only heard about it a few weeks later. So much for drugs.

- Sex? Isn't that when they ate ther dunner in Portadown?

I join in this fundie-baiting & tard bashing because it's actually important. (J-Dog, stop giggling)

While we Yurpeans tend to smile indulgently at the US Kultur wars, it's sobering to look at the damage the tards can do when someone lets them drive. A few anti-vaccination flakes in the UK have caused MMR take-up rates to fall to 70% or so, and kids die as a result. Using evilution as a wedge issue is an ideal way to give these morons political clout, and (witness last week's referendum result here) the damage you can cause with fear and ignorance is huge.

Not being a scientist, I leave it to Zachriel, Wes, et al to demolish the substance of what they have to say.

As their greatest threat is posed when they convince otherwise reasonable people to agree with them, I see it as my mission to help people break down in contemptuous snickering whenever they open their mouth.

Also, my charitable instincts are inherited from the good folks who used to pay to be allowed to poke sticks at the inmates of Bedlam.

Date: 2008/06/28 17:05:55, Link
Author: Amadan
Quote (keiths @ June 27 2008,23:00)
 
       
Quote
The project was started by the philosophers Peter Singer and Paola Cavalieri, who argued that the ape is the closest genetic relative to humans – that it displays emotions such as love, fear, anxiety and jealousy – and should be protected by similar laws.

To me the latter seems far more important than genetic similarity.

Is it wrong to treat apes in a way that elicits negative emotions recognisably similar to human ones because "it hurts their feelings" (i.e. for much the same reason that it's wrong to cause them in humans), or simply because the similarity provokes an anthropomorphic response in us humans? Right and wrong (in their moral senses) are not useful measures of apes' behaviour. They apply only to human actions. We condemn the man who beats his dog for a variety of reasons, some rational and some aesthetic, but mainly because cruelty to animals is so easily extended to people as well.
   
Quote
We confer rights on humans who are not moral actors (infants, the severely mentally ill, etc.).  If it's legitimate to grant rights to humans who haven't "earned" them through moral agenthood, why should apes be required to "earn" them this way?

Snip
   
Quote
Amplifying on the point I made above, does that mean that you think that infants should not have rights? They are utterly dependent on third parties to defend their rights, just as apes would be.

There's an important distinction, namely that infants and the incapacitated are recognised as human persons. Rights are sometimes ascribed to non-human persons (e.g. corporations), but I think that's at best a loose use of terminology, and at worst a debasement of the idea of rights. (I'm thinking here specifically of Santa Clara County v. Southern Pacific Railroad) Even in those cases however, the non-human person acts in every way through human agency, and whatever benefit the right confers is ultimately enjoyed by human persons.

It is helpful to think of rights as a type of property. We ascribe those properties to humans mainly (in my opinion) because we would want them for ourselves if or when we find ourselves in similar circumstances. That's why I think there's a category error in talking about rights for animals. Unless Hovind is right about genetic degradation, I'm unlikely to wake up as a gorilla.

Of course, I shouldn't be too rationalistic about it: I'm pretty sure that my dog expects people to treat him well in much the same way that I expect people to treat me well. Those emotions and cognitive faculties evolved for much the same reasons. (Howqever, when I say "Bad Dog!" he just wags the tail a bit faster.)

The REAL question is whether pasta has rights.

Date: 2008/06/28 18:09:28, Link
Author: Amadan
Forget the single malt, I've found the nectar of the gods Designers!

Date: 2008/06/29 04:43:55, Link
Author: Amadan
Quote (keiths @ June 28 2008,18:59)
 Anything formed in the image of His Noodliness the FSM has rights.  Obviously.



Life, Liberty, and the Pursuit of Parmesan

Date: 2008/07/07 12:17:29, Link
Author: Amadan
Densye

 
Quote
What happens then? Well, what happens then is being played out in Canada right now, and all across Europe. All ethical systems come under attack, and degenerate into a swamp of unfocused feelings.


Ummmmm, which Europe would that be, Denyse?
Maybe it’s the Europe being ravaged by the invading Muslim hordes we hear about on UD from time to time? (‘The Crescent v. the Croissant’, one might say...)  Are these osculospumatory fanatics the ones attacking “all ethical systems”? Including their own? Tut tut. But at least once they’ve finished their attacking, we won’t have to worry about those nasty foreign ethical systems and Sharia law etc that you and the other concerned citizens there are so concerned about.

Or maybe it’s the Europe that has so undermined its sense of ethics that it unanimously supports a legal system for trying war criminals? Imagine stooping that low!

Of course, it could be the Europe that so diminished its citizens’ sense of personal responsibility that that reliable indicator of a man’s right to do as he damn well thinks he should, the murder rate, lags shamefully behind that of the Only Remaining Christian Nation?

Actually, it might just be the Europe where the majority of schoolchildren attend church-sponsored or other non-secular schools. After all, you’ve made it very clear what a vicious attack on ethical systems it would be if the US was to do the same.

But, on reflection, I don’t think you mean any of those Europes.

What you really meant was Yurrp , a place inhabited by knock-kneed, lily-livered pinko navel-gazing crypto-fascist commie atheist faggots who are just waiting for Chuck Norris to come over and kick their asses into shape the next time they screw up. You know, the real place, not somewhere that exists in some idiot echo chamber.

For God’s sake woman, sell that brain on EBay: it’s in perfect unused condition. You’ll make a fortune, and be able to retire from ‘writing’.
Pleease. . .

Date: 2008/07/07 14:29:19, Link
Author: Amadan
Quote (tsig @ July 07 2008,14:19)
 Nobody argues with an electrician about power on an outlet.

... except St Krispin of the Extended Digit, patron saint of carbonised life forms.

Date: 2008/07/08 05:35:08, Link
Author: Amadan
***UPDATE***

I now realise that this is the Europe Denyse had in mind.

Quite right, Densye, ethical systems under attack everywhere you go. Deepest, heartfelt and humblest apologies.

Actually, that's an idea: the Knocknagoshel Apology Festival . . .

Date: 2008/07/10 15:15:44, Link
Author: Amadan


Despite the CheesyPoofs, judging Dave's Greatest Hits continued.

Date: 2008/07/13 07:39:04, Link
Author: Amadan
I recall a church painting in somewhere in Portugal that depicted a miracle said to have taken place in the 17th or 18th century.

A woman was somehow obliged to a (quelle surprise!) (or should that be que surpresa?) Jew. To discharge this obligation, she had to bring him a consecrated host. Having received it, she surreptitiously put it in her handkerchief. But as she was leaving the church, blood was seen to be issuing from the handkerchief and the sacrilege was disclosed. History does not relate the consequences, but regular readers will surely be able to fill them in fairly accurately.

All this tells us much more about Portuguese Catholicism than about the truth or otherwise of the reported events.

Having grown up an Irish Catholic in reasonably liberal family, I can understand the outrage devout Catholics feel at what is being portrayed, rightly or wrongly, as an incitement to sacrilege motivated by an atheist's derision. I imagine that all religions venerate their martyrs and make a point of recalling real persecution when it did happen to them, and the Catholic Church has an entire bureaucracy dedicated to it. The two buttons labelled Persecution and Sacrilege are big, RED and very easily pushed. But I thought PZ's comments were pretty infantile. It's not as if someone was trying to make Communion compulsory for biology professors.

That said, portraying this as persecution is going miles over the top. It's also more than slightly ironic hearing the chorus of tut-tutting on UD given that at least half of the goons there would consider Catholics about as Christian as Maoist Scientologists.

Date: 2008/07/13 19:12:58, Link
Author: Amadan
Sunday. The garden breathes well-being, and all is right with the world. Time for a hymn to remind us of the important things.

Date: 2008/07/14 08:15:06, Link
Author: Amadan
Sorry, I just can't stop laughing.

The Walrus among the pigeons?

Date: 2008/07/14 18:04:17, Link
Author: Amadan
Can science be overturned? Interesting Q.

As I understand it, the first thing a scientist has to do before brushing his/her teeth in the morning is to say "I might be wrong".

I am a lawyer qualified to practise in three jurisdictions. As an exercise for the reader, I leave it to you to estimate the arrogance-withdrawal that would provoke in me.

Empirical observation is something we all do reflexively and throughout our lives. But then if you subject the inferences you draw from it to the withering criticism of others who seek the same advantages that you do, even while you are constrained by the need to limit your deductions to those supportable by earlier data and by legitimate mathematics, you come as close as I care to define to "actuality".

"Disproving" science is not a matter of preference, in the sense of asking "Who do you want to tell you what it's all about". It's a question of epistemology: Do you think this statement is objectively verifiable?

If you want to "disprove" science, you also want to shut your eyes and hope the clerk gives you the right change, design your own wing for the plane using Impressionist paintings as your guide, and take up that intriguing offer from Emperor Bokassa's nephew with the locked bank account.

Date: 2008/08/16 07:41:44, Link
Author: Amadan
Around here, baseball caps usually indicate a predeliction for baseball bats, which in these parts tend to be used for percussive wealth distribution and ethnic attitude adjustment. Not to be recommended.

The chocolates sound like a good idea, but you might ask Mrs J. to see how they survive deep-frying in batter.

Date: 2008/08/19 11:07:13, Link
Author: Amadan
From Malta Today
 
Quote
Far from becoming extinct 65 million years ago, the dinosaurs actually co-existed with early humans, and even helped in the construction of the pyramids.
This is the word of Vince Fenech, Evangelist pastor and director of a fully licensed, State-approved Creationist institution which admits children aged between four and 18.
“Of course the ‘dinoceros’ existed (as Fenech pronounces the word). It is mentioned in the Book of Job. They were used to help build the pyramids,” he says, adding that this latter observation is only “his personal belief”, and that it does not form part of the school’s curriculum.


Cue Fred Flintstone driving the the dino-crane...

Date: 2008/08/19 18:38:16, Link
Author: Amadan
I really can't resist giving an Old Joke a reviving spin in the fresh air in its wheelchair...





Thank you for your patience and forbearance.

Date: 2008/08/20 03:04:31, Link
Author: Amadan
Gnash, you beat me to it.

But here it is anyway:

Date: 2008/08/20 08:25:09, Link
Author: Amadan
Well, we started in San Francisco. Covered a lot of ground, including hanging out of cable-cars, cycling across the GG bridge, and touring Alcatraz. No Bigfoot, though I did notice quite a few very fit gentlemen with big moustaches. I took this as a divine signal that we were on the right track.

On to Monterey. There is a kind of paddling-zoo there they call an 'aquarium'. We saw lots of fish, some of which had Big Fins. The trail was getting stronger.

Yosemite and Sequoia National Parks nearly put us off the scent. These fiendishly clever diversions had Bigfoot-style features such as waterfalls (Bigfoot's shower, they would have us believe) and enormous wooden phallic symbols. However, a prominent feature named the Half-Dome is clearly a sarcastic reference to the intellectual capacity of run-of-the-mill Bigfoot hunters, and I deduced that we were being led astray. Damning all park rangers as unbelieving materialists, I left to reconsider our tactics.

This we did in the town of San Luis Obispo.Translated from the original Puerto Rican, that means 'Saint Looey Bishop'. And then it came to me: Of course! The name was a cryptic message, discernible only by Those With Eyes To See™. The real St. Louis is in Missouri, deep in the True Believing Heartland. Bishops are a pagan, idolatrous, Mary-worshipping Catholic abomination. The message was clear: get away from the liberal coast or be damned forever along with the Romanists. Asserting my God-given authority as master of the household, I loaded the bags into the car just before my wife told me to.

We drove to the deeply religious city of Las Vegas. Oh Praise! It was a wonder to see the faithful so selflessly giving of their worldly goods, even without a televangelist to egg them on. I was taken aback to see so many people using playing cards, but then I recalled that they too serve the Lord's purpose. Others made their love-offerings through strange machines with flashing lights and whirling symbols that seemed positively satanic. However, I discovered that the machines were called 'SLOTS', clearly as reference to the Second Law of Thermodynamicus (the famous emperor who banned Evolution). Now as every televangelist knows, material wealth is a sign of divine favour, but in their zeal to demonstrate how hard it is to pass through the eye of a needle, these folks had taken it to extremes. I have never in my life seen sheer corpulence in such an amount or on such a scale. With so many Bag-like Bras, Bulging Bellies and Behemoth Backsides, I knew Bigfoot could not be far away.

The Grand Canyon proved to me that we were on the right path. Only a monstrous creature could have gouged such a cavity in the Earth's surface, even if the ground had been softened by the Flood. I explained this in great detail to others there. Inspired by my message, they suggested that I go to Hell, presumably to continue my research. Not sure how to get there, it occured to me that Hollywood is the source of nearly all the evil in this Christian Nation, so I betook myself to Los Angeles.

It took me three days, scouring the Godless wastes of Los Angeles but, sustained by my faith, I eventually found him.








Keep going!









Bigfoot!







Date: 2008/08/20 14:18:50, Link
Author: Amadan
Are we to infer that they hadn't met before?

Shurely shome mistake....

Date: 2008/08/26 05:54:47, Link
Author: Amadan
Quote
In Australia, the opposition party blames the government for the downturn because they were "talking down the economy"


Proof, of which we can never have too much, that the world is round and that antipodeans are therefore upside-down: here in Ireland, the Government blames the slump on the opposition because they talked the economy down.

And the government is always right, you know. It even says so on their web site.

Date: 2008/08/27 11:01:02, Link
Author: Amadan
What goes around comes around. It'll be interesting to see who starts shouting the loudest about this in the ID camp.

Date: 2008/09/01 06:16:25, Link
Author: Amadan
It seems to me that there's a bit of over-hyping going on here. What it seems to boil down to is that Palin avoids offending The Core in her statements on education and would probably go along with Teaching the Controversy™ more out of sympathy than conviction. She said "I believe we were created" or words to that effect. Big deal. So do all the theistic evos.

Is she a dominionist trojan horse? The evidence (?) is that her pastor is a bit of a nut-job who associates with the osculospumatory fringe.

Rev. Wright, anyone?

Date: 2008/09/06 11:54:57, Link
Author: Amadan
This seems like the right place to ask this question.

I'm trying to find a suitable moniker for the Republicans' Happy Couple. The need for this struck me as I was looking at PTET's excellent, sneering coverage of it all.

"Captain Geritol and Polar Barbie"?
"ditto and Igloo Barbie"?
"Fossil Man and Gospel Mama"?
"President POW and The Moose-Meat MILF"?

Your thoughts (FTK, it's in the dictionary)  and suggestions, please.

Date: 2008/09/07 12:47:32, Link
Author: Amadan
Quote
Fatalistic cynicism and secession of our responsibility to participate knowledgeably in both the educational system and the electoral system is what brought this country to its knees.


Here in smugly superior Yurrp, we like to sneer at the Murkin system of popularity polls, but I sometimes wonder how things would work out for us if we had to organise continental-scale elections for a position that carried real power. It sure wouldn't be pretty.

It's worth remembering that the US system was designed so as to have the president elected by the Great and Good of the various states. The noisesome mob were to have their say in the bear-pit of the House of Reps, not in the olympian halls of the Senate, and certainly not in the matter of the President's election. To the minds of your revered founders, that gave sufficient balance between the popular and the propertied. Rational debate was, in their minds, assured among an elite whose position was not dependent on the popular will.

The emergence of coast-to-coast television companies as the main media of political persuasion has, unsurprisingly, reduced most political debate on TV to the lowest common denominator. Given the diversity of regions and interests, how could it be otherwise?

So to my mind, you have a system designed for a set of circumstances that haven't existed since the introduction of the steam train and the popular press. The American cult of ancestor worship ( "our Founding Fathers"! C'mon, get a grip, they weren't superhuman) makes it heretical to even suggest changing the rules. The need for intravenous television makes every elected official a whore for the purposes of fundraising.

The current incarnation of teh Intertoobs demands a bit more interaction than the almost perfectly passive consumption of TV. It will be interesting to see if the Net takes over from TV as the main medium of mass communication. If it does, and it continues to demand something more than drooling on a couch for your nightly news, you could see a revival of popular participation in political debate.

I wouldn't bet on it, but then I'm a sneering Yurrpean cynic.

Date: 2008/09/07 14:13:41, Link
Author: Amadan
What the Hell is going through your head, Erasmus? Criticising a system = hating freedom? That's on a par with the sort of comments we got from Fox at the time of the UN Security Council debates on the Iraq resolutions.

My point, which you clearly missed, is that the US constitution is the product of 18th century men who had assumptions and objectives that reflected their times and backgrounds. Did you think I agreed with their view that a propertied elite should have a permanent advantage in political life? Perhaps I should avoid complimacated litturary stuff like irony.

If you take the view that voting just encourages the bastards, you are stuck with the problem of how you are going to assure yourself the freedom that you clearly value. Opting out is fine until you run up against the system. When that happens - say, if a cop doesn't like the colour of your skin or the town council votes to remove the Koran from the library - what are you going to do?

Perhaps your point is that there is nothing that you can do, and that the system will inevitably crush individual freedom. Personally, I don't take that view. If the system of government itself is a subject of debate and potential change, the individual has a far stronger chance of fighting back.

In the USA, that doesn't seem to be an option. The 1789 constitutional framework is sacrosanct and its drafters are presented as uniquely endowed with wisdom and foresight. Bollocks. Contributing to this problem is the biased, homogenised and sound-bite level of most political discourse on US national TV networks.

Of course, you can assert and protect your freedom in the USA, but you could do it a heck of a lot more effectively if you redesigned your constitution.

Does that make it clearer?

Date: 2008/09/07 17:51:48, Link
Author: Amadan
Quote (midwifetoad @ Sep. 07 2008,14:35)

And my country, warts and all, does not publicly humiliate Germans and Italians by noting, as a matter of law, that their condoms are, for some unspecified reason, undersized.

Hmm. Perhaps they export the undersized ones to the UK for a reason.

</800-year grudge>

Date: 2008/09/07 17:53:09, Link
Author: Amadan
Quote (Arden Chatfield @ Sep. 07 2008,14:43)
Quote (Amadan @ Sep. 07 2008,12:13)
What the Hell is going through your head, Erasmus? Criticising a system = hating freedom? That's on a par with the sort of comments we got from Fox at the time of the UN Security Council debates on the Iraq resolutions.

I *think* he was being facetious with that one line.

Oops.

Scorn withdrorn.

Date: 2008/09/07 18:52:42, Link
Author: Amadan
Quote (carlsonjok @ Sep. 07 2008,14:57)
That the Founders crafted such a constitution, under assault from the git-go (and very nearly stillborn) by the demagogues of the day speaks to it's unique nature.


Being unique doesn't make it perfect. Is it uniquely effective in the way it protects, say, the rights it proclaims? I'd say that it has, by and large, done a decent job, especially in establishing the power of judicial review. The USA and the the world are all the better for it. But consider also how Shrub has arrogated the right to ignore laws he doesn't like. (That such a power-grab is probably unconstitutional is not the point: the point is that he can get away with it because Realpolitik prevents anyone doing anything about it) Could he do that if the rights of the Commander-in-Chief were expressly limited in time or scope? Room for improvement there, I'd say.

   
Quote
As an American, I see plenty of problems in execution of our political system, but that is not due to any defect I see in it's particular construction.


If the system permits that type of execution, you have to ask if its construction is still appropriate. It's undeniable that it was designed (where have I seen that phrase before?) for social and technological conditions very different from today's. Perhaps Americans consider the abuses and corruption within it an acceptable cost of the freedom the system permits. Or perhaps they reason that the problems can be fixed without change to the constitution. But if I was an American, I'd take quite a bit of convincing.

   
Quote
The beauty of the Constitution is it's narrow focus to the construction, and limitations, of government, coupled with it's relative permanence. It isn't intended to specify the detailed nature of political life, but rather provide a framework within which to operate.

So, I see no need to redesign The Constitution, only to ensure it's faithful execution (which has been all to poor of late).


I agree, constitutions shouldn't be tinkered with on a whim. My point however is that many Americans seem to subscribe to the notion of American Exceptionalism, that their Constitution is the definitive and unimpeachable wellspring of democracy. But remember that Eisenhower's first draft of his farewell speech referred to the concentration of power in "a military-industrial-congressional complex". Allegedly for fear of instigating a political crisis, he removed the reference to Congress, and toned down his remarks to the 'potential' for such a concentration, not to its actuality. But that it exists is a fact.That it does so within your constitutional system suggests that the ability to concentrate that much power in that way is a defect in the system that those who drafted the constitution did not and could not have forseen. But any political commentator, let alone politician, who dared to say so would at best be written off as a flake, or be denounced for treason for daring to suggest that the Founding Fathers (Forgive me, I have to laugh whenever I see that term) might have got even part of it wrong.

Date: 2008/09/08 03:55:16, Link
Author: Amadan
Quote
...you seem to the think that abuses and corruption are particularly egregious in the American system.


I don't say that the USA is rotten to the core. I'm referring to the multiplier effect you identify. Otherwise legitimate aspects of government like lobbying and fund-raising are, to use a nice phrase from the old Catechism, Occasions of Sin. The potential risk of (and rewards from, bless them!) their abuse increase (disproportionately, it seems to me) as accountability diminishes and power increases. And that is where I see a problem in the US system. Your Federal govt has accumulated quite astonishing powers at the expense of states that are allegedly sovereign. I understand and sympathise with many of the historical reasons for that, but it sure ain't what anyone was thinking of in 1789.

What would your constitution look like if those august gentlemen had been asked to draft it on the assumptions that
  • secession should be impossible
  • corporations should have the economic and political power that they currently have
  • the Federal military establishment should be funded to the extent it is, (regardless of their distaste for standing armies)
  • universal suffrage and corporate-controlled TV should be allowed


I'd hazard a guess that you would see much more power reserved to the states and more stringent control of Federal offices. That, or they'd send some nice flowers to London and ask if they could give it one more try. No more jokes about your mother's weight. Honest.

I've banged on about this too long, so I'll shut up soon. It's just that, as one of your fond relatives abroad, I find it disconcerting that the de facto emperor of the world should be selected by means of a process that looks like the bastard love-child of a beauty pageant and an arm-wrestling tournament.

Date: 2008/09/10 05:38:04, Link
Author: Amadan
Quote (jeffox @ Sep. 10 2008,00:54)
Voting isn't so bad.  I've come to the realization that, as a borderline anarchist, my other option is to vote with my 20 gauge.  Since I also recognize Machaevalianism (sp.) for what it is, I'll stick to voting the normal way, for now.  :)

I hope that doesn't boggle too many people's minds.

I AM tougher than I look, really.  ;)

This puts me in mind of the sainted Dorothy Parker's views on deep questions like this:

Razors pain you, rivers are damp,
Acids stain you, drugs cause cramp,
Guns aren't lawful*, nooses give,
Gas smells awful, you might as well live.




* except in Alaska, where they seem to be obligatory

Date: 2008/09/10 09:18:14, Link
Author: Amadan
But nothing will change until people arrive at politicians' doors singing

You can get anything you want
At Alice's Restaurant



(just wait until the song comes around again and we can all join in)











(Here it comes . . . )

Date: 2008/09/11 04:07:00, Link
Author: Amadan
The Discovery Institute today unveiled a multi-million dollar PR apparatus known as the Logicless Harangue Collider (LHC). The LHC is described as “an infinite echo-chamber” in which super-dense articles are debated in a circular manner until being smashed together. Leading scientists, ranging from undistinguished statistical theologians to refrigerator maintenance engineers, will study the ejecta to confirm some of their most fundamental preconceptions.

One of the most highly anticipated results of the LHC is the so-called ‘Hick’s Bozon’. The project’s project’s leader leader, Dr Dr W. A. Dembski, explained: “The Hick’s Bozon is a particle of no scientific weight, I mean, mass. However, it does exhibit a very high quantity of what we call spin. It’s name is a tribute to the Southern Baptist Convention, which has been praying for it as a sciencey sounding thingie they can use to dazzle the red-state rubes. I should add that as I have predicted it theoretically, this experiment is a superfluous detail which is rather pathetic.” Asked whether the LHC will help confirm his Big Bank Theory, Dr Dr Dembski was non-committal. But he gave a sly wink.

There has been some public concern as to whether the LHC could generate a black hole of inanity such that all intelligence could be sucked out of the Earth. In response, the LHC’s engineering janitor Mr Dave Tard, was reassuring. Speaking through a loudspeaker in the ceiling, he confirmed that intelligence was “very very unlikely” to be attracted to anything generated by the LHC. “That would require a critical mass, and anyone critical is by definition out of here”. He later qualified his statement, adding “homo -ds”.

The LHC’s publicity spokes-entity is Densye O’Bleary. He, she, or it is the author of several leading academic and popular colouring books on scientific-sounding stuff. Asked to explain the technical working of the LHC, O’Bleary responded “Buy my book. They all say the same thing, so buy any of them. Or all of them. Please.”

During calibration, the LHC will initially run at a lower level of operation. It is expected the Vice-President-to-be Palin will have an important role in government oversight of the project, so increasing acceleration is expected in the period leading up to November, generating a froth of fundamentalist articles. These are expected to be published in peer-reviewed journals, or at least, to be published in journals and reviewed by people who pee.




Edit: Thought of a better last line





Date: 2008/09/12 09:24:36, Link
Author: Amadan
Andrew Sibley gets excited by Michael Reiss's suggestion that the best way to stimulate mental growth among those with sh*t for brains is to fertilise it with manure. The only surprise there is that they linked to the the bleeding-heart Guardian as well as the ideologically-correct Torygraph.

Jerry protesteth:
           
Quote
Now I understand how creationism could be set aside as an alternative explanation of life but Intelligent Design is completely in sync with the development of life over 4.5 billion years and the origin of new species at various times during that period and much of it due to natural processes. Creationism is not.

That ripping sound is the seams in the Big Tent.
           
Quote
If you are a believer in front loading then the intelligent input may have been only once.

(That certainly explains the intellectual vigour of the ID movement, Jerry.)

To summarise:
  • Creationism is out because it ignores natural processes
  • ID is OK because it just loves natural processes, except for a teeny-weeny little poof at the beginning
  • That the aforementioned poof is not the subject of the kind of science them folks in white coats use to look at, ummm, natural processes, is irrelevant

   
Quote
None of this has anything to do with a belief of when God may have infused a soul in his image into man.
But Jerry, didn't you know that Denyse has blazed the scientific trail into that question? Pretty soon now she'll be publishing MRI pictures of our body thetans!

Date: 2008/09/12 11:02:43, Link
Author: Amadan
Omigod, that was my Gross Post!!!!



Do I get a Doctorate from Patriot University? Or lunch in the cafeteria?

Date: 2008/09/14 11:33:27, Link
Author: Amadan
Quote (Louis @ Sep. 13 2008,07:54)
       
Quote (Lou FCD @ Sep. 13 2008,12:56)
         
Quote (Amadan @ Sep. 11 2008,05:07)
The Discovery Institute today unveiled a multi-million dollar PR apparatus known as the Logicless Harangue Collider (LHC).

[snip]


Belated, but done.

We all understand you are busy, so no criticism is implied or intended, but I think Amadan gets a whole extra hour of POTWhood for this oversight.

;-)

Louis


Amadán staggers buck naked into corridor and falls back against door, slamming it shut. Exhausted, he slides to the floor revealing a plaque on the door reading POTW. A smear of what appears to be baby oil and peanut butter traces the arc of his collapse. Behind the door can be heard the muffled giggling of what sounds like a troupe of highly pneumatic cheerleaders* calling him back.

Through waves of exquisite exhaustion, and despite his face being fixed in a grin that death itself could not hope to erase, he mutters, barely audibly, "Thanks for the extra hour, lads".



* You have to listen verrrry carefully for details like this.

Date: 2008/09/23 04:14:21, Link
Author: Amadan
Eek! It's getting closer!

Last night on Questions and Answers (an Irish TV talkshow where politicians and the Great&Good dodge audience questions) someone pointed out that Iris Robinson is Sarah Palin without the curly tail glasses.


Better just give up and go home, people. The barbarians are at the gate.

Date: 2008/09/23 08:40:56, Link
Author: Amadan
These types are not likely to be tempted by The Devil's Buttermilk™.

But if they were, we've found just the thing.

Date: 2008/09/23 14:06:06, Link
Author: Amadan
Quote (Arden Chatfield @ Sep. 23 2008,09:32)
 
Quote (George @ Aug. 10 2008,07:14)
Though DUP backbenchers and ministers' wives are making all sorts of silly calls for teaching creationism and other reactionary rubbish, I seriously doubt that this will filter up to government, even DUP cabinet, policy.  Not being hopefully naive here.  I think the top DUP politicians are hard-headed enough to think of the money.  If the establishment gives real support to creationism, that will be a clear signal to biotech and similar companies to invest south of the border (where there are already plenty of financial goodies waiting for them).

Also, the time NI politicians spend spouting creationist rubbish is time they aren't spending spouting political sectarian rubbish, which is far more dangerous.  Creationism is a symptom of political normalisation in the north, and therefore to be almost welcomed, ironically.

I assume it's only the Protestant politicians in NI who are advocating this?

Yes. Specifically, those in the DUP and miscellaneous Silly Parties in its orbit. I'd like to think that the more rational line adopted by Sinn Féin, the SDLP and [most of] the Ulster Unionists (Peter? any views?) is a credit to their seriousness etc etc. But these are, after all, politicians. The DUP has the biblical literratlisis litrerla the Bible is all true vote sewn up. If there were votes in it for any of the others they'd support teaching cannibalism too.

Date: 2008/09/24 19:16:33, Link
Author: Amadan
Whatever you do, Arden, make sure you don't bring crunchy peanut butter.

I couldn't walk for days.

Date: 2008/09/26 08:29:03, Link
Author: Amadan
Once again, the MSM twists things to distort their meaning.

Date: 2008/10/01 11:01:11, Link
Author: Amadan
Actually, I doubt that she's YEC, and there really isn't too much evidence to suggest that she is. Whatever about the word-salad (and boy, can she ever toss 'em! Croutons, even), she isn't downright dumb.

What I do suspect is that she knows perfectly well what The Base wants to hear and is happy to say it. Like DocDoc* Billy, she knows it's all garbage, but hey, if you wanna hunt, ya gotta go where the ducks moose are.


*Who's there?

Date: 2008/10/06 09:23:13, Link
Author: Amadan
Some person, obviously a hard-core Darwinian agitator, lets go a great big wad of concern trollery at the IDiots:

 
Quote
If Darwin and the Darwinian crew had never gone the way of molecule to man (common descent vs. common design), would science be where it is today. Is the concept of common descent vital to scientific advancement? If anyone has run across any relevant articles contemplating this scenario, please reference them.


Linkibus vulgaris

Date: 2008/10/07 03:05:08, Link
Author: Amadan
It really doesn't matter any more: Human evolution is over.

Shame really. I was really keen on the grand-kids getting invisible wings.

Date: 2008/10/17 09:29:29, Link
Author: Amadan
Ah George, you only identified the runner-up:




Sleveen, gobshite,veterinary-strength eegit, and the embodiment of what made this country the great success it is today.

But the question that's most on my mind is what [Irish] political parties Obama, McCain, Bible Spice and that guy who has a B in his name belong to?

Date: 2008/10/26 04:57:47, Link
Author: Amadan
Given the fault-lines now widening between the factions of the GOP, it seems appropriate to bestow a few names.

In honour of Ray Comfort's worthless invaluable research into botanical origins, I propose that the Palin faction henceforth be called the Banana Republicans.

Date: 2008/10/26 14:18:55, Link
Author: Amadan
Nothing could sum up the intellectual rigour and high-toned rhetoric of the presidential contest better than this.

Alas, not my own work, but you may all pretend that it is.

Date: 2008/10/29 09:28:16, Link
Author: Amadan
Quote (Arden Chatfield @ Oct. 28 2008,16:18)
Sometime soon we're going to need to resurrect Dave's bon mot about how Sarah Palin is on the verge of becoming America's Margaret Thatcher, since she's going to be in the White house til 2024.  "We own that now, too."


I have been hoarding that one one jealously until Tuesday, but you can find it here. Poor old Dave might be a bit down just now, so let's remind him of the happy happy days of the Convention.

 
Quote
Posted by: DaveScot | September 4, 2008 5:49 PM

You finally got one right, PZ. This IS how you will lose.

Even totally united behind Gore in 2000 and Kerry in 2004 you couldn't beat a dumbass draft dodging reborn alcoholic George "Shrub" Bush and his snake-oil sidekick Dick Cheney of all people. That's pretty pathetic. This round you've got an even worse candidate that half of your own party thinks stole the nomination by cheating and dirty politics. Your party is shattered up the middle and you have the worst candidate in all the decades I've been paying attention. I knew Jack Kennedy and your nominee, PZ, is no Jack Kennedy.

Now the culture war is still on, the players are all the same on both sides, except this time we have an honest-to-God centrist war hero, even if he is an elitist beltway insider, and a little unheard of cutie, obviously a political savant, who in 30 minutes won the hearts and minds of every heretofore apathetic God fearing blue collar flyover family all across the nation and made them start caring about who wins this election not to mention is stealing a lot of the Hillary voters who wanted nothing more than a woman in the Whitehouse. If McCain wins then Palin, sooner or later, is going to become the first woman president of the United States as by the time she's up for election to the top spot there won't be any question of lack of experience. You are basically looking at teh American Margaret Thatcher. Get used to her. She's going to be in your face for the next 16 years. It's all over except for the tears and anger from your side that you were fucked yet again. Write that down.


I'm sure he's right. He is about so many other things.

Date: 2008/11/02 18:18:50, Link
Author: Amadan
Meanwhile, the George W. Bush Presidential Library nears completion . . .

Date: 2008/11/03 07:57:02, Link
Author: Amadan
Peter, not quite on topic, but wotthehell.

Seems dear Mervyn is exercising his formidable intellect again, and on an all-island basis, no less!

Just the usual chip-shop brawl, no new nuggets of knuckleheadedness.

Date: 2008/11/04 14:42:35, Link
Author: Amadan
**Prediction**

Faux Noose will have a live report from Ramallah, Gaza, Tehran, or some such place to show the muslamian trrrists celebrating their guy's victory, preferably by firing AK47s into the air.

Fair and Balanced

Date: 2008/11/05 05:01:45, Link
Author: Amadan
An Irish Times journalist tells a story in his memoirs about about an editorial conference the day after a general election. The paper had opposed the previous government for years and the voters had finally thrown them out. Cheers all round.

Douglas Gageby, the editor, asked the neophyte journalist what they should say about the new coalition as it took power.

"How about 'It is long past time that this incompetent and corrupt administration was ejected from office'"?

"You'll go far in this business, m'boy"

Date: 2008/11/06 03:13:20, Link
Author: Amadan
Actually, I understand that Gov. Palin is going to take off the next six months or so to finish her book.



It's called The Bridesmaid's Best Man, by Barbara Hannay.




This comment was sponsored by Acme Joke Recycling Inc. No beauty pageant contestants were harmed in the making of this comment

Date: 2008/11/06 11:28:24, Link
Author: Amadan
In the immortal words of our former Taoiseach* Albert Reynolds:

 
Quote
Never pack a gobshite in your bag, because, wherever you go, they'll have one there for you.


* Look it up

Date: 2008/11/06 13:22:38, Link
Author: Amadan
Golly! An opening for another old joke!

Dubya is being briefed on the day's security issues. Towards the end, Condi Rice says "And I'm sorry to report that twelve Brazilian soldiers were killed in a joint training accident yesterday."

The Prezdint is appalled.

"My God Condi, how are we ever going to deal with this? Those poor men! Their families! This is beyond awful, I . . . I can't find words to . . ."

After a brief pause, he asks

"Condi, just how big a number is a brazillion?"

Date: 2008/11/07 05:35:08, Link
Author: Amadan
The fine-tuning argument is hardly that cutting-edge.

Voltaire, in Candide (1759 or so):

 
Quote
"It is demonstrable," said he, "that things cannot be otherwise than as they are; for all being created for an end, all is necessarily for the best end. Observe, that the nose has been formed to bear spectacles--thus we have spectacles.


And, more relevantly for DaveTard, we have screen doors to be wary of as we exit.

Date: 2008/11/07 10:43:36, Link
Author: Amadan
Quote (stevestory @ Nov. 07 2008,09:54)
Davetard is back.

Damn. After all the effort I put into trying to find him:

Date: 2008/11/07 13:24:59, Link
Author: Amadan
Quote (Jkrebs @ Nov. 07 2008,06:49)
Denyse writes,

   
Quote
Changes at Uncommon Descent
O'Leary

Some kind readers may have noticed that we have been changing things around a bit here at Uncommon Descent.

We are retooling the blog to serve you, our community, better, and will let you know of key developments as they come on stream.



Actually, the image that occured to me was this:



Sewage, but with God-rays in the background.

Date: 2008/11/07 16:44:26, Link
Author: Amadan
(Disputed)

Date: 2008/11/07 20:04:35, Link
Author: Amadan
Quote (Wesley R. Elsberry @ Nov. 07 2008,19:45)
 
Quote

One thing: what does it say on the side, there, under IQ?


I think I've got all but the height value...

   
Quote

Have you
seen
Dave?

Height - ???
Weight - Yes
IQ - 150+
(Disputed)

His friends
miss him
very, very
much and
are sorry
if they
hurt his
feelings.

"Height - 6ft"

I couldn't think of anything amusing to say about height, particularly as the source pic was only 316x416.

And the 'Not suitable for children' bit wouldn't align straight for me. Gnash, gnash.

Thanks to all for compliments, I really didn't think it was that good. (And anyone who agrees with me on that is a bastard)

Date: 2008/11/07 20:05:56, Link
Author: Amadan
Quote (CeilingCat @ Nov. 07 2008,19:33)
What kind of UDairies Tard is that?

2 percent or Homo?

Damn you, Kat, I should have thought of putting in something like that.

Date: 2008/11/12 07:42:01, Link
Author: Amadan
Things have been a bit quiet over at the Tardmines recently. No doubt this is due to the disincentivising effect of the new socialist administration.

To introduce a healthy capitalist spur to productivity, I propose that, in parallel with our own coveted POTW award, we recognise each week's most profound manifestation of true pigheaded ignorance with the Presidential Science Medal:



Admins wishing to avail of this can find it at

http://lh5.ggpht.com/_8An3n3....dal.jpg

or

http://lh5.ggpht.com/_8An3n3....dal.jpg

for a smaller version.

Date: 2008/11/12 08:26:52, Link
Author: Amadan
Quote (Erasmus @ FCD,Nov. 12 2008,08:03)
amadan i admired your work regarding Christian Domestic Discipline over at the other mines.  very good.

Found it while Googling for Christian Romance novels, for a recent post about Palin on the Politics thread.

Those of you wondering what the heck we're gabbling about, I posted this on FSTDT (warning, not for the squeamish).

The fact that it comes up on a search for those terms says  . . . well  . . . something.

Date: 2008/11/12 08:35:41, Link
Author: Amadan
Tee hee

Date: 2008/11/12 16:16:01, Link
Author: Amadan
Happy Birthday, Louis.

Date: 2008/11/15 21:06:56, Link
Author: Amadan
Quote


...Hey, if you like bananas, that’s fine, but you are still far more closely related to Ronald Reagan than to Bonzo (whatever you may think about that).


Bed-time for ID?

Date: 2008/11/17 04:24:55, Link
Author: Amadan
Quote
Kairosfocus:I will break my silence (I have no other means of effective contact) to wish you well . . .


The insight! The elegance of language! The intellectual savoir faire!

Date: 2008/11/17 09:01:50, Link
Author: Amadan
Quote (deadman_932 @ Nov. 16 2008,23:56)
     
Quote
17 November 2008
DaveScot is No Longer With Us
Barry Arrington
DaveScot has resigned his position as UD’s primary moderator. We wish him well in his endeavors.

With apologies to W.H. Auden:

Stop all the blogs, cut off the ID drone,
Prevent the YECs from waving the crocoduck’s shin bone,
Silence the echo chamber and with comments dumb
Bring out DaveTard’s coffin, let the moaners come.

Let administrators circle as the commenters discuss,
Scribbling on their posts that He No Longer Is With Us.
Put crap prose in the mouths of dolts he loves,
Let blog-czars moderate with clumsy leaden gloves.

He was my t-shirt, my scruffy beard, my lard,
My reckless wrecking ball and my daily tard,
My loon, my maroon, my dork, my King Kong;
I thought that dumb would last for ever: I was wrong right.

ID is not wanted now:  but still the tards come;
Roll out the SLoT, don’t mention the Sun;
Pour on the denial and arguments forlorn,
For UD is no longer worthy of scorn.

Date: 2008/11/22 04:53:52, Link
Author: Amadan
Quote (Skullboy @ Nov. 21 2008,18:11)
   
Quote (JLT @ Nov. 21 2008,17:44)
 
StephenB = pure TARD.



That whole thread is extremely dangerous to TARD addicts. That TARD is so pure that the same dosage you've been mainlining daily for weeks could kill you if it comes from that thread.

StephenB truly deserves this week's medal.
It even uses Maya's new word!

Date: 2008/11/24 09:45:59, Link
Author: Amadan
Dear God Designer, the parody writes itself...

Date: 2008/11/25 01:46:25, Link
Author: Amadan
Dunno about youse lot, but I always find that Kliban has an uncanny way of finding le mot juste about the ID crowd. Denyse in particular . . .

Date: 2008/11/25 05:57:43, Link
Author: Amadan
Baylor Bear quotes Dr Charles Garner:

 
Quote
To be prepared for science in the 21st century, students must understand why some scientists accept, and others doubt, particular theories based on the nature of the evidence and the magnitude of the phenomena being explained.

Quite right. This controversy is causing an absolute frenzy of publication in the scientific press. These startlingly original objections to conventional science have not been refuted for at least 30 years.

 
Quote
The ideas embedded in evolutionary theory are too important to treat superficially. Let’s teach more about evolution, not less, and give the students of Texas enough scientific evidence to decide for themselves.

¿Así que les permetimos elegir el idioma de instrucción en su escuela, no?

While we're at it, why don't we let the kids decide for themselves on the evidence for and against abstinence-only sex-ed? Having explored all the options and (under suitable pedagogical guidance, of course) carried out some simple experiments, I have no doubt they'll come arrive at a mature and well-informed decision.

Date: 2008/11/25 18:35:39, Link
Author: Amadan
This isn't about UD, at least not directly, but comments are disabled on the PT post about it.

LGF reports an essay competition being run by Yahoo O'Hara (or his Turkish cousin, I can't remember . . .). They're looking for  
Quote
comprehensive and convincing information on the subject of all the Darwinist dilemmas that prove the invalidity of evolution


Lots and lots of lire for the winners.

Folks, it's Sokal Time! I would dearly love to submit an entry just to see how it does.

Anyone - especially sciencey types - wishing to contribute is invited, nay, implored to do so on this thread on my blog.

Date: 2008/11/30 09:48:33, Link
Author: Amadan
Quote (JLT @ Nov. 29 2008,15:55)
For an IDist it's enough to skim through SciAm or watch a documentary every now and then to know exactly what's going on "in science" in general. Even better, without having any background  they're able to separate the wheat from the chaff and to tell the scientist where they're wrong or what they'll never find out.

And they probably don't have the slightest clue how unbelievably, mind-stunningly arrogant and offending that is.

This is rank hypocrisy!

What gives you the right to even comment on ID as if you understood it? Your oh-so-clever PhD in Dubious Things You Can Do With a Test Tube? Your White Coat of Unimpeachable Authority?

If, and only if, you can show an advanced degree in Southern Baptist Theology, or at least sincere testimony of an uniformed credulousness, then you might be eligible to advance an opinion worthy of inclusion on UD.

Date: 2008/12/01 04:47:51, Link
Author: Amadan
Quote (JLT @ Nov. 30 2008,12:42)
I walk past a catholic cathedral twice a day. According to their standards I'm perfectly qualified to comment on ID.

But I'd stop commenting on ID if they stopped commenting on biology...

Nope.

Sorry.

Doesn't count.

You aren't an expert unless you can see it from your house.

Date: 2008/12/01 07:49:33, Link
Author: Amadan
Quote (JLT @ Dec. 01 2008,05:37)
@ Amadan:

Actually, I can see a church (well, its tower) from my home, although not the cathedral (I'm living in Ireland; probably everyone here can see a church from his home... ;)

Oh God. Now we'll have to play that awful Two* Degrees of Separation thing that everyone in Ireland has to do.

D'ya know me cousin Ultan McClafferty in Termonfeckin?


*As opposed to six: It's a bloody small country.

Date: 2008/12/02 06:14:00, Link
Author: Amadan
Densye
Quote
Darwinian evolution would likely only work well in a living system or ecology if it is governed by an underlying mechanism that determines the desired end state (or, possibly, an acceptable range of end states).


Like, just hypothetically, a life-support system coupled with a reproductive system where the desired end-state is survival until successful reproduction?

Darn it Denyse! Where on Earth am I going to find that?

'Fraid I won't be able to consider this properly until after I've picked up the kids and cooked their lunch.

Date: 2008/12/04 14:44:47, Link
Author: Amadan


Say it’s not true! The Filter Explanat’ry
No longer will feature in Dembski’s inanity.
Exquisitely tuned to rule out coarse reality
Its meaningless jargon bejewelled his banality.
DaveTard who once proudly the filter did bruit
Now firmly maintains that he always saw through it.
Denyse never managed to work out the numbers
But she knew it was right, and so onward she lumbers.
And the rest of the sheep meekly follow their lead,
And patiently wait for the Doctor’s next screed –
A Bayesian search for Noah’s lost Ark,
Which it finds in the Baylor Cafeteria Car Park.





Date: 2008/12/04 15:24:34, Link
Author: Amadan
Quote (Wesley R. Elsberry @ Dec. 04 2008,15:14)
The tombstone should be 1996-2008, though.

Voilá!



With glorious labours of shock-artists from Bakh-Byondov Air-Brush and Turnip-Canning Kollektiv, History is always ideologically korrect!

Date: 2008/12/06 02:55:42, Link
Author: Amadan
Quote (oldmanintheskydidntdoit @ Dec. 05 2008,18:28)
Patrick finally says something of substance
       
Quote
Now as I’ve pointed out before the major issue is that natural selection is essentially a funnel, and it must be balanced in order to produce results. For an example, a while back I had an experiment with a GA that performed word searches. Going from memory here, so short version is that there were multiple versions of the fitness function: a) pseudo-random search b) a function that attempted to emulate Darwinism c) a function that incorporated some active information about the target d) explicit directed front-loading. The target was less than 200 informational bits but only C and D were capable of finding it. The most difficult target at 360 informational bits required D.

eh? How's that then? How did Patrick "emulate Darwinism"? I want details of this attempt Patrick!
He continues
       
Quote
The problem with the finch example is that once the environment changes back to normal the finch population also reverts back to being a mixed population based upon continuous variation.

He rebuts the obvious objection
       
Quote
Some Darwinists like to say that in order for such changes to fixate that the environment must be permanently altered as well.

And as we know, the entire worldwide environment is fixed.
       
Quote
Having said all that, in general I don’t see an issue with unguided Darwinian mechanisms being capable of making these particular changes considering their “relative” simplicity and apparent modularity (then again, it may be front-loading) which “I” think “might” allow for a stepwise pathway.

Yeah, the thing is if you can't tell the difference between "Darwinian mechanisms" and "front loading" that really makes front loading irrelevant.
And who said IDists never give details of what ID predicts? Stand up!
       
Quote
Now Darwinists always start with the assumption of simplicity giving rise to higher complexity. Some ID proponents present this alternate scenario: What if ALL of the original squirrels could glide? After all, it’s far easier to suffer a deleterious mutation, and the survival benefit from this particular feature is negligible in most circumstances.

I suspect Patrick is sitting in a cardboard pyramid smoking a big reefer.
He does give some ground
       
Quote
So it’s possible that Darwinism may “work” in the mathematical models but the models do not match reality. Models depend on empirical data and definitions. GIGO: Garbage In Garbage Out.

Yeah, might want to mention that to Dr Dr Dembski there.
Finally, some sense
       
Quote
Needless to say, I’m not sure if all this makes the issue ever more confusing.

Go read the whole awfulness of the original comment if you are lacking a tard infusion. It's epic. And Patrick, you are a very very confused IDiot.

OMG

Date: 2008/12/11 04:21:20, Link
Author: Amadan
We have always been at war with Eastasia rationality.

Date: 2008/12/11 07:02:46, Link
Author: Amadan
The Great Mathematician Nods With Favour on His Acolyte
 
Quote
P.S. Congrats to Denyse O’Leary, whose Post-Darwinist blog tied for third in the science and technology category from the Canadian Blog Awards.


As a mathematical illiterate, I endured a moment of doubt when I saw that The Canadian Nunja had come 4th (with a crushing total of 31 votes, no less!), not 3rd.

But recall that the Great One is a mathematician:

Code Sample
3/3 = 1
4/4 = 1
Therefore 4=3.



And talk about a ringing endorsement from the organisers!

Date: 2008/12/11 08:49:06, Link
Author: Amadan
And on the Third Day . . .

Date: 2008/12/12 01:52:05, Link
Author: Amadan
Quote (CeilingCat @ Dec. 12 2008,00:37)
According to Nature, a subscription to Chaos, Solitons and Fractals costs a stunning US $4,520 a year!

I'm looking forward to retirement in a couple of years and I was thinking of supplementing my meager retirement income by selling photoshopped nudie pictures of Sarah Palin to unsuspecting Rethuglicans.  

But now, I'm wondering if setting up a mildly weird scientific journal might not pay much better.

Count me in! In fact, most of the usual suspects here would be useful to have on board.

Lemmesee . . . a title: How about Teleological Archive of Rejected Digests? That would attract all those ID papers that were so unfairly suppressed by the mainstream science media.

It will be essential to have a raging controversy on the Letters page which will hopefully run and run, provoking bitterness, partisan sniping, and ruined careers. Perhaps Arden (or his mother) would like to serve as the focus of this?

Scientific standards are, of course, central to the reputation and integrity of any journal, so we must fake them convincingly. The easiest way to demonstrate that we don't accept any old rubbish is to publish rejection letters in the body of the magazine, thereby (a) reducing the number of crap articles we have to solicit for publication and (b) saving the price of a stamp on PFO letters.

Further suggestions, anyone?

Date: 2008/12/12 04:20:01, Link
Author: Amadan
JLT: cool avatar.

Randomly assembled from unsorted spare pixels, I presume?

Date: 2008/12/12 04:33:57, Link
Author: Amadan
Quote (stevestory @ Dec. 11 2008,22:05)
2 Can someone tell me what the Duncan thing is about? I have tech problems with npr's site and can't listen to the audio.

The interview was about change in the GOP. Duncan's main point was that what they need is a better sales pitch, not change in their core message.

The interviewer quoted a web comment from a GOP  web site that suggested the party move away from the religious right and asked if that person was wrong to believe that some groups had disproportionate influence in the party.






(Sound of starter motor fighting a losing battle on cold morning. Dust settles noisily.)

Date: 2008/12/21 19:00:46, Link
Author: Amadan
I have just struggled through Densye's latest. I had to wipe my eyes and check the screen when I read the bit about helping those poor inarticulate scientists.

I was going to say something to the effect that she is to science writing what Florence Foster Jenkins was to bel canto, but I can't help suspecting that dear Florence was having even more fun then her adoring audience.

In contrast, can anyone who reads Densye's 'prose' (Sweet Jeebus, talk about a new depth to the word 'prosaic'!) not help but feel the pain, the strain, the quivering purple-faced vein-bulging gruntingness of the lower-abdominal pressure it must require to produce it?

Date: 2008/12/23 08:17:50, Link
Author: Amadan
Re "bumped the shark"

There really is a simple explanation for this most unfortunate typo.

Densye is afflicted with a cognitive impairment that causes her to confuse the second and tenth letters of the alphabet.

It's called 'BJ on my mind' and I'm sure she will be happy to discuss it with all or any of you.

Date: 2009/01/02 17:43:34, Link
Author: Amadan
Quote (stevestory @ Jan. 02 2009,16:23)
That they can't do that tells me they don't have the teeny tiniest idea how science works.

Tut tut tut, Steve. That you're surprised by this tells me that you don't have the teeny tiniest idea of how the Goddidit Scam works.

1. Thou Shalt Not Talk Science to a Scientist (they couldn't sit for a month after learning that lesson)

2. Thou Shalt Not Waste Good PR Funds on Reescr . . . Reasrch . . . Test Tubes

3. Thou Shalt Make Lots of Sciencey Noise, But Just For The Rubes, Dammit!

4. Thou Shalt Buy My Book

Date: 2009/01/02 18:51:07, Link
Author: Amadan
Quote
I have been dismissed as an engineer looking for ether but I have proven my case here.


Ah. I see.

Date: 2009/01/02 19:44:25, Link
Author: Amadan
Quote (jeffox @ Jan. 02 2009,19:20)
Don't forget:

5.  Thou shalt make a joyous noise unto the tard!

:)   :p

That is not a valid premise as it assumes its conclusions.

Date: 2009/01/08 16:46:05, Link
Author: Amadan
Not exactly an evilushin quote, but too good not to inflict on youse lot:

 
Quote
Until original sin, mankind enjoyed a pre-pubertal sexual innocence. To judge by the one human being we know who is free from original sin, the Blessed Virgin Mary, human procreation before original sin seems to have been virginal, that is, not involving an active role on the part of either the male or female.


(From a letter in The Irish Times Monday 5 January 2009) (AD, in case you're wondering).

The subject of the letter was The Catholic Church and Celibacy.

Date: 2009/01/14 14:36:03, Link
Author: Amadan
I find myself in the mirror, not quite sober but devilishly handsome unable to contribute to Gil's polyglot collection as the Irish for 'fool' is 'amadán', and that, it would appear, has been taken.

Date: 2009/01/16 13:58:41, Link
Author: Amadan
The Resistance strikes its first blow!

Now everyone hold hands and pray for the success of our atheist friends.

Date: 2009/01/18 10:22:51, Link
Author: Amadan
Quote (khan @ Jan. 17 2009,19:49)
 
Quote (stevestory @ Jan. 17 2009,20:32)
   
Quote (khan @ Jan. 17 2009,20:29)
   
Quote (stevestory @ Jan. 17 2009,20:20)

Does anyone know his dimensions, so as to construct sweater dimensions?

I already know the dimensions of that sweater.

Too f&$%ing long by Too F&$%ing wide.


I'm 5'3", small boned, and underweight; I'm sure the original 'sweater' could be a tent.

It may not show much evidence of design, but the way that cardy is sagging out over his midriff clearly indicated front loading.

He must have $20 worth of nickels in the pocket of that thing.




Which reminds me of a venerable Grouchoism:

"My dear, you look like a million dollars. In lose change".

Date: 2009/01/21 13:40:42, Link
Author: Amadan
A final comment to close this thread - permanently, we hope:

Quote
We will restore science to its rightful place...

Date: 2009/01/23 18:46:06, Link
Author: Amadan
Quote (CeilingCat @ Jan. 23 2009,03:56)
 
Quote (nuytsia @ Jan. 23 2009,03:51)
 
Quote (Kristine @ Jan. 22 2009,09:17)
Denyse... You can put a man on Mars?

She reads them one of her love poems.
You'd be amazed how far they go. :D

Hmmm....  I wonder if she's a Vogon?

A rough draft, but better never than late...

I net-surfed idly as a clod
Intending for my brain to fill,
When all at once I said “My God!”
“A host of dumb creationist shills!
In Telic Thoughts, in U. Dissent,
In AIG, the same thing’s meant!”

Continuous as the curse of tax
There emanated, by the yard,
From that whining horde of hacks
A glutinous stream of lumpy tard.
I cried: “Let’s make this book-list longer:
If they are wrong, let me be wronger!”

The other creos sought to write
Simple parodies of science,
They never rivalled my pure shite,
And lacked the force of my deniance:
Proving Darwin was transitional–
(And probably a homosishnal.)

Now oft, while counting out my dough
I think of those who pay my bills:
The credulous, the simply slow,
And those for whom school held no thrills;
I dream of all the vacant gapes
As I point out “There still are apes!”

Date: 2009/01/28 05:33:40, Link
Author: Amadan
Quote (tsig @ Jan. 28 2009,03:38)
 
Quote (huwp @ Jan. 27 2009,17:19)
 
Quote (carlsonjok @ Jan. 27 2009,17:08)
No. The sweater is not the tent.  But, you are in luck because I used my mad google skillz to find a picture of the creation of the ID Big Tent.  


Whilst I am in awe of teh mad google skillz, I'm not sure I'd describe that picture as tasteful.  I'm just glad we didn't get something from your horse collection.

However, I suppose it really could depict the genesis of the ID Big Tent.

Well I always thought it referred to the Big Top, the biggest tent in the circus.

Bring in the clowns
Too late
They are here

This is unfair and in poor taste.

As previously displayed photos have demonstrated, Ddrr Dembski suffers from an acute medical condition having the technical name Tacky Cardie (ugh).

Mocking those less attractive, fortunate, intelligent, or educated than oneself if a deplorable thing and certainly would never be tolerated in this forum.

Date: 2009/01/29 13:39:54, Link
Author: Amadan
Good to see that, in these difficult end times, they're putting good moral thoughts into the kids' heads*.




*Their target audience should have plenty of room . . .



Date: 2009/01/30 13:24:28, Link
Author: Amadan
Then spake The Fount of All That Is True:
 
Quote

The ultraviolet catastrophe, also called the Rayleigh-Jeans catastrophe, was a prediction of early 20th century classical physics that an ideal black body at thermal equilibrium will emit radiation with infinite power.


That one didn't get solved til someone made all the physics-y bits hop instead of walk.

But didn't the Tardmeister Himself go one better with zero-frequency waves?

Date: 2009/02/04 17:40:51, Link
Author: Amadan
Louis,

Congratulations and anticipatory sympathy for the involuntary insomnia you will suffer (a) from 2009 until 2011 (est'd); and (b) from 2025 until 2030 (for different reasons).

I am the descendant of a very long line of parents, and so speak with considerable authority on these matters. A few points I can offer, based on my inherited insight into these things:

1. Food goes into the louder end.
2. Breastfeeding is the natural and wholesome way to ensure that your child is properly nourished and that you don't have to cover night feeds.
3. You will never, ever, ever be cool, fashionable, or attractive again. Just accept it.
4. Burping is vitally important to babies, ensuring that they settle after feeding. However, they must be taught properly. Practice your belching frequently, using as much beer as it takes to keep your CO2 levels up. Then you will be able to demonstrate to baby the correct head and neck positions, as well as fun tricks like reciting Latin verbs etc basso profundo. Mrs Louis will understand the importance of this and appreciate your fatherly solicitousness.

Bon chance to the three of you.

Date: 2009/02/04 17:52:44, Link
Author: Amadan
But . . . Barney proves that dinosaurs and precocious brats man coexist!

Date: 2009/02/07 05:40:31, Link
Author: Amadan
Quote (khan @ Feb. 06 2009,18:53)
Dear FSM, I have been doing the straight tard at 'FAQ2 Is Open For Comment' and my brain is getting ready to throw a rod.

 
Quote
That’s quoteable. Its absolutely correct! And as long as it is correct, ID is true science whether the scientific community likes it or not.

Gotta admit, it's an irrefutable argument.

Mind you, it's not original.

Date: 2009/02/08 17:56:14, Link
Author: Amadan
[Graffiti moved to Bathroom Wall. - Lou FCD]

Quote (RFJE @ Feb. 08 2009,16:57)
Evolution and the Origin of Life: Real Problems

The origin of life is one of the biggest problems for evolution, because of it's committment to naturalism.  That is, that all processes in the universe are explainable using only natural laws.  Virtually all other sciences can be explained by natural laws, but there are very real and ignored problems with  how the first life began.



I think you do yourself a disservice: you have in fact pointed out the underlying flaw in all the other sciences as well. After all, if we can't explain how the first chemicals began, there's no point in trying to understand chemistry, is there? And if we don't know where fizz comes from, there's no point in physics either.

It is indeed a credit to your mighty - nay, olympian - intellect that you have seen what the puny white-coat brigade have so clearly missed - or just avoided. Just think of the waste: all that paper, equipment, time and money squandered in pursuit of the uncompromising diktat of the tyrant Darwin, as inscribed on every textbook and paper infected by his insidious thoughts: "The Foundation of My Evil Theory of Evolution is Abiogenesis!" True, you have to get the basement light to reflect off the foil on your head at just the right angle to see it properly, but it's* there. And whether by reason of ignorance or (more likely) a simple lack of commitment** to the truth, the so-called scientists have missed it all along.

Quote
My question is why am I labeled as a propagandist . . .


I give up. Why are you? This is your first post on this board, so you can't be referring to anyone here, can you?

This place does harbour a few shocking bullies who really, really hurt people's feelings by throwing rough, sharp-edged facts and some dangerously sharp logic. If any of them have been mean to you, just let me know and I'll be very very cross at them.


* Please note correct use of apostrophe.
** Not sure of the corect speling. Is this OK?

Date: 2009/02/08 19:28:09, Link
Author: Amadan
[Graffiti moved to Bathroom Wall. - Lou FCD]

Omigod, so we do know where fizz comes from!

Date: 2009/02/15 15:40:58, Link
Author: Amadan
Quote (Schroedinger's Dog @ Feb. 15 2009,14:55)
 
Quote (Wesley R. Elsberry @ Feb. 15 2009,21:46)
If RFJE holds to usual religious antievolutionist form, trying to deal with theistic evolution and theistic evolutionists is going to be a huge problem for him.

Agreed 100%

Wes, as the "master of this venue", I hope you will forgive me for some of my ascerbic comments towards religion. I do not wish to mock anyone's belief, but I trully think that the average fundie's way of thinking/worshipping is in no way similar to yours (or any other theist scientist on this board).

It just blows my mind that smart people can easily reconcile their personal beliefs with mainstream science whereas others just seem stuck 500 years ago (at least).

My limited experience suggests it's based on upbringing and identity. Some groups self-identify as (a) different (b) persecuted or threatened in some way or another and ( c) self-evidently in the right.

Children born into these groups soak up these assumptions and conflate them with their personal and family identities. To disagree with them on these taboo subjects can provoke the same response as saying that their father is a bad man and their mother is ugly. Others who are not born members might subscribe to those central beliefs out of convenience or agreement, but the point is that they appeal to something that tugs at the heart, not the head.

We all have these blind spots and react in that way, whether it concerns countries, football clubs, political parties or religions. When the disagreement is about something that is considered unimportant (say, science education), the strength of the counterargument is irrelevant: it's just wrong.

What I find difficult to understand is the acceptance by members of nominally Christian groups of blatant lying and misrepresentation. Perhaps it doesn't count when the person who points it out isn't a True Believer.

Date: 2009/02/15 15:49:02, Link
Author: Amadan

Wow. That's deep

Date: 2009/02/16 16:31:43, Link
Author: Amadan

Date: 2009/02/17 08:15:52, Link
Author: Amadan
Quote (slpage @ Feb. 16 2009,21:30)
Well, OK - most of the mutations producing phenotypic changes that lead to human evolution from an ape-like ancestor were NOT beneficial.  Simple as that.

Especially if you were an ape-like father whose ape-like daughter was dallying with a slightly less ape-like mutant.

I mean, would you want your daughter to marry one of them?

It'd drive me absolutely bananas.

Date: 2009/02/18 08:21:28, Link
Author: Amadan
Proof, if it were needed, that the Papacy is The Whore of Babylon (or as is said in Dublin, 'the Hoor of Ballymun')

 
Quote
Organisers of a papal-backed conference next month marking the 150th anniversary of Darwin’s On the Origin of Species said that at first it had even been proposed to ban Intelligent Design from the event, as “poor theology and poor science”. Intelligent Design would be discussed at the fringes of the conference at the Pontifical Gregorian University, but merely as a “cultural phenomenon”, rather than a scientific or theological issue, organisers said.


I've got a little link. The comments are a useful refresher in creotard for those who might have forgotten the basics.

Date: 2009/02/18 15:28:27, Link
Author: Amadan
Quote (Gunthernacus @ Feb. 18 2009,14:47)
Like the Sirens' song...

First it was Carlson:
         
Quote (carlsonjok @ Feb. 17 2009,16:46)
I have a small digital recorder...I've never used it so I have no idea...

Now Amadan:
         
Quote (Amadan @ Feb. 18 2009,09:21)
I've got a little link

No wonder Richard is back.

Some people just got no Kulchur.

(And some who do just insist on making a complete mess of it.)


Strides manfully away, showing not the slightest indication of insecurity about genital dimensions

Date: 2009/02/18 15:35:21, Link
Author: Amadan
via Pharyngula:




I think I'm going to spew . . .

Date: 2009/02/18 16:18:13, Link
Author: Amadan
Post of the Nanosecond.

Best laugh I've had in while. Well done young man.

Date: 2009/02/20 13:40:36, Link
Author: Amadan
Quote (huwp @ Feb. 20 2009,11:15)
It also means that we have time to play some very good rugby as well.

Hwyl am y tro.

Huw

Looking forward to it . . .

Date: 2009/02/20 20:00:18, Link
Author: Amadan
Methinks we have a sniff of it. I'd have to agree that Wales have played like a Proper Bloody Team (feck off Huwp and let the adults talk) this year (again) but Kidney seems to have put a bit of the Munster zip in the crew. (And why not? 8 out of 15 are from De Reel Hoam iv Rugby)

Have to disagree about the French though. Chabal was wocious in 2nd row and had just the one decent run against us, in which his hair was more impressive than his ball-carrying. The back row let the pack down and the halves never got a grip. OK, it was the first game, but this isn't the Amateur Hour.

England woke up against Wales in the 2nd half but the team is a clatter of individuals led by a non-captain. You'll run in a try at Croke park but you'll be hammered.

Wales? (Huwp, Leave the room) Maybe . . .

PS: Have you noticd how Jerry Flannery always looks like you've just knocked over his girlfriend's pint?

PPS: Superman has a pair of Paul O'Connell pyjamas.

Date: 2009/02/22 12:37:42, Link
Author: Amadan
Video of an anti-ID song???


You have got to track that down for us to see.

Date: 2009/02/22 19:45:41, Link
Author: Amadan
You see, that's the difference.

The creos have been trotting out the same arguments for 200 years now.

The rest of us keep abreast of things.

Date: 2009/02/22 19:56:26, Link
Author: Amadan
This is probably germane to just about every thread on this board, and therefore belongs here:

Quote
'One of these days, Chico,' I said, 'you are going to face up to the fact that those friends of yours in what you persist in calling the War House know nothing about everything. They are as ignorant as you are. You should do something about it. Go down to the library and read a book.'

'Do you have any particular book in mind, sir?'

'Start at A or the shelf nearest the door and see what you can learn by Christmas.'

'You're joking, sir.'

'I never joke, Chico. The truth is is quite adequately hilarious.'


Len Deighton, Funeral in Berlin, 1964

Date: 2009/02/22 20:17:29, Link
Author: Amadan
I think I've posted before on the fact that our humble scientist must, before expecting the day's cornflakes to descend into the bowl, mutter to himself ritually "I might be wrong".

Do the wannabe theocrats ever consider whether the elimination as an option of 'We just don't know' might be the sin of Pride? The dichotomy that leaves IDC as the default option to All That Evidence-Based Stuff has just a teeny-weeny understated subtle hint of a gangrenous dose about it.

Date: 2009/02/22 20:20:48, Link
Author: Amadan
Maybe they just want to keep us in suspense.

Date: 2009/02/24 14:15:20, Link
Author: Amadan
I waste bloody years' worth of expensive education writing exquisite satirical prose and poetry for you lot and all you can talk about is a few cheaply thrown-together pixels.

Ungrateful shower of @?##&!!

PS  To all who were kind enough to wish me Happy Monkey, I wish them many happy rhesturns.

PPS: J-Dog, Thank you for the interesting quote. Could your Granny really do that? With the whole kennel? Why did anyone put that on a birthday card?

Date: 2009/02/25 19:27:14, Link
Author: Amadan
Quote (Richardthughes @ Feb. 25 2009,13:34)
Can someone please photoshop the cover of his book to "Closed-minded Christianity" wiv a silly pic?

KTHXBAI

Short notice, but the never let it be said  . . .

Date: 2009/02/26 07:56:20, Link
Author: Amadan

Date: 2009/02/27 07:18:36, Link
Author: Amadan


Hobby Vurthay

I'b gob shu shum gake . . .

Date: 2009/03/02 08:11:32, Link
Author: Amadan
<rugby_pundit /on>

I imagine there have been paralympic chess matches with more real action than we saw in Croker last Sat. But BOD deserves some sort of medal, if only to compensate for missing organs etc.

Don't underestimate the fathomless Irish ability to screw up, particularly in Murrayfield. And Wales are going to be [nearly] impossible to beat in front of the home crowd. If only our cruel, inhumane darwinian overlords could conjure up a potato famine or such like to undermine their morale!

And Louis, there's a rule to deal with the situation you describe:

Never Give A Ball To A Forward

Date: 2009/03/03 15:23:20, Link
Author: Amadan
Quote (Doc Bill @ Mar. 03 2009,08:25)
Getting back to the roastee, I also considered that what Egnor was trying to achieve was purple prose satire.

Unfortunate, the prose is poor, it's not funny and there's no real theme.

That leaves Dembski-fugly purple.

What is it about creationists that they are jokes, but they can't tell jokes?

You deign to call that wretched snivel ‘purple prose’? Pray, speak not so of that regal shade.  I think you forget your colours, Sir! I think you stumble, Sir, a lost chthonic being that finds itself in Sol’s realm and, dazzled, knows not one hue from another. If the dribblings of Eg*** are to be any colour at all – and so transparent are they, it is beyond the pow’r of man and beast to see it – then let them be a thin pale yellow, that it be of no worth to smear them on good white paper.

And ‘prose’? Ha! That prissy-frimping mewl? Is the jabbering of a half-wit prose? Are we to seek edification in the ramblings of the blissfully doted? Swift, Johnson, Rousseau, Dickens, Emerson, Joyce – and the biblical eructations of a protosimian headhunter with a sacred bone from Balaam’s ass through his nose? No! I say: prosaic it surely is; prose it surely is not!



ETA: Apologies to Dean Swift

Date: 2009/03/06 07:41:38, Link
Author: Amadan

Date: 2009/03/06 08:03:26, Link
Author: Amadan
When some posteriosylvian State eventually gets around to implementing a DI Academic Creedom Bill, the lawyers for the rationally-inclined will eventually get around the "Who me, Officer?" defence and drag the DI into the witless box.  

And they will point to Ignor's "Fundies with Pitchforks and Torches" rant on a web site that doesn't seem to have a disclaimer about the contributors' views not necessarily reflecting etc etc etc.

Dumb, dumber, and DI

Date: 2009/03/06 16:14:05, Link
Author: Amadan
Quote (J-Dog @ Mar. 06 2009,13:07)
Quote (Louis @ Mar. 06 2009,12:39)
But what created the tardles?

[/Tardist]

There is really only one way to understand the current state of tard, and that is to delve back deep into the archeotard record.

The caves of LasCaux first show early man's efforts to deny the obvious and give evidense of at least one early resident denying there were any mastodon's living in the area - with the next panel showing the unfortunate je^rry skewered by a tusk - with the third panel reading out what could be interpreted as some form of laughter -as s finger clearly points to a  "Ha!  Ha!"

Then I believe it was noted quasi-Spartan Davescoto that first demonstrated the Utility of Tard Theory, when he stayed at home with a "twisted ankle" while The 300 went on to glory at Thermopylae.

Later, William Paley's deeply conflicted neighbor, Anglican Minister William "Ann" Damp-Panty led tard in a new direction when he reportedly "found" Mr. Paley's watch "on the heath", and came up with an unbeliveably large number of reasons how it could have jumped from Mr. Paley's pocket to Mr. Dam-Panty's pocket, with the most oft repeated story the "I found it on the heath" mantra.

We can only hope that the new Budget holds enough dollars to continue the study of this archeotard.

"He who does not learn from the tard - eh, he is destined to repeat it", as noted Frenchman Schroediger's Dog is often fond of repeating.


PO next W!

Date: 2009/03/07 10:15:35, Link
Author: Amadan
Quote (1of63 @ Mar. 06 2009,22:58)
 
Quote (Zachriel @ Mar. 06 2009,21:06)
   
Quote
pharmgirl: We will likely never have observational data of evolution working at the genetic level over geological time.

And we'll never know what stars are made of because of their vast distances and unapproachable heat.

Meanwhile, analysis of soft tissues in T. Rex shows the presence of protein sequences that are more closely related to chickens than mastodons.

<Spock>

Fascinating!

</Spock>

Except you just know it's gonna take a lot more than a few scraps of dino tissue to satisfy the Tardists.

That needs a whole UDder approach.

Like going back in time to collect dino DNA samples every hundred years or so to build up a map of genetic pathways.

In a TARDIS.

With Dembski as Dr Dr WooHoo.

If the sweater fits...


Before I was banned and obliviated, and while posing as UD's resident atheist ID supporter*, I suggested that the wide range of opinions that found expression in the great Dr Dr D's elegant theses could be compared to Dr Who's small but all-containing time machine.

Thing is, I *ahem* couldn't recall the name of the dratted thing. Someone, can't remember who, helpfully chimed in to say "Ooooh, askmeteacheraskmeaskme it's the Tardis!"

So for a while I could soberly discuss the importance of the ID Tardis, support for the ID Tardis, etc etc. Eventually DaveT (who at that time had the keys to the asylum) cottoned on and all my lovingly crafted posts vanished in a fragrant cloud of electrons.

Aber es war schoen.




* No, I don't know either

Date: 2009/03/07 11:51:54, Link
Author: Amadan
Quote (k.e.. @ Mar. 07 2009,11:06)

TAKE A PILL AND LIE DOWN HOMO!

[blushes]

Why Dave, I never knew you cared!

Don't think we'll need the Pill, but I'll just get the KY...

Date: 2009/03/07 12:09:17, Link
Author: Amadan
Quote (dnmlthr @ Mar. 07 2009,10:21)
   
Quote (Amadan @ Mar. 07 2009,16:15)
Before I was banned and obliviated, and while posing as UD's resident atheist ID supporter*, I suggested that the wide range of opinions that found expression in the great Dr Dr D's elegant theses could be compared to Dr Who's small but all-containing time machine.

Thing is, I *ahem* couldn't recall the name of the dratted thing. Someone, can't remember who, helpfully chimed in to say "Ooooh, askmeteacheraskmeaskme it's the Tardis!"

So for a while I could soberly discuss the importance of the ID Tardis, support for the ID Tardis, etc etc. Eventually DaveT (who at that time had the keys to the asylum) cottoned on and all my lovingly crafted posts vanished in a fragrant cloud of electrons.

Aber es war schoen.

Well played, masterful baiting.

ETA: You don't happen to have logs of the event?

This is the response by Tribloon7 to my first post when I 'forgot' the name. My comment was Obliviated, so you can just see him quoting me. Zachriel kindly preserved the exchange for posteriority.

Another quote from an obliviated comment.

Date: 2009/03/07 12:41:37, Link
Author: Amadan
Quote (oldmanintheskydidntdoit @ Mar. 07 2009,12:18)
Yeah Patrick, remind me again why your "more plausible stories" about how ID did it are totally ignored?

You obviously lack faith.










In, ah, science. Yeah, science.

Date: 2009/03/07 14:11:43, Link
Author: Amadan
Quote (J-Dog @ Mar. 07 2009,12:51)
That BIG ID no-no nasty word is indeed "catholic".  Dr. Dr. was one, before he "got saved" and clearly the IDists are all about catering to modern Fundy thought, and your basic modern Fundy hates Papists, and the Whore From Rome.

I realize that you and I, and most sane people that read and swite in English are aware that there is more than one meaning for the word "catholic:", but you made the mistake of posting "catholic" at UD.

It was like waving a red flag before El Toro, or holding the large size bag of Cheesy Poofs in front of a certain ill-mannered Texas bully-boy - something was going to snap.


Particularly since they didn't want to teach the notroversy.

Quote
I also realize that O'Leary claims to be Catholic, but really... she is so far over the edge she's as Catholic as Hitler was on a church-going day, plus she belives in a Spatuala Brain, so she is twice destined to anathema.   Sooner or later she will realize that you can't out-dick the Pope, and she will re-cant her ID heresy, but basically, IMO she just don't count as catholic - hence your banning.


Hmmm: Opus Dei, holocaust-deniers, paedophiles, fraudsters, and  . . .  WHAT???? a vacuum-skulled scientific illiterate who's been hanging around with Red-State Fundagelicals?  GET THE HELL OUTA HERE, LADY!

Quote
I think you just mis-judged the raw amount of stupid at UD, which is easy enough to do.


Only in one direction

Date: 2009/03/08 08:35:26, Link
Author: Amadan
But it's true! Einstein should be at the very centre of creationist iconography!

Date: 2009/03/10 05:19:48, Link
Author: Amadan
Interesting article

How long before this gets tardiculated? As Densye will tell you, MRI stands for Magical Religiosity Indicator.

Nice quote:

Quote
"There is nothing unique about religious belief in these brain structures. Religion doesn't have a 'God spot' as such, instead it's embedded in a whole range of other belief systems in the brain that we use everyday," Professor Grafman said.


Now all we need is an MRI scan from Alabama that shows a picture of de Baby Jeebus.

Date: 2009/03/11 05:22:18, Link
Author: Amadan
Day-trip for the outpatients

Money quote:

Quote
Near the end of the "Evolution Trail," the class showed no signs of being swayed by the polished, enthusiastic presentation of Darwin's theory. They were surprised, though, by the bronze statue of man's earliest mammalian ancestor.

"A rat?" exclaimed Amanda Runions, a 21-year-old biochemistry major, when she saw the model of a morganucodon, a rodent-like ancient mammal that curators have dubbed Grandma Morgie. "All this hype for a rat? You're expecting, like, at least an ape."


Words fail me.

Date: 2009/03/11 07:17:24, Link
Author: Amadan
Quote (JohnW @ Mar. 10 2009,16:32)
...or the "Slavery is good if done in a godly manner" nonsense on UD's "skepticism" thread.

Hey! It's all in the interests of economic growth and freedom! It even say so on GATT's web site!





(Nice bit of hacking there, wonder how long it'll last.)

ETA: Seems the boys in the WTO slipped up and let the domain name go to the activists. Tee hee.

Date: 2009/03/13 05:27:47, Link
Author: Amadan
Our Istanbul Correspondent: All Science Here!

Date: 2009/03/13 06:46:59, Link
Author: Amadan
Quote (khan @ Mar. 12 2009,20:01)
Quote (Wolfhound @ Mar. 12 2009,20:35)
OT (if that's possible at TBW):  Gave blood 2 hours ago.  Drove home.  Fed horses, fed and watered chickens, gathered eggs from said chickens, fed parrot, fed dogs, fed cat, drank 3 Smirnoff Ices.

Wheeeeeeeeee!   :p

My next blood donation will be #160, 20 gallons (yes I know they switched to liters long ago).

Wow. Some Romanian friends of mine would like to meet you.


Unfortunately, they won't allow me to give blood here. They take that 'preserving Ireland from heathen British contamination' stuff a bit too seriously here.

Date: 2009/03/15 15:26:30, Link
Author: Amadan
Not to be out-Yeatsed:

That is no forum for sane men. The tard
In one another’s thrall, berks  with their muse
– Those lying generations – as if jarred,
The church-bell calls, the meekly-crowded pews,
Dolt, Dim and Dave, commend in terms most hard
Whatever is proposed, proved wrong, reused.
Caught in that brain-dead drooling all neglect
The simplest use of basic intellect.

Creationist Man is a pathetic thing,
To tattered stories grimly stuck, unless
Soul grab its mouse and click, and harder click
On every link on the Internet,
Nor is there Google-school but studying
Textbooks of their own magnificence
And therefore I have surfed the Web and come
To the holy forum of AtBCium.

Date: 2009/03/15 15:36:33, Link
Author: Amadan
Oi! Be careful what you wish for.

If they're not allowed to be rude about us, would we have to be nice about them?

UD without bannination would be like religion without damnation. What would be the point?

Date: 2009/03/15 15:57:14, Link
Author: Amadan
Quote (FrankH @ Mar. 15 2009,15:41)
 
Quote (Amadan @ Mar. 15 2009,15:36)
Oi! Be careful what you wish for.

If they're not allowed to be rude about us, would we have to be nice about them?

UD without bannination would be like religion without damnation. What would be the point?

Personally I think that if one really wanted to get under their skin, being nice but pointing out their rudeness in a polite and "matter of fact" manner would be the way to go.

As much a I want to make fun of them and reach through the monitor to wring their scrawny little pencil necks, I know that killing them with kindness will work the best as it will easily be shown who is the rude moron.

Have to disagree.

There is a subset of the creationist herd that may be open to persuasion that they've been fed the wrong story. They tend to be the more intelligent and engaged ones who really just don't know the facts or what scientists actually say. Confronting them with the harsh realities of science etc will only reinforce their belief in the false salvation/evolution dichotomy, because you are attacking them. However, what does get through to them is seeing the dishonesty of their own side. UD (as faithfully observed here) does that nicely. Wouldn't it be a shame if they took that toy away from us?

Then of course there are the lost causes who bring their crayons to the debates at UD. Sadly, they won't let me in to play any more. But they're fun to poke sticks at from outside the cage.

Date: 2009/03/15 17:21:35, Link
Author: Amadan
Quote (tsig @ Mar. 15 2009,16:55)
 
Quote (J-Dog @ Mar. 15 2009,16:31)
How long before they announce this was all "street theater"?

Yes, they threw Dave under the bus.

Date: 2009/03/15 17:23:49, Link
Author: Amadan
Shakespeare, Yeats, Auden: Golly, but we're very cultured here!

Date: 2009/03/15 17:26:43, Link
Author: Amadan
Quote (GCUGreyArea @ Mar. 15 2009,17:25)
Should we be sending DaveScot a formal invitation to join us here in the forum of the banned?

Wes wouldn't like it. He once threatened to hack PT.

Date: 2009/03/15 17:37:40, Link
Author: Amadan
Quote (GCUGreyArea @ Mar. 15 2009,17:31)
 
Quote (Amadan @ Mar. 15 2009,17:26)
   
Quote (GCUGreyArea @ Mar. 15 2009,17:25)
Should we be sending DaveScot a formal invitation to join us here in the forum of the banned?

Wes wouldn't like it. He once threatened to hack PT.

Like most Christians I believe in forgiveness and second chances, unlike most Christians I practice what I believe in, funny though, I'm not a christian.

I think we should at least give him a chance, it just seems to poetic to pass over.

Maybe if there was a secure way of letting us hear what he had to say without actually giving him access to the forum.

Do you think we could rig up, oh, I don't know, maybe something like a microphone in Texas and a loudspeaker in the ceiling here?

Hey, why didn't anyone think of that before?

Date: 2009/03/15 18:35:35, Link
Author: Amadan
Quote (Ptaylor @ Mar. 15 2009,18:24)
Meanwhile, Barry has put up another Darwin-was-a-racist thread:
       
Quote
Some Darwinists will say anything to try to draw attention away from the obvious.  The point of my “Scientific Certitude” post was to show that evolutionary theory has been used to support racist views.  Darwin was a firmly committed racist, and he was not shy about expressing his racist views: <snip>


Link
What a wanker.

Too true. That deserves the Presidential Medal.

Date: 2009/03/15 18:48:39, Link
Author: Amadan
Quote (Kristine @ Mar. 15 2009,17:49)
I guess it's time for that poem I was thinking about before leaving - ah-hem, here's one for Amadan:
       
Quote
When I consider how his snark was spent,
Ere half his days, in this dark U and D,
And that one poster which is UD marquee
Lodged with them useless, though his pride misspent
To serve therewith their Maker, and present
no true account, lest Dembski chide,
"Doth Design exact day-labor, evidence denied?"
I fondly ask. But Pretense, to prevent
That comment, soon replies: "Designer doth not need
Either man's labs or his own brains; who trains
the credulous to the yoke, they serve him best. His logic
Is ringly: thousands at his fallacies speed,
And post o'er sanity and reason without rest;
They also serve who only bloviate.

Deeply flattered, thank you.

Oh, it's not about me?

Date: 2009/03/15 19:21:03, Link
Author: Amadan
I love Milton. I tried to cook up something based on 'Avenge O Lord Thy Slaughtered Saints', but it wasn't any good. [Sulk]

But there's always WS Gilbert to fall back on when you're stuck:

To sit in solemn judgment on the UD Chair
With a Bannination Button at your finger there
And just waiting for a dissident to whisper "Where
Does it say we have to follow Dembski everywhere?"

Date: 2009/03/15 19:35:45, Link
Author: Amadan
Quote (Dr.GH @ Mar. 15 2009,19:00)
Quote (GCUGreyArea @ Mar. 15 2009,15:25)
Should we be sending DaveScot a formal invitation to join us here in the forum of the banned?

I have no use for D'Tard at all. Nor he for me.

I think we should start a pool for when DS stages a return to the warm pile of manure that is UD.

I agree. Apart from Town Hall, where is there? And even Dave has more self-respect than to join the communal head-bang there, doesn't he?

10 days for my money. Barry doesn't want to lose us, after all. We're probably his biggest fans audience.

Date: 2009/03/15 20:31:59, Link
Author: Amadan
Quote (carlsonjok @ Mar. 15 2009,20:00)
Amadan! Paging Amadan!  Please report to the nearest Photoshop!

Allen MacNeill has returned to the field. In part:
   
Quote
Most evolutionary biologists today freely admit that Darwin was a racist by today’s standards, although even by 19th century standards, his racism was very mild. But that hasn’t been acknowledged by Arrington and O’Leary. Instead, they keep on posting the same idea over and over again, without ever responding to evidence that shows unequivocally that evolutionary biologists today are  not racists, nor does the modern theory of evolution contain anything that might be used to support racist ideologies.

It’s kind of like tag-team wrestling: O’Leary keeps posting until the opposition gets too tough, and then she tags Arrington, who posts the same old same old over again. So, once more into the breach, good friends, once more:


EDIT: So google up some WWE pictures and photoshop away!

Fecksake!

It's 1:20AM in the Literate Part of the World!

I'll see what I can do tomorrow. Some of us have a Real Life, you know.

[/curmudgeon]

Date: 2009/03/16 09:37:30, Link
Author: Amadan
This just in. Those evil Templeton people are trying to get back in Densye's Good Book good books by giving her an opportunity to bloviate about something she has the cube-root-of-feck-all's chance of actually understanding:

Quote
While Professor d'Espagnat's work is not explicitly religious, he aims to delineate what science cannot definitively rule out.

His concept of an ultimate reality - as he terms it, "the ground of things" - is only glimpsed, not explicitly described, by science.

Science, he said, "is aimed not at describing 'reality as it really is' but at predicting what will be observed in such-and-such circumstances".

"What science really teaches us is that it's not with ordinary concepts that we shall ever reach 'the ground of things'," he added.

The spiritual, he argues, cannot be ruled out by scientific endeavour. However, for him, the existence of something inexplicable does not create an uncomfortable sense of mystery.


Countdown to ecstatic tardspume: 10, 9, 8, uh, has anyone seen my calculator?

Date: 2009/03/16 10:20:15, Link
Author: Amadan
Quote (k.e.. @ Mar. 16 2009,10:00)
Can they really be that ignorant of history.

(a) Those who are, don't care.

(b) Those who aren't know it doesn't matter because (a)


Are you new to Creospotting?

Date: 2009/03/16 17:19:25, Link
Author: Amadan
I promised Carlsonjok a pic today but couldn't have been arsed to transform Densye into WWF wrestler. It would have been an intellectual mismatch anyway.

So this is what you get instead. ¡Que aproveche!

Date: 2009/03/17 14:20:25, Link
Author: Amadan
St Patrick's Day was, unusually, dry and mild in Dublin. As is usual, the parade is attended by parents unable to dump their kids at school, and by hordes of foreigners (pronounced 'fardners' in the local dialect) who expect the day to be an orgy of green-tinged Riverdancery and are bemused by the general uninterest of the natives.

But I had a pleasant walk down the South Bull Wall, so all's well with the world.

Carry on.

Date: 2009/03/17 14:24:22, Link
Author: Amadan
I think the contributors to this board did Ddrr Bill a great service in pointing out the mistaken view of Weasel that he was about publish, saving him much embarassment.

I wonder if he's grateful?

Date: 2009/03/17 16:51:09, Link
Author: Amadan
Quote (Arden Chatfield @ Mar. 17 2009,15:33)
 
Quote (Amadan @ Mar. 17 2009,12:20)
hordes of foreigners (pronounced 'fardners' in the local dialect) who expect the day to be an orgy of green-tinged Riverdancery

What? You mean... the entire country of Ireland doesn't look like this?:


Nope.

Irish pint glasses don't have handles, and none of those guys are singing in Polish.

Akshully, the Poles are the only ones who do any work in this country. Disregard the above.

In fact, disregard just about everything I say.



I do.

Date: 2009/03/17 17:11:25, Link
Author: Amadan
Quote (AmandaHuginKiss @ Mar. 17 2009,17:02)
The implication was that if we met aliens, we may never be able to understand them as we do not share the same base grammar.

That is so easy to refute it doesn't even need to be refuted.

After initial misunderstandings that lead to the tragic deaths of unidentified red-suited crew members, the common nature of earthlings and aliens is accepted and the busty alien princess falls in love with Kirk.

Are you sure you're serious about science?

Date: 2009/03/18 05:45:53, Link
Author: Amadan
Quote (Kristine @ Mar. 17 2009,23:23)
Afarensis gets what Afarensis wants. I'm pretty proud of this one. :)
   
Quote
'Twas Barry, and the slithy Gil
Did fla and gellum in the bact:
All dimsy were the Dembskifarts,
And the tome O'Learyblat.

"Beware the DawkerDawk, my son!
The sel that fish, the genes that catch!
Beware the meme-meme heard, and shun
The shimmying post-cranial scratch!"

Dave took his moral pen in hand:
Long time the churchrome foe he sought --
So rested he by the Dumdum tree,
And stood awhile distraught.

And, as in oafish thought Dave stood,
The DawkerDawk, with eyes evolved,
Came watchmaking up the mountain good,
And improbable as he came!

One, two! One, two! And through and through
The synaptic fire went snicker-snack!
Dave left ID dead, and with ID's head
at UD turned his back.

"And, has thou brain? The DawkerDawk
Comes to thine arms, my beamish boy!
Happy Darwin Day! Callooh! Callay!"
Oh, 'tis a dreamed-of joy.

jealous....

Date: 2009/03/18 08:54:02, Link
Author: Amadan
Tasteless Comment of the Month!

Your award will be presented by a crippled war orphan.

Which reminds me of a joke . . .

Date: 2009/03/20 15:51:38, Link
Author: Amadan
[Doctrine Slot]

It takes just a few digs with a sandpit-class spade to establish that, in RC doctrine, Da Big Guy is infallible only when he speaks ex cathedra*, and then only on matters of doctrine. To the best of my knowledge (I'm a bit rusty on matters Romish) that has only explicitly been done once, in the 19th century, on the question of the assumption of Mary. Not many people know that.

Pity though, it spoils all Jack Chick's really juicy lines.


* 'from the seat' Don't bother, the joke is already old.

Date: 2009/03/22 17:42:29, Link
Author: Amadan
Happy Birthday Kristine!

Oh yeah. A funny-looking guy in an ugly cardigan left this for you:

Date: 2009/03/22 18:01:23, Link
Author: Amadan
There would be no violation of copyright if you opened a thread here on the same subject as some or all the threads opened on UD. That would allow the banned and limbo'd to cross-post.

You couldn't copy more than extracts of UD posts you were responding to without breaching the authors' copyright, but you could in any case hyperlink to them.

The result would be a bannination-free UD response site (as opposed to mirror) where any UD regular who actually wanted to respond to reality-based observations could do so without fear of the banhammer.

Date: 2009/03/23 11:06:35, Link
Author: Amadan
Not a great game of rugby but oh my designer what a match! As Spike Milligan put it, 'Not a dry seat in the house'.

I really feel sorry for Steve Jones, it was a heartbreaking finish for him, but in fairness it was a kick even he could respectably miss. If he had got it over, there would be 32 pieces of Paddy Wallace's body on display in 32 counties now, with one in particular nailed to a flag-pole in Limerick (this is not uncommon there, apparently).

I think it was a 6-Nations won and lost by coaches. Kidney maintained the form, morale, and psychology consistently, Gatland wobbled, Hadden was a lost cause, Johnson only began to get to grips when England had blown their chances, and who the feck knows what Lievremont was doing? And poor old Mallet was reduced to experimenting with putting forwards into the backs. On their day, France, England or Wales could have thrashed Ireland, but there was nobody there to push the right buttons or make the right selections.

Which, by default, proves ID, as ane fule kno.

Date: 2009/03/23 11:30:17, Link
Author: Amadan
Please don't get me wrong, Peter, but the phrase 'dog bites man' minds to spring.

But it would be fun to ask if Mr Thorsland would approve of teaching all that Newtonian 'theory' in his God-fearing school if he knew the Trinity-denying alchemical idealogy that goes with it.

Date: 2009/03/24 09:34:15, Link
Author: Amadan
I've seen ravens that had less Poe about them.

I mean, "count the letters in the dictionary"?

But hang on! A picture is worth 10^3 words. And a 'word' is (if I remember correctly, someone with a brain will put me right if I'm not) 32 bits. 'Two bits' means 25 US cents. So if I take a photo of a quarter-dollar, its FCSI is [(32/2)*10^3] = 16000 bits = $4000.00

Not a bad return on a quarter, especially in these impoverished [End-]times.

Date: 2009/03/24 10:24:37, Link
Author: Amadan
Cakes are self-raising, i.e. they don't need parents to raise them. If they don't need parents, they must either have been spontaneously generated or divinely created. Louis Pasteur (who, as his name implies, must have been a Southern Baptist pastour even if he was French) made spontaneous generation illegal. Therefore ID.

Sheesh! Do I have to do all the thinking in this place?

Date: 2009/03/24 10:38:21, Link
Author: Amadan
Quote (Jkrebs @ Mar. 24 2009,10:30)
PotDay, so far, at least.  Very good.

Thank you.

Never has Portal seemed so appropriate:

Date: 2009/03/26 06:08:25, Link
Author: Amadan
Proof, (as though it were needed) that ID was right even before it was right.

Legally enforceable undertakings require me to state that Eve Joiner is not related to Denyse O'Leary.

Date: 2009/03/27 07:53:16, Link
Author: Amadan
Quote [mined] from unknown source:

Quote
Something about it reminded me of Texas - the enormous, wide, open spaces, surrounded by teeth.

Date: 2009/03/27 19:33:06, Link
Author: Amadan
Quote (Ptaylor @ Mar. 25 2009,22:20)
 
Quote (Hermagoras @ Mar. 26 2009,16:57)
Agreed.  That should win an award or something.

TOTW? Anyone have Photoshop skilz for a trophy?

Sorry for the delay, small matter of work, family, life, etc. I'm sorry, AtBC, but I have not been faithful to you...

Annnnnyway, I am happy to donate the Springer Memorial Trophy, which is to be awarded each week (or as appropriate) to the UD poster who performs service to Tard above and beyond the call of, erm, Tard.

The Bush medal has been enshrined in this, as also a colander to signify the extent to which ID holds water.



Admins or anyone who feels the compulsion to award it are invited to link to it at

[URL=http://lh6.ggpht.com/_8An3n3xauRA/Sc1uDh9iHAI/AAAAAAAAAf8/tJ-AeaIHAi0/s400/tard_trophy.gif[/URL]

Date: 2009/03/28 05:16:05, Link
Author: Amadan
Quote (Hermagoras @ Mar. 28 2009,00:42)
holy crap jerry is thick    
Quote

“Latching is equivalent to preventing deleterious mutations. Therefore a realistic simulation should not latch, but should instead allow deleterious mutations to be filtered out by the fitness function.”
Absolute nonsense. You have it backwards. Deleterious mutations are eliminated from the offspring in normal evolution not allowed to prevail. Natural selection would select the progeny with the functional traits and eliminate those when the traits were not conserved. A functional state is treated as equivalent to a non functional state by Dawkins’ Weasel program which is very bad evolutionary theory by the high genius of evolution. Latching is a more realistic outcome.
This whole discussion is as I said folly because the example is very bad evolution and very bad pedagogy. But people follow this idiot Dawkins like he is a prophet. Dawkins would make a good used car sales man because he has sold a bunch of junk to people in the last 30 years. And they smile when they buy it.
“To latch or not to latch, that is the folly.”

All this time and jerry shows not the slightest understanding of what Weasel is about.

We have a winner!


Date: 2009/03/28 11:16:11, Link
Author: Amadan
Quote (oldmanintheskydidntdoit @ Mar. 28 2009,10:56)
If they all believe they are right, that ID is true etc then how is it they never question the fact that nothing ever happens that advances the ID cause?

They would have to be totally deluded to use the "expelled" oh noes we're being silenced argument every time because there are countries around the world other then the USA.

For example, is there a single example of ID being silenced in Gordon Mullings part of the world? Why not open up the ID science base camp there then?

A Google Image search for "secret research lab caribbean" throws up this:



The only way we'd find out what's going on would be to sneak past the ruthlessly efficient ex-East German Stasi Guards by swimming in in scuba suits wearing full evening wear underneath. Then we'd mingle with the elegant and sophisticated glitterati enjoying their hedonistic materialist life while casually . . . .

Oh hang on, that's how you find out about secret evilushinary research.

How do you break into a Tardbase? Send a postcard saying that Sunday School has been rescheduled to 3:45AM on Tuesday, (and PS, Jesus says to leave the gate open)?

Date: 2009/03/28 11:59:40, Link
Author: Amadan
Quote (Zachriel @ Mar. 28 2009,11:24)
Quote
William Dembski: But it points up that just as grammars are not sufficient to generate meaningful texts, so the Darwinian mechanism is not sufficient to generate the functional complexity of biology.

That statement is only supported if your colleague has shown he has exhausted the possible solutions. Phrasenation can successfully explore a library of meaningful phrases, a miniscule subset of possible phrases. Using a grammar-checker requires a clear, operative definition of "meaningfulness" so that we can judge the results.

William Dembski,

Please provide a specific and discrete algorithm for determining the metric of fitness, the "meaningfulness" of phrases. Start with these sequences and then provide the generalizing principle.

"Add two cups of sugar and stir."
"To be or not to be?"
"Pain of a rat, pray!"
"A cold God soon berates."
"Supercalifragilisticexpialidocious!"
"I have been in such a pickle."

(The last phrase brought down the house in Shakespeare's time.)

That was too good a phrase to pass up:

Date: 2009/03/30 08:18:14, Link
Author: Amadan
Quote (oldmanintheskydidntdoit @ Mar. 30 2009,08:05)
Jerry misses the point
       
Quote
Yesterday, I found my copy of the Blind Watchmaker so I decided to read the chapter about the Weasel simulation. In Dawkins first example in the Blind Wathcmaker, after 20 generations, 20 of the 28 characters were found. Any one have any idea of what population size, mutation rate or other parameters were programmed in to get so quick a result?

Hazel answers
       
Quote
Many people, as has been discussed here and elsewhere, have gotten results similar to those in the BWM with a mutation rate of 5% and populations around 100 or 200. I don’t believe there are any other necessary parameters.

Now, Jerry, is that with or without latching?

The strange thing is that on that very thread Jerry has said
     
Quote
My guess is that Dawkins tried the latching first and found it to be too easy so he changed the program but unwittingly went to poor evolution to do so.

     
Quote
Now it turns out that by programming that latching effect into this absurd example one gets a less absurd simulation but it is extremely trivial one because it reaches an answer very quickly.
     
Quote
From what I understand the offspring population size generated at each iteration should be the same for each type of simulation. The only difference is whether a letter is latched or not. If that is wrong, then why? I am willing to learn.
     
Quote
Latching is equivalent to preventing deleterious mutations. Therefore a realistic simulation should not latch, but should instead allow deleterious mutations to be filtered out by the fitness function.
     
Quote
This whole discussion is as I said folly because the example is very bad evolution and very bad pedagogy. But people follow this idiot Dawkins like he is a prophet. Dawkins would make a good used car sales man because he has sold a bunch of junk to people in the last 30 years. And they smile when they buy it.
     
Quote
I bet Dawkins did the latching first and found out the example was too fast and consequently not believable so he went for the even less realistic version just because it searches longer. But in either case the example has no value except to prolong irrelevant discussion about it for people who have too much time on their hands.
     
Quote
Dawkins is one of those die hards so this program as well as Dawkins should be thrown under the bus and everyone should move on to the new paradigm.
     
Quote
So if there is any teaching value in the Weasel program it is that “The King Is Dead”; “Long Live the King.”
     
Quote
No, I think the whole discussion should be abandoned and the Weasel program put in a black hole where it rightly belongs only to be resurrected to show why it is useless and not to emulated.
     
Quote
I find the persistence of this silliness the most interesting thing about this discussion. Now that I understand that the Weasel program is nonsense, we can point to this discussion to shorten any further discussions in the future. That is the whole value of this thread. A way to short circuit further inane discussions down the road.
     
Quote
The parameters of the program is nowhere close to reality so trying to salvage it by suggesting which of latching, almost latching and no latching is best, really misses the point.
     
Quote
There is no accumulation of information through selection that I have ever seen so how could I present a better way to an example I am not aware of.

And let's just repeat that last comment again
     
Quote
Yesterday, I found my copy of the Blind Watchmaker so I decided to read the chapter about the Weasel simulation. In Dawkins first example in the Blind Wathcmaker, after 20 generations, 20 of the 28 characters were found. Any one have any idea of what population size, mutation rate or other parameters were programmed in to get so quick a result?

Way to make yourself look like a fool Jerry! And all on the same thread! So Jerry is cool with dismissing something out of hand before he has even read the authors description!

He really does not have a clue.



Further comment not required.

Date: 2009/03/30 18:13:17, Link
Author: Amadan
Am I the only one who thinks that there is a distinctly YEC aroma to the Tardmines these days?

Has the new management renounced all that ahem [swallows hard] sciencey nonsense?

Date: 2009/03/30 18:16:06, Link
Author: Amadan
[Worshipful bow before the Master]

Many more ellipses, Mighty One.

[Exit, pursued by a mask tool]

Date: 2009/04/01 06:42:29, Link
Author: Amadan
The Tardoscopic Interferometer is also widely used.

This measures the speed and intensity of interference with rational comment on a creationist blog.

Then there is the HeisenBorg Sphincter-o-Scope.

This is used to counter scientific objections by means of a 'handwave-collapse' function.

Lastly, there is the Kairoscope:

This measures, on a logorrheic scale, the sufficiency of a creationist argument in terms of the quantity of words and number of months it takes to express it.

See? All science!

Edit: Changed name of last device. L'espirit d'escalier and all that.

Date: 2009/04/02 15:53:30, Link
Author: Amadan
But you forgot the scissors!

If you cut in half the sheet of paper with the cake recipe, it will make twice as many cakes. Especially if they're rock cakes.

Or maybe not: seeing that we're dealing with Shannon information here, it would probably have to be a log2 cake.

Date: 2009/04/03 05:58:51, Link
Author: Amadan
Panic!

If someone from UD feeds a few flagella into the Eureka Machine, surely the EF will pop out, rendering scientists obsolete!

Suggested response strategy: Argue that technician who plugs in the Eureka Machine reads Left Behind novels and so has "smuggled in" Tard.

Should work. Other suggestions welcome.

Date: 2009/04/03 11:42:57, Link
Author: Amadan
Quote
a crowbar


First time I've hear that term for it. You must have gone to a technical school.

Date: 2009/04/04 16:08:53, Link
Author: Amadan
Could be worse. What if you had made us think of the porn model's head on Densye's body?


No, please don't. PLEASE

Date: 2009/04/07 06:32:18, Link
Author: Amadan
Quote (Richardthughes @ April 06 2009,23:18)
God. hmmm. You can bring the prime mover forward to the universe itself. Or push back to infinite regress.

There is no logical objection to asserting a Prime Cause as a means of avoiding infinite regress.

After all, the negative integers stop at 4004 BC. Nobody objects to that, do they?

Date: 2009/04/07 09:38:30, Link
Author: Amadan
Ben Stein returns to the Hallowed Halls of the Academic Elite.

Or will the evil Dawkins make those knock-kneed Perfessers drop him??

Won't anyone think of those poor Christian morons children?

Edit: Grammur. Ure wurth it.

Date: 2009/04/07 14:42:24, Link
Author: Amadan
Don't worry. Poor dear Ben will be just fine. It's science that makes you kill people, as he comprehensively demonstrated in a cinematic footnote to the pimple on my arse. And they're not going to allow anything like science at Liberty, nossir.

The C*ultergeist tells us that Jews just need to be 'perfected' to be come good Republicans Xtians. Maybe all those newly-minted missionaries will take the opportunity to perfect Ben. In fact, they really would be failing in their duty if they didn't try.

Hmm. Someone should go and remind them.

Date: 2009/04/08 13:16:03, Link
Author: Amadan
Forget the Cambrian Rabbits: We've found a Carboniferous Pony!

Date: 2009/04/09 07:53:30, Link
Author: Amadan
Seems to be true:

http://ncseweb.org/news/2009/04/comer-case-dismissed-004712

Date: 2009/04/10 10:50:29, Link
Author: Amadan
Joyeux Cumpleaños!

Me and the guys got you a real special present . . .

Date: 2009/04/10 16:10:05, Link
Author: Amadan
Quote (k.e.. @ April 10 2009,13:35)
 
Quote (khan @ April 10 2009,19:28)
Happy Birthday!

Thanks...where's my cake?

A Reubenesque lady ate it:

Date: 2009/04/12 06:55:10, Link
Author: Amadan
idnet.com.au delivers a searing indictment of the [im]moderation policy.

 
Quote
Where are the defenders of Darwinism when we need them?


That is meant as a complaint against moderation, isn't it?

Date: 2009/04/15 05:23:45, Link
Author: Amadan
Quote (k.e.. @ April 15 2009,04:27)
Fuck they're vacant!!!!

Lobotomized at the same time the pastor stole his foreskin.


The legal term is compost mentis.

Date: 2009/04/21 18:34:06, Link
Author: Amadan
Dear Abby,

Happy Afterbirthday.





ewww

Date: 2009/04/21 20:09:58, Link
Author: Amadan
I've followed this thread for a while. Like Daniel, I'm not a scientist. Unlike him, I'm one of the delinquents who hang around this shabby corner tripping up grannies, so I may be accused of bias towards The Dark Side. Nevertheless, I'd like to derail Daniel from his scientific quest for a minute if he'd be so obliging. I'd like to ask Daniel about toast.

When the alarm dumps me from the bosom of my slumbers into the grim indifference of the day, I soften the blow with the wonder that is toast. I note that removing the toaster's plug from the wall tends to impede the production of toast. I have heard that the magic that restores toast production when I plug it back in is related, in some way that someone mentioned in school, to the magic that makes the news issue from the radio. Remember, I'm not a scientist, so I can't explain this from personal experience or even intuition. I suppose that option is still open, but it would take quite a bit of catching up on the books.

So help me here Daniel. Can I say that I know that your toaster, which has pretty much the same parts as mine and even comes from the same factory, works by means of the same magic as my radio? How do I know that yours doesn't have a toast fairy? For that matter, how can I be sure that mine doesn't? To eliminate the toast fairy hypothesis, do I have check the behaviour of every toaster in the world? And should I then check all the radios to make sure they run on the same stuff?

As a rational person, you'll tell me not to bother. Though you aren't a scientist, you know that this "electricity" thing is reasonably well understood. I can take it for granted - heck, I can even say I "know" - that toasters and radios need it. It might be conceivable that there are other ways of making them work, but the ones we're talking about, with the wires and aerials, all use it. All that stuff in the textbooks is not really relevant to us laymen. The important thing is that, consistent with its description, we can use electrical equipment when we plug it in.

But Daniel, while I know you are impeccably honest and would not lie to me about something so important as toast, how can I be sure you're right? Am I being unreasonable if I suggest you just mention the toast fairy hypothesis the next time you talk to someone about toasters? I have to note that the plug on your toaster has just 2 pins while mine has 3, and yours says something about 110 Volts while mine mentions 220. Doesn't this inconsistency prove the toast fairy hypothesis? Also, the news on your radio is distinctly different from that on mine.

So Daniel, I'm afraid we've reached an impasse. Unless you can give me a convincing explanation of all plug types used on toasters, and of the mystery of the missing 110 volts, and account for each different news programme on every radio everywhere, I have to conclude that you are unable to defend your electricity "theory".

It's tough, but that's what you have to do to overcome the objections of toast-fairyism.

Date: 2009/04/22 06:30:25, Link
Author: Amadan
... or a vivid imagination.




(Or so I'm told)

Date: 2009/04/22 07:46:36, Link
Author: Amadan
Quote (CeilingCat @ April 22 2009,07:04)
 
Quote
23

Nakashima

04/21/2009

3:15 pm
Mr Arrington,

I am attempting to state Mr Kairosfocus’ logic in symbolic terms, and facing some difficulties.
Post of the week on another board!

How about this? A never-ending loop of Bible-babble!

Date: 2009/04/22 11:29:23, Link
Author: Amadan
Quote (Richard Simons @ April 22 2009,10:31)
I am curious about what is going on in Daniel's mind. Is he aware that the evidence he demands for evolution is so enormously different from the evidence he accepts for his religious beliefs? Does he have a block in his mind that does not allow him to examine his religious beliefs? It is my understanding that a person can be hypnotised into, say, always avoiding a certain patch of floor in the middle of a room and when asked will be able to provide justification for their actions. Does something similar go on in the minds of religious believers when they are asked to justify their faith? Has anyone made a comparison?

Having asked a similar question to some fairly convinced religious types, I gather that the thinking is similar to the reason why you (hopefully) don't daydream about your children getting kidnapped or run over by a bus. Some things are just too awful to contemplate.

It's a pattern we all adopt. F'rinstance, we in the West live in a comfort zone that lets us ignore the effect on developing countries of trade policies designed to assure our standard of living. We occasionally rationalise away Bad Thoughts that pop up, or we pretend the problem isn't really there.

Creationists I have argued with are almost always not just poorly educated in science; they tend to be unaware of it and indifferent to it. So why should something you neither know nor care about have the right to disturb your faith-based world-construct?

The vast majority of fundies I have encountered don't actively go out looking for evolution to disinfect. They just want it to go away.

Date: 2009/04/22 15:28:40, Link
Author: Amadan
or toast?

Date: 2009/05/01 05:58:16, Link
Author: Amadan
Persecution!!!!!11!!!!

Date: 2009/05/01 09:40:38, Link
Author: Amadan
Akshully, I'll side with the Faroutmaaan. If you can dump a mine of batshit like McLeroy* without publicly provoking The Base, it would be a great tactic.




* How did the good Clare name Mac Giolla Rua end up as this misbegotten hash?

Date: 2009/05/01 17:59:29, Link
Author: Amadan
Q: What do you give a moderator on his birthday?

A: A moderate cake

Date: 2009/05/01 18:07:00, Link
Author: Amadan
Quote

BarryA
09/14/2006
5:24 pm

There were two points. 1. you wouldn't let it go and you were cluttering the thread and thereby making it less useful; and 2. I was, frankly, embarrassed for you (not by you, for you).

Date: 2009/05/04 12:43:04, Link
Author: Amadan
You're absolutely right. They don't even have the decency to have their bang in private!

Stop the Big Bang NOW!

And as every fiscal conservative knows, inflation is a liberal tactic to destroy the hard-won savings of honest church-going famblies.

So let's get back to the spirit of the Ford presidency:


Whip Inflation Now!

And that cosmic expansion can only be another case of the goddam Demon-crats overreaching, (universal health-care, universal declaration on goat-lovers' rights, yadda yadda) and shoving the guvmint into every nook, cranny and orifice it don't belong in:

Stop this wanton expansion!

Date: 2009/05/11 08:38:26, Link
Author: Amadan
Doktor Ben Addresses His Intellectual Peers

   
Quote
Ben Stein - accomplished scholar, attorney, writer and actor who attended Yale Law School — delivered a message of creationism, patriotism and value for humanity to graduates and their families on Saturday, May 9, at Williams Stadium.


Surely they were referring to Expelled's impassioned discussion of patriotism and value for humanity, and how they are despised by the Jew-killing scientists? Because Expelled is about Intelligent Design - y'know, science, not, ah, what'sitcalledagain ... oh yeah creationism.

Umm,, no:

   
Quote
He spoke extensively about his work on “Expelled: No Intelligence Allowed,” a documentary exposing the flaws of Darwinism and showing how the scientific community discriminates against scholars who believe in creationism.




As my teenage kids say*

FAIL


* And just because I like to show their friends my prowess in disco dancing. What's not to like?

Date: 2009/05/11 10:50:00, Link
Author: Amadan
Who? The kid or the girlfriend?

Date: 2009/05/21 05:19:20, Link
Author: Amadan
Not really relevant to anything currently on AtBC, but this has been on my mind so much for the last day or 2.

Best summed up by the editorial in today's Irish Times.


Deeply disturbing.

Date: 2009/05/29 08:18:41, Link
Author: Amadan
Quote
I have a laser cutting and engraving machine - just upload a pic of jesus and insert bread to produce lovely burnt in images at high resolution.

We could do a whole loaf telling the life of jesus - with a special surprise satan slice slipped in.


You could publish it as a follow-up to this old Catholic standard:



Perhaps it should be called "Slice of the Ain'ts"

Date: 2009/06/25 06:57:17, Link
Author: Amadan
Here in Ireland we’re likely to spend the next few years coming to terms with the Ryan report on abuse of children by Catholic clerical orders. It makes for appalling reading. But what shocks me most is that these weren’t isolated Bad Apples. The abuse was a product of (in fact, integral to) a system, and the system was willingly accepted not just by the state and RC establishment, but also by the people who voted for the politicians and who went to church every Sunday.

We became Catholic Ireland because our national identity was Not-British, and Catholicism was Not-British. Any radical idealism there was in the independence movement was strangled in the messy compromise that we ended up with in 1921. The only group with the resources to provide health and education was the RCC, so the solidly middle-class types who took over government were delighted to hand them over. (Proper deference was of course shown to those who could afford private schools and private medicine.) The Poor (always capitalised – you inherit it like your surname) would always be with us, and the Brothers and the nuns would look after them. There was a constant undercurrent of suspicion that it could be very bad for the kids who were imprisoned for being Poor. But to doubt the system was to question the Church, and the Church was at the very centre of what it meant to be Irish.

So we rationalised the doubts away: it’s the best we can afford; they’re the Hard Cases and you can’t use kid gloves on them; a few belts didn’t do me any harm; the people in charge know best; the only alternative is Communism; the papers would be full of it if things were that bad. In short, classic accommodation of authoritarianism. I’d like to know how clerics and the religious orders rationalised it. Holy Catlick Oireland, Jansenism, ultramontanism and anti-modernism surely feature strongly, but I really don’t know.

Anyway, the point of this rant is to point out that certainties, particularly the smug ones, are authoritarianism’s best protection. And not just religious certainty: I get the same feeling reading the lynch mobs at Pharyngula sometimes. Dictatorships are always popular at the beginning, and the easiest way to replace one you're tired of is to install a new one.

Given the choice, trust the guy who admits he might be wrong.

Date: 2009/06/30 08:25:42, Link
Author: Amadan
Having a drink in your honour:

Date: 2009/07/01 04:50:29, Link
Author: Amadan
Waterloo?

Date: 2009/07/01 15:58:52, Link
Author: Amadan
How about this?

Date: 2009/07/27 06:13:32, Link
Author: Amadan
Quote (carlsonjok @ July 26 2009,13:05)


snip, snip, snip...

And, children, what does this tell us?  That an infinitely intelligent programmer/designer would impart very little, if any, CSI into the program. Thus rendering the product of this infinitely intelligent programmer/designer virtually indistinguishable from nature, operating freely.

QED

Omigod, I think the chimps have bashed out the whole of Macbeth!

A Conservation Law!!!

We deduce:

1. CSI is conserved as between the Diviner Designer and the Designed.

2. The less information content in the output, the more is retained in the source.

3. Conversely, the more concise the output, the greater the flow of CSI from Designer.

4. KairosHocus is evidence for for an infinitely intelligent Designer.

5. Scientific research is a conspiracy to drain the Designer of His CSI mojo in order to steal all the goodies for Evil Athiests.

You can help to stop this terrible evil NOW! Contributions are tax-deductible, too.

Date: 2009/07/27 13:02:25, Link
Author: Amadan
Hmmm. I really think we're on to something here.

A second conservation law:

The Intensity of Tard increases in proportion to the tightness of the corner into which it's painted.

Discuss

Date: 2009/07/27 19:33:47, Link
Author: Amadan
Quote
1 –> The simple metric of FSCI is based on thresholds that give us the ability to make a conclusion based on a topology of islands of function in a sea of non functional configs, and in the further context of sufficient information storage in the function that unaided random walk based search strategies and the like will be maximally unlikely to succeed in reaching shores of function

It took me a while, but I eventually figured out what he means:

Date: 2009/07/28 06:59:45, Link
Author: Amadan
Quote (sparc @ July 27 2009,22:03)
 
Quote (Amadan @ July 27 2009,19:33)
   
Quote
1 –> The simple metric of FSCI is based on thresholds that give us the ability to make a conclusion based on a topology of islands of function in a sea of non functional configs, and in the further context of sufficient information storage in the function that unaided random walk based search strategies and the like will be maximally unlikely to succeed in reaching shores of function

It took me a while, but I eventually figured out what he means:


Is it just me or does the island in the foreground lack FSCI.

It's for the Theistic Evolutionists.

Date: 2009/07/29 09:54:44, Link
Author: Amadan
Too good an opportunity to miss:

(From Thin Lizzy's Live and Dangerous Album, c 1978)

Phil Lynnott (in perfect Crumlin accent): "Annywun heyar goddany Oirish in dem?"

Crowd: [Roar]

P. L.: "Any'v da girls loik a bih moar Oirish in dem?"

Joes should just learn to let his inner rock-star out. He might even score the next time he visits Africa.


Edit: Splleing

Date: 2009/08/04 18:28:21, Link
Author: Amadan
Quote (Ptaylor @ Aug. 03 2009,20:51)
Can anyone suggest/provide a better timeline graphic for the Dust-up at UD corral item?

Can you be a bit more specific?

Date: 2009/08/04 18:39:50, Link
Author: Amadan
Oooooooh, that dust-up.

I posted this here on that merry night:




but it might be a bit subtle, given the rather small space provided by the timeline.

I'll see what I can do.

No LOLcats.

Date: 2009/08/04 19:08:03, Link
Author: Amadan
Oh, this kind of popped out this evening. Maybe it'll be of use somewhere:

Date: 2009/08/06 19:15:31, Link
Author: Amadan
Quote (Alan Fox @ Aug. 06 2009,14:08)
Here's the link for Professor Demsbski and the Explanatory Filter Débacle!

ETA:

Reinstating The Explanatory Filter

Please please give this yoke another run when cover that episode.

(Puts down Own Trumpet)

Date: 2009/08/07 09:13:20, Link
Author: Amadan
These might be useful somewhere:





I can resize them etc if needed.

Date: 2009/08/12 17:39:47, Link
Author: Amadan
Apropos nothing in particular, an alternative banner. For Sundays, maybe:

Date: 2009/08/13 09:08:52, Link
Author: Amadan
In fairness, the DDrr wasn't editing reviews of his book. IIRC he was disparaging someone else's views on ID and suggesting to onlookers that they wait for the coming opus max from the Texan Authority on Revealed Divinity.

Date: 2009/08/19 03:24:58, Link
Author: Amadan
Miller Light is what brings to mind that famous line about American beer:  "Someone has found a way to dilute water"

Date: 2009/08/25 05:10:34, Link
Author: Amadan

Date: 2009/08/25 06:30:47, Link
Author: Amadan

Date: 2009/08/26 14:32:29, Link
Author: Amadan
Behold My [Proposed] Works Ye Mighty and Despair!

Quote
But at the next Dover trial, as the body of peer-reviewed work supporting ID continues to grow (Marks and I have plenty in the pipeline, and there are other labs now getting into the act), it will no longer be possible for the next Judge Jones to dismiss ID for lack of peer-reviewed papers



Oh! Look!

Date: 2009/08/28 05:31:23, Link
Author: Amadan
You've clearly misunderterpretated the evidence.

Maybe Ddrr Bill will turn up as a surprise speaker here and explain why you're wrong.

Date: 2009/08/28 10:47:39, Link
Author: Amadan
Quote
Unveiling a recent discovery, a spokesman for the Liberty University/Bob Jones Joint Archaeological team said "Folks, I've got some good news and some bad news..."




Date: 2009/08/28 10:59:52, Link
Author: Amadan
I like these:

Quote
Shrewd Orthodontist fucks czar: Ow!
Frustration! Czech Dr who'd toss wok.

Date: 2009/08/28 16:29:43, Link
Author: Amadan
Far and away the best  proof that the Schläger baramin was unintelligently designed:

Date: 2009/08/31 05:56:31, Link
Author: Amadan
O la la...
A Snivly quotes some woo-addled god-botherers:

 
Quote
Relativity and quantum physics, which serve as the pillars of contemporary science, and more recently chaos theory, are now presenting us with a radically new physical view of the world in which positivistic, deterministic, and materialistic philosophies no longer have secure places. They present us with deeper, greater, and more mysterious aspects of nature.


Deferring to the people here who actually know about these things, but isn't the lesson to be drawn from all those .... ummm ... measurements 'n shit they do in relativity and quantum physics and chaos stuff that it looks pretty weird and unintuitive, but you'll never know anything useful about it unless you

(i)   don't factor in tooth fairies or Unknowable Secrets (no positivism here, nossir)
(ii)  assume that what you see is governed by one or more consistenly acting processes (determinism, anyone?)
(iii) can rely on the same evidence that the next fellow can (and our friend Materialism takes a bow).

Tard.

Date: 2009/09/02 05:22:55, Link
Author: Amadan
Oh my Designer, the game is up!
Quote
Equally startling is that these genes were discovered in what had been considered “junk” DNA, non-functioning strings of repetitive DNA that do not seem to do anything.
[...]
Scientists have long assumed new genes could only evolve from duplicated or rearranged versions of preexisting genes, passed on by our ancestors, Dr McLysaght said. But then scientists began to discover a very few novel genes in species such as flies and yeasts that arose from apparently inactive junk DNA.


I, for one, welcome our new junk DNA overlords.

Date: 2009/09/02 09:07:35, Link
Author: Amadan

Date: 2009/09/03 08:45:53, Link
Author: Amadan
I read that a British dance company are staging a work inspired by Darwin’s junket to the Galapagos  – video clip  here.

I have no doubt that all here share my indignation at the unfairness of this. Discussion of evolution should be balanced, preferably with grainy clips of goose-stepping Sturmabteilungen, indignantly-read scripture, and lascivious close-ups of Sarah Palin’s big, firm, round, graspable, motherly spectacles. But this we cannot do, given the meagre resources left after meeting our commitments to godless depravity and corruption of the vulnerable.

In lieu of this, and as a token of the esteem in which we all hold the folks at UD, I propose we write an operetta for them.  I give below my unworthy preliminary sketches and invite fellow misfits, nitwits and nincompoops here to add to it as they may.

I need hardly emphasise the importance of this. Without attention, ID would surely wither away and die. And then where would we be?


Yeomen of the God – A One-Note Operetta

Overture, conducted by a handsome young man in a frilly shirt

Necessarily similar to, but by no means plagiarised from, La Gaza Ladra ("The Quotemining Magpie") by Rossini)

SCENE 1

Chorus of HebrewJudeo-Christian Slaves

    Our great country’s becoming a pain in the ass
    Since they ripped out the Bible from Biology class
    Our existence is teetering on the ledge
    What we need is a strategy document called the Wedge.
    Then those libruls will get what was always their due
    And the White House will always be Red and never Blue.
    And if high-tech all moves to some foreign land
    It won’t matter ‘cause soon the Rapture will be at hand
    Let’s pray, let’s pray
    That the Rapture comes soon!
    Let’s pray, let’s pray
    That the Rapture comes soon!

[Enter Guillermo, a genius]
    I found a watch, it’s not my own, but I’ll appropriate it,
    If someone says it’s Paley’s, he’ll be excommunicated!
    It’s firmly sealed and how it works is purely hypothetical,
    But unimportant stuff like that is really just pathetical.
    This artefact no junkyard storm could possibly assemble
    And if you say Life’s not a watch, I’ll volubly dissemble.
    So by default, we must assume, Design must be Divine.
    This theory, which is all my own, is mine, I tell you, MINE!

[Enter Scrotus, Guillermo’s lackey]
    A hammer I hold o’er the heads of the herd
    Of sheep who attend to my Master’s each word.
    They soon figure out that an off-message bleat
    Will have them ejected right into the street,
    With a lump on their skull, right on top of their dome-o
    So they better remember that I am il uomo.

Scrotus: Master, do you love me?
Guillermo: Hush, fool! Do you espy that curiously shaven canine walking in a most peculiar way?
Scrotus: ‘Tis not a pooch, my lord, it is a Canooch.

[Enter Ritardella, a respectable, ummm, whatever...]
    They call me a journalist, some kind of journalist, though I can never tell why:
    My facts are selective, my grammar’s defective, my IQ would make Dave’s look high.
    I blog for homeschoolers and other such droolers, though nobody visits at all.
    I use first-class sources for all my discourses, like Fox and WorldNet and TownHall!
    I’ve written a book, with a similar kook, on the spiritual nature of mind –
    If you open my head, it’s reliably said, that there’s nothing at all you can find!

Scrotus: Master, tell me,  do you love me?
Guillermo: (Ignores Scrotus’s pleading) Ritardella, come to me.
Ritardella: Lose the fat kid first.

To Be Continued





Date: 2009/09/03 09:37:45, Link
Author: Amadan
Quote (damitall @ Sep. 03 2009,03:16)
  ... mind you, I do get  a bit sweaty hearing pretty women speaking with an Irish accent.


Like our dear Minister for Health?

Date: 2009/09/03 16:37:51, Link
Author: Amadan
Quote (paragwinn @ Sep. 03 2009,11:23)
Guillermo: Hush, fool! Do you espy that curiously shaven canine walking in a most peculiar way?
Scrotus: ‘Tis not a pooch, my lord, it is a Canooch.


*snorf*

But could you not get an autographed copy of this marvellous portrait?

Scene 2, in which we introduce the dastardly Don Ricardo, is gestating. Comic relief, in the form of the Rastafarian duo Tiki and his contradictory alter-ego Gem, follows in Scenes 3 to 17 (as well as a post-script and several intermezzi), leading up to the dramatic trial scene presided over by Sheriff Bangy and a jury of onlookers!

J-Dog, Sondheim forgives you. But not the other lazy shites here who thought I didn't mean what I said about everyone contributing. Even if only plot suggestions by PM, if you're feeling shy, like.

Date: 2009/09/08 12:27:11, Link
Author: Amadan
Quote (damitall @ Sep. 08 2009,04:09)
Well, I seem to have precipitated a TardTorrent from kf, by asking politely-framed questions at UD not specifically addressed to him.

Do I get a small prize?

This is what is known in rhetoric as the Montgolfier Principle:

 
Quote
The deeper the hole you dig yourself into, the more hot air you need to get out.

1st corollary: If hot air alone can't do it, throw logic, principles etc overboard

Date: 2009/09/09 10:32:37, Link
Author: Amadan
Interesting (but surely hopelessly biased) profile of Densye's best friend here.

Date: 2009/09/09 11:48:35, Link
Author: Amadan
Quote (socle @ Sep. 09 2009,11:17)
Dembski:
     
Quote
In case you missed this blog (and now that The Brites are no longer in existence):


http://satirizingscientism.blogspot.com

Yet another outlet for IDCists to dissipate their energy (as opposed to doing science):  A blog "satirizing scientism" that's about as funny as syphilis.

Mickey Mouse hasn't evolved???

HA!

Also, they don't have their own opera, which means Dembski must have a small, bent penis.

Date: 2009/09/14 08:47:37, Link
Author: Amadan
Quote
This is a classic evolutionary cunard.(sic)


... as evidenced by these typical materialists. Please note the slogan, which emphasises the [semi] pointlessness of faith-unimbued existence.




Acute paranoiacs Fox-watchers will note the name of the sixth liner at the bottom. This proves it's all part of a librul conspiracy.

Date: 2009/09/17 04:25:06, Link
Author: Amadan
The question, I have to ask with slightly more bewilderment than facetiousness, is whether biblical literalism is compatible with Christianity.

Conversely, (i.e. with swapped proportions of etc etc) is biblical non-literalism compatible with faith-based systems such as Pastafarianism, Hinduism or Connacht Rugby?

Edit to grammar fixing

Date: 2009/09/17 04:33:59, Link
Author: Amadan
Quote (KenGee @ Sep. 17 2009,03:54)
While Rugby is okay if you want to play a real game then Aussie Rules Football is the best. You can tell that because only the Irish will play us at it, and that’s only if we go easy on them.

Excuses....

Date: 2009/09/17 08:07:16, Link
Author: Amadan
DaveTard wasn't a fundie, but he could force a laugh out of me sometimes. Count that as a plea of mitigation.

And Dick to the Dawk was a masterpiece.

But otherwise, sadly, you're right. Brites was a shocking waste of electrons.

Date: 2009/09/17 10:16:30, Link
Author: Amadan
Quote
You will NOT see them denying teleology, instead they just stay silent and stick to whatever they can back up with science.   You won't see public claims of:

"Meteorology does not admit conscious anticipation of the future (ie consious forethought)..."

"Physics is a completely mindless process..."

"(Chemistry and the Brain) -- With all deference to religious people, the notion that humans were created in the image of God can be set aside."

"Astronomy rejects all supernatural phenomena and causations."

No.  No sir.   These kinds of public pronouncements are found only within--and are inherently part of-- EVOLUTION.  Evolution is incompatible with Christianity.


To phrase a coin, that's not even halibut.

Date: 2009/09/18 09:57:52, Link
Author: Amadan
Floyd, on a point of protocol, I’d point out that the purpose of a peanut gallery is to give Onlookers* a place to snicker comment on the interchanges of the dramatis personae of the main debate. Sophocles tends not to call on members of the chorus to debate with Oedipus the pros and cons of marriage. But as you wish.

The purpose of my remark, as I suspect you understand, is that your assertion is not even ‘not even wrong’.  Your statements about the contents of science textbooks indicate that you are not attempting to understand science but failing. They indicate that you do not even understand what those books are for.

Textbooks in meteorology, physics, “chemistry and the brain” or astronomy do not make the claims you list because they don’t need to. In fact, the claims you list are largely interchangeable as between the disciplines you mention. That is because science is generally concerned with empirical observations and with making logical inferences, deductions and predictions based on them. None of them states a teleological position for much the same reason that they avoid criticism of late mediaeval hairdressing. Have you encountered this idea of methodological naturalism? Regardless of whether you agree with its utility, do you understand what it means and why it is used?

The comments that I mocked in the peanut gallery suggest to me that you wouldn’t disapprove of methodological naturalism in physics or meteorology. Why do you require it in biology? Is there a distinction between biology and other sciences that demands a teleological dimension that is excluded from other disciplines? How do you know? And why is it binding upon us?

Your comments about the “incompatibility of Christianity and evolution” not only indicate that you fail to understand what evolution is, but also that your perception of Christianity is entirely idiosyncratic. Why that perception should have any bearing on the truth or falsity of the theory of evolution is quite simply beyond me.

* A comprehensive definition of this term is available from the Caribbean

Date: 2009/09/18 11:30:27, Link
Author: Amadan
Quote (George @ Sep. 18 2009,02:43)
Amadan is a gosh darn hypocrite who's going to burn in Hell-Fire for his sins!


Nope. I have been caressed by His farinaceous tendrils and am Saved:



I am, however, a hypocrite. You should not, though. That would be very wrong.

   
Quote
How can he be posting here in SuPPoRt of evilution when he doesn't even understand it himself!!1!!1!  Proof!? You want proof he doesn't understand evilution?  I'll give you proof!!1!

         
Quote
IDA would be marketing Ireland as the innovation island -- "like Einstein explaining his theory of evolution".

Mary Coughlan, Tanaiste of Ireland, 17th September, 2009

This published quote demonstrates that Irish people do not understand evilution.  

Amadan is Irish.  

Therefore Christianity and Evolution are incompatible. QED.


</FL>


To quote another eminent compatriot, Get in the Fookin sack

Mary Coughlan is a prize example of the defects that are foundational to our dear democracy: a social worker promoted beyond her ability in reward for loyalty and political connection. She's as thick as is compatible with respiration and personal hygiene.

In mitigation, I must point out that she can swear like a sailor with a toothache.

Date: 2009/09/18 14:26:07, Link
Author: Amadan
Floyd,

Is it premature to suggest that this discussion will not move beyond the position that "evolution" (however defined) is indeed incompatible with Christianity as you understand it, but that your understanding of Christianity is not shared by (a) theists who loiter in this forum* and (b) the large number of sects and religious leaders who have been cited and referred to by all and sundry?

Your four "incompatibilities" involve questions of theology and exegetics that are of no interest to many here who prefer to focus on science and mutual defamation. (They also raise issues of logic and rationality but frankly, mah deah, I don't give a damn, it's your religion, not mine). The emerging pattern in which someone points out that x is a Christian who does not reject evolutionary theory, simply leads to you sniping at their assertion or ignoring it. This will go nowhere unless all agree on a meaning of "Christianity". History suggests that may be difficult.

If you agree, we can then address your second point, namely, whether ID is science. That too, of course, involves questions of definitions, but I think there's rather more solid ground to go on there.

Do you agree?


* Mugging grannies, mostly

Date: 2009/09/21 07:22:58, Link
Author: Amadan
My favourite specimen was from a thread on Rapture Retards where they were discussing what they'd like to do in Heaven next week. One dweeb said he'd really like to ask Jesus for a light sabre.

Date: 2009/09/23 10:40:42, Link
Author: Amadan
Floyd, can you clarify something for me?

Your first incompatibility of "evolution"* and what you call Christianity claims that God is the required explanation for the origin of, well, everything. You cite Colossians 1:16, which suggests to me that in your view, God is the originator of all things seen and unseen, not just the earth, animals, plants, stars etc (Genesis) or Jesus (John).

Does this mean, in your view, that "Biblical Christianity" states that God creates all things even now? For example, I am looking at patterns created on a computer screen as I type this. Did God create those patterns? They weren't there a moment ago (gosh! there's another one!). And I had the distinct impression that some combination of me, Bill Gates, Michael Dell and the Electricity Supply Board were doing the creating. Am I wrong? If not, the reason you find incompatibility between "evolution" and your "Biblical Christianity" is because your "Biblical Christianity" is so ludicrously and selectively literal that no rational person would accept it.

Perhaps you'll say that, no, what God did was create all the matter and energy and the rest is down to Nature and human agency. If so, how does that make theistic evolution incompatible with the theory of evolution (as understood in non-YEC circles)? Is your God so small that he cannot direct evolution as he sees fit? Having created the universe, is he bound by laws of probability and the likes?

I have to say, Floyd, it truly looks like everyone is out of step but you. But maybe you'll set us right.


* Which for some reason known only to Floyd, takes in cosmology, geology, biochemistry, genetics, abiogenesis, and, quite possibly, bicycle maintenance

Edit: fixed footnote failure

Date: 2009/09/23 12:19:21, Link
Author: Amadan
Quack, you're being very unfair.

The Bible is perfect and literally true in all things. Except when it gets a bit metaphorical, or when there were copying errors. Fortunately, we have Floyd to tell us where these things are.

Date: 2009/09/24 12:02:06, Link
Author: Amadan
Separated at birth?

   

Someone please apply an explanatory filter.

Date: 2009/09/29 04:29:38, Link
Author: Amadan
Darwin was a nut case even before publishing his evil satanic work. It was inevitable that his son would die young - probably of shame and embarrassment - after his screwed-up father named him Annie. This proves that gay marriage is socialistic.

Further proof, if it were needed, that evolution is evil is in the fact that the evidence showing its falsity is visible only to true believing fundagelicals living in the USA.

Date: 2009/09/30 15:42:13, Link
Author: Amadan
We are fortunate indeed to be able to share these extracts from Dan Brown's new book, Faith and Flagella. Sadly, the pages are not all contiguous, but I'm sure that Onlookers will see what a thrilling, uplifting read it is.


 











Date: 2009/09/30 16:41:16, Link
Author: Amadan
Like, apart from being proof of Da Fludd?

Date: 2009/09/30 17:28:24, Link
Author: Amadan
The idea of doing a UD Dan Brown kind of bubbled up about a month ago but I left it to ferment. I was bored today trying to write an article on the Lisbon Treaty so I gave up and just threw it together over about 3 hours. Doing the book formatting took about 45 mins.

Date: 2009/09/30 18:07:59, Link
Author: Amadan
Quote (deadman_932 @ Sep. 30 2009,17:58)
I said "LOL" with characteristic modesty many times, Amadan. You are the KING (for a week)!

P.S. Watch out for richertahugs, he likes stealing the robes and crown -- he says they're his

Richard's attempts to disrobe me are a hazard I have learnt to live with.

Date: 2009/09/30 18:09:35, Link
Author: Amadan
Quote (Advocatus Diaboli @ Sep. 30 2009,17:58)
But was it a cucumber or something else in Denyse Canoochey's room? I need to know.


I guess you just happened to have that picture on your desktop, eh, Adv?

Yeah, right...

Date: 2009/09/30 18:27:03, Link
Author: Amadan
Floyd, if I was to produce a statement by a biologist to the effect that evolution was compatible with Christianity, how would you evaluate it against Mayr? Is Mayr correct because of his understanding of the nature of God (or Christianity, or any other religion, come to think of it)? Or is it because of his qualifications etc as an evolutionary biologist?

Is it relevant whether the 'pro-Christianity' statement is made in a textbook? If so, should it be in a school-level one, which gives only a broad description of evolution? An undergraduate one, which is typically more detailed, and likely to be much more clearly referenced? Or a specialist one, which is likely to be very detailed but focused on a narrow aspect of evolutionary biology?

Are web pages acceptable? There are lots of web pages that discuss the compatibility of Christianity and evolution. Many are written by biologists who are Christian, and some at least are written by Christian theologians who have studied biology.

In short, why is Mayr's opinion so privileged? Note that your answer has to address Mayr's special qualification, it can't just be a diatribe against evolution generally.

No, I didn't really think you'd answer.

Date: 2009/09/30 18:42:38, Link
Author: Amadan
Sorry Peter, typical bloody southerner forgetting about our dear northern cousins.

I'm deeply sorry for your plague of fluddies.



And you're very welcome to them.

Date: 2009/09/30 18:47:11, Link
Author: Amadan
Deadman, I think Peter was taking issue with my 'limited geography'* claim about fundies. Norn Iron has a slew of them.



* That's a Mormon joke.

Date: 2009/10/01 08:18:47, Link
Author: Amadan
Probably too many in-jokes. They'll get the Triceratops one, though.

Date: 2009/10/09 04:35:44, Link
Author: Amadan
Kliban says it best (again):

Date: 2009/10/09 05:47:54, Link
Author: Amadan
I've no doubt it's intended to complement Carter's prize as a comment on Bush/Cheney & co.  Sad, really. I sympathise with the sentiment, but I don't think Obama did anything like what you'd expect of someone who really deserves the prize. It would be simpler to institute the anti-Nobels.

Date: 2009/10/10 08:11:29, Link
Author: Amadan
Quote (Doc Bill @ Oct. 09 2009,14:13)
And, more importantly as this bears directly on Grand Canyon carving, once the planet was completely covered in water, how did it drain?

Easy when you know how:



Edit for speling

Date: 2009/10/10 13:42:44, Link
Author: Amadan
... and their hømies.





Date: 2009/10/10 19:02:32, Link
Author: Amadan
No, I don't think that's a fair comment. As far as I recall, Floyd's opinion is that the Fall introduced death of both the body and soul.

Which does nothing to account for Jesus' Y chromosome, but then again it's late. Oíche mhaith agus codladh sámh ó mBaile Átha Cliath

Date: 2009/10/11 11:11:22, Link
Author: Amadan
Quote (khan @ Oct. 11 2009,10:15)
 
Quote (Amadan @ Oct. 10 2009,14:42)
... and their hømies.


Congrats!

I must make clear that I understand - indeed, sympathise to an extent with - the opinion of those who consider that the word "hømies" may be insufficient in itself to justify this prestigious award.

In humility, I accept it in anticipation of snark yet to be delivered over the coming four years* week.



* @#&&&!! teleprompter

Date: 2009/10/12 05:43:32, Link
Author: Amadan
Quote (Reciprocating Bill @ Oct. 11 2009,19:13)
Quote (oldmanintheskydidntdoit @ Oct. 11 2009,16:24)
Or maybe "the designer" had hands?
Or it might have been done with tools and equipment.

This has all been worked out to a pathetic level of detail. And it's little hands AND little tweezers:

I. Biological causality reflects the operation of two basic, complimentary units: Thinks and Poofs. A Think is a mind-like, timeless-sizeless representation of a Thing. A Poof is a hand-like manipulation of matter-energy such that the appropriate Thing is physically instantiated. A Think without a Poof is incapable of interacting with matter/energy, is therefore undetectable, and hence remains a somewhat of a theoretical abstraction. Similarly, a Poof can arise IFF informed by at least one Think.

Given sufficient agentic and material resources, Thinks and Poofs give rise to Things. Balanced Think/Poof calculations give rise to testable empirical predictions arising from the combinatorial mathematics of Thing Theory.

II. Thinks and Poofs are initiated by units of pure intelligent agency known as Rodins*. At the current state of theoretical development the Rodin remains a placeholder concept that has yet to be given empirical grounding. It is unclear, for example, whether there is a single Rodin, two Rodins, or countless Rodins and, if there exist more than one Rodin, whether all Rodins give rise to equally efficacious Think/Poofs. It is also unclear whether multiple Rodins stand in cooperative, competitive, or other relationship to one another, whether Rodins borrow Thinks inferred from the Things originated by other Rodins, whether Rodins have degrees of omniscience, and so forth. However, we have every reason to believe that these questions can be given empirical formulation and resolved through an appropriate combination of laboratory and field investigation.

With the above limitations in mind, we may begin to sketch the moving parts of Intelligent Design, grounding it in a calculus of Rodins, Thinks, Poofs, and Things, and indeed begin to explore the operation of entities in any given instance of Intelligent Design.

IV. Intelligent Design may be said to have occurred when a Rodin gives rise to a Think or Thinks, which in turn invoke(s) a Poof or Poofs in order to originate a Thing.

Rodin-initiated Thinks are mind-like, agentic, timeless-sizeless representations. Poofs do the hand-like work of actually arranging matter/energy to conform to the specification of a given Think, giving rise to a Thing. A Rodin may "choose" to formulate a grand system of interlocking Thinks all apiece, yet implement such a Think-Structure imperceptibly over deep time by issuing Poofs only slowly and sequentially. Alternatively, a Think-Structure may give rise to thousands of simultaneous Poofs, yielding an (only apparently) saltational Thing Structure that instantaneously mirrors the underlying Think Structure. Biological Things that display Irreducible Complexity almost certainly issue from the latter sort of process: a single Rodin exerts its intrinsic intentionality to originates a complex biological Think Structure which is intern effected by means of multiple simultaneous, interlocking Poofs.

The reader may find it helpful to imagine countless little hands equipped with little minds - I call them "Behes" - issuing from a Rodin or Rodins, swarming over and grasping bits of matter-energy - say, base pairs in a DNA molecule - and manipulating them with special tweezers to form Irreducibly Complex Biological Things.

V. It should be clear from the above that a calculus of Rodins, Thinks, Poofs and a completed, empirical Thing Theory promises to dissolve some of the knottiest problems in biology today. For example, we may now confidently sketch the origins of life on earth: a Rodin or Rodins originated a complex Think-Structure that gave rise to both simultaneous and sequential Poofs that created the first biological Thing, detonating life on earth. All that remains is to supply the details.  

In the future we hope to infer the properties of agentic Rodin or Rodins themselves, by tracing Think-Poof-Thing pathways much as the electrodynamic properties of elementary particles may be inferred from the ephemeral trails left within a cloud chamber. We anticipate that the biology of the 22nd century will be characterized by Rodin simulations (e.g. of Rodin belief-desire), the computational modeling of Biological Think-Structures, the detection and deconstruction of Poof-efficacy at the Think-Thing interface, the simultaneous, coordinated operation of countless Behes, and eventually a completed Thing Theory. We may also confidently anticipate that a bankrupt Darwinism with truly be a "thing" of the past.

*Sculptor of The Thinker.

POTÆ!


(Post of the æon)

Quote
All that remains is to supply the details.  


Why?

Date: 2009/10/14 06:32:53, Link
Author: Amadan
It's time to move on to Floyd's second "debate" issue:
"ID-is-Science-so-let’s-teach-ID-in-Science-Classrooms"
As posed, this does not invoke consideration of US law and policy. Accordingly I consider American jurisprudence on the first amendment to the US constitution to be irrelevant to this debate. The Kitzmiller decision may be persuasive, but it is not conclusive here.

This issue can be addressed in two interrelated questions:
  • Is ID science?
  • Should ID be taught in science classrooms?
As to the first, some definition is essential. I take science to be concerned with three processes:
(1) the rational examination of nature by means of sensory observation,
(2) the application of logical processes to those observations, and
(3) the consequent production of ‘useful’ statements about nature.

The words ‘consequent’ and ‘useful’ are important here: those statements must be consistent with the observations  and previous ones (or account for the discrepancy), and must allow for a means of verifying or negating them by observational and logical means. In short, science requires methodological naturalism. This is the practice not because of some directive from On High: it’s because omission of any one or more of empiricism, logic or falsifiability leads to a negation of objectivity.

(Denizens of This Low Joint are aware I’m not a scientist, but I have to state it to comply with the court order. Those with suitably stained white coats are invited to correct the above if I’ve got anything wrong. As is Floyd.)

Q: Is ID science?
A: Not as proposed by anyone yet.

ID is a tripod with two legs, both flawed.

The first, proposed by Behe, is the idea of irreducible complexity. As I understand it, he argues that some biological phenomena comprise essential components that could not individually have had evolutionarily viable natures. Alternatively, if those elements were viable, it is improbable that they could have co-evolved so as to combine to produce the observed phenomenon.

This argument is undermined by process #2 above and refuted by process #3.  As to process #2, phenomena cited by Behe as being irreducibly complex (e.g. the bacterial flagellum and the human blood-clotting system) have been plausibly accounted for in ways that account for all observed evidence and that admit of falsification. Those accounts have not been falsified, and alternative accounts have not been found to be a priori invalid. As to process #3, the only way to maintain the ‘scientific’ status of a claim of irreducible complexity is to prohibit any examination of how the claim might be false. That is dogma, not science.

The second leg of the ID tripod is Dembski’s argument on grounds of probability. As I understand it, this argument is based on what has been shown to be a circular definition of the term ‘Complex Specified Information’. This is therefore refuted by process #2, which requires that statements derived from empirical observation follow the rules of logic. Dembski’s argument is also undermined by process #3: he persistently refuses to respond to critiques of his publications that point out fallacies and errors, rendering his conclusions about his ID inferences not ‘useful’.

That is why I conclude that ID as currently expounded  is not science, and I invite you to do likewise.

Q: Should ID be taught in science classrooms?
A: No.

School curricula are determined by decisions about utility, resources and children’s learning abilities, all in light of the principles intended to be served by the educational system in question. Science curricula at that level generally aim to acquaint students with the main established ideas and techniques of the relevant disciplines. Speculation and ideology are not taught.  My own experience as a student and parent persuades me that that approach is adequate and appropriate.

Behe’s and Dembski’s formulation of ID is not science. In terms of utility, what benefit is there in holding out logically flawed arguments as forming part of science? In terms of resources, what additional benefit does ID offer over the part of science that it would displace in the curriculum? In terms of children’s learning abilities, how should students be taught to equate unsupported hypotheses with supported ones? And why? What principle is served?

It is conceivable that ID could be formulated and tested as a scientific concept. It would be remarkable if someone could invent a reliable method of identifying purposive design. It would be transformational if that technique were to show purposive design in naturally occurring life-forms. That would definitely warrant a place in school science curricula. But it hasn’t happened yet.

I have excluded from my argument any examination of the history of how ID came to its present condition. Personally, I find that history to be a very persuasive argument against teaching ID in schools, but that alone shouldn’t sway this debate.

Apologies for a very long post. Over to you, Floyd.

Date: 2009/10/14 07:41:26, Link
Author: Amadan
Quote (Schroedinger's Dog @ Oct. 14 2009,07:31)
   
Quote
"This isn't really, and never has been a debate about science. It's about religion and philosophypolitics and power."


Philip E. Johnson*, about the ID movement.

Therefore, the next part of the debate is useless, except if everyone here enjoys Yodel Elf's stupidity as much as I do...





*Just writing the name makes me want to hurl...

Fixed that for you.

PS: Those wanting to hurl should learn the basics here. You just might be the man to help knock Kilkenny of their perch, y'know.

Date: 2009/10/14 09:20:14, Link
Author: Amadan
Quote (Reciprocating Bill @ Oct. 14 2009,08:23)

wMad sounds like a frustrated SF writer.

Hmmmmm. Now there's an idea...

Date: 2009/10/16 08:38:16, Link
Author: Amadan
The "European Council" is not the Council of Europe, which is the author of the cited document. The CoE is an institution under the European Convention on Human Rights.


The European Council is the executive branch of the EU, as foretold in Scripture.

(To quote the Daily Mail: "First they came for the curvy bananas, then for the pint glasses, and finally for your soul")

Date: 2009/10/18 15:59:16, Link
Author: Amadan
I nearly posted something about a Floydian slip but I have standards.

dnmlthr: Your avatar illustrates the practice of ducking into a crocodile. Have you notified Kirk Cameron?

Date: 2009/10/18 19:19:29, Link
Author: Amadan
My hypothesis, which is mine*, is that puns are the the literary and rhetorical counterpart of flatulence. The pressure to release them is bearable in inverse proportion to the social acceptability of doing so, and the pleasure in their delivery is measured by the distress caused to persons upon whom they are inflicted.

(Ok. I'll get Louis's coat...)



* and it is mine too

Date: 2009/10/19 17:45:43, Link
Author: Amadan
Quote (Zachriel @ Oct. 19 2009,14:17)
 
Quote (Lou FCD @ Oct. 19 2009,14:06)
   
Quote (Zachriel @ Oct. 19 2009,14:57)
The function of the hole is to fit and support the puddle "staggeringly well."

Oddly, after reading that, I was about to use the word "staggeringly" as well, though in a slightly different context.

"Staggering well" does seem like an oxymoron.

I have treasured this clipping for years, knowing that this moment would someday arrive:

Date: 2009/10/20 04:10:21, Link
Author: Amadan
Quote (FloydLee @ Oct. 20 2009,02:07)
       
Quote
That says that God caused life to exist.

Which makes God the required explanation for the origin of life, which constitutes "the beginnings of biological evolution" (William Schopf).  
Which then re-affrims a huge Incompatibility with evolution, because it clearly "no longer requires God as creator or designer." (Ernst Mayr).
                 
Quote
Post-Darwinian evolutionary theory, which can explain the emergence of the first bacteria, doesn't even leave much room for a deist God whose minimal role might have been to flick the first switch.

---Slate editor Jacob Weisberg, 8-10-2005

                 
Quote
Evolution is God's redundancy notice, his pink slip.

---Richard Dawkins, Wall Street Journal, Sept. 10, 2009.

You are evading the point that has been made time after time here.

To use an analogy that is showing friction burns (if only on one side): if God made the universe "directly" (including water), then describing emergent properties of the matter and energy in it ("water runs downwards in response to gravity ") is not incompatible God's proclaimed status as Creator. Science describes biological evolution as an emergent property of living things. It also hypothesises that life is an emergent property of matter and energy under particular conditions. The contingency is upon the creation of the universe by God, not upon properties that God gave the universe, which, as I understand Christian teaching, God intends us to use reason and our senses to explore.  

Your naïve literalism is what is incompatible with Christianity. I suspect you realise this, and that that is why you evade questions that point out the absurd consequences of your arguments.

Date: 2009/10/20 04:16:38, Link
Author: Amadan
Quote (deadman_932 @ Oct. 19 2009,19:58)
P.S. Sorry, Amadan, I couldn't help myself. I promise never to steal from you again.

You are welcome to steal my overdraft or any of the bills I am currently ignoring.

Date: 2009/10/20 04:49:54, Link
Author: Amadan
PS Floyd: Please read Communion and Stewardship, by the Catholic Church's International Theological Commission (president at the time a certain Joseph Ratzinger). This addresses what you term "incompatibilities" between science and Christianity.

Date: 2009/10/20 05:16:19, Link
Author: Amadan
A great place to shop.

(Let it load and don't click anything)

Date: 2009/10/20 09:54:10, Link
Author: Amadan
Quote (FloydLee @ Oct. 20 2009,09:13)
 
Quote
Floyd, let it go.  No one cares.

Merely responding to Keelyn, Mr. D.  That's all.
Hey, would you be an agnostic like she is?  Or an atheist?  Gotta be something (other than Christian.)

That is just a distraction and you know it.

That Catholic Church has addressed evolutionary theory and found it compatible with Christianity:

here

here

I particularly like this one:

 
Quote
In modern times the theory of evolution has raised a special difficulty against the revealed doctrine about the creation of man as a being composed of soul and body. With their own methods, many natural scientists study the problem of the origin of human life on earth. Some maintain, contrary to other colleagues of theirs, not only the existence of a link between man and the ensemble of nature, but also his derivation from the higher animal species. This problem has occupied scientists since the last century and involves vast layers of public opinion.

The reply of the Magisterium was offered in the encyclical Humani Generis of Pius XII in 1950. In it we read: "The magisterium of the Church is not opposed to the theory of evolution being the object of investigation and discussion among experts. Here the theory of evolution is understood as an investigation of the origin of the human body from pre-existing living matter, for the Catholic faith obliges us to hold firmly that souls are created immediately by God..." (DS 3896).

It can therefore be said that, from the viewpoint of the doctrine of the faith, there are no difficulties in explaining the origin of man in regard to the body, by means of the theory of evolution. But it must be added that this hypothesis proposes only a probability, not a scientific certainty. However, the doctrine of faith invariably affirms that man's spiritual soul is created directly by God. According to the hypothesis mentioned, it is possible that the human body, following the order impressed by the Creator on the energies of life, could have been gradually prepared in the forms of antecedent living beings. However, the human soul, on which man's humanity definitively depends, cannot emerge from matter, since the soul is of a spiritual nature.


These statements (and there are others) are made with full appreciation of evolutionary theory: you have to credit them with a proper working knowledge of all its scientific ramifications. The situation is not equivalent to that of Dawkins opining (rather pig-headedly, in my view) about Christianity.

Can we move on from this mortally flogged horse now please?

Date: 2009/10/20 11:45:46, Link
Author: Amadan
Quote (FloydLee @ Oct. 20 2009,10:58)
 
Quote
However, the human soul, on which man's humanity definitively depends, cannot emerge from matter, since the soul is of a spiritual nature.

This sentence makes God a required explanation, absolutely for the origin of the first humans.  
Moreover, the theory of evolution, in which "God as creator or designer is no longer required" (Mayr), is NOT sufficient to produce humans after all.  

Which adds up to create an incompatibility between evolution (which gives God his pink slip, Dawkins said), and Christianity, of course 

This is true even for Catholic Christianity, as it turns out.  As you can see, they **always** re-affirm the First Incompatibility WRT human origins on Earth.



sigh

Fot the second time on the same bloody page, Floyd!

Catholic teaching on human origins, link in my post above

Quote
It can therefore be said that, from the viewpoint of the doctrine of the faith, there are no difficulties in explaining the origin of man in regard to the body, by means of the theory of evolution. But it must be added that this hypothesis proposes only a probability, not a scientific certainty. However, the doctrine of faith invariably affirms that man's spiritual soul is created directly by God. According to the hypothesis mentioned, it is possible that the human body, following the order impressed by the Creator on the energies of life, could have been gradually prepared in the forms of antecedent living beings. However, the human soul, on which man's humanity definitively depends, cannot emerge from matter, since the soul is of a spiritual nature.


There goes your first Incompetence Fallacy.

The (Christian) Catholic Church states that there is no incompatibility using the very text you use to suggest the opposite!

Drop it and move on the ID, Floyd. This is just pathetic.


Edit: Bloody Submit button has a mind of its own.

Date: 2009/10/20 12:59:14, Link
Author: Amadan
Floyd is no longer able to sustain arguments in support of his Five Flunktastic Fallacies.

Can we pleeeeeeease drop this and move on to ID?

Date: 2009/10/20 15:02:34, Link
Author: Amadan
Quote (FloydLee @ Oct. 20 2009,13:05)
 
Quote
Floyd is no longer able to sustain arguments in support of his Five Flunktastic Fallacies.

Just curious, Amadan:  what was your specific refutation to the Fourth and Fifth Incompatibilities?

On checking, I find that you have only raised four that I recall, Floyd: see here. Unless there's a super-secret double incompatibility somewhere.

Also, you forget that it has been pointed out that the compatibility of evolutionary theory and Christianity is not determined by your opinions. The fact that the Catholic Church is quite at ease with evolutionary theory refutes your claim without any need to consider your Five Four Flunktastic Freeform Failures. That you have your own private definition of Christianity is a credit to you. Please mind it carefully and above all else, don't give it to strangers who can't dispose of it safely.

Of course, it would be surprising if an institution like the Catholic Church, which is kinda involved in education n stuff,* hadn't thought about all that "made in the image of God" stuff in the light of a theory that has been at the heart of biology for 150 years. And oooooh look! There it is! The very one I linked to earlier which you never quite got around to reading! Well done Floyd.

And all that "death before the Fall" stuff. Hmmm. That's a stumper. Probably because nothing in Genesis says that there was no death before the Fall.

Nothing, Floyd.


Sorry.


If I said to you "Floyd, please don't jump off that cliff, if you do you will surely die", I'm afraid that your choice not to jump will not guarantee you immortality. Genesis says nothing about death in relation to animals and all the creepy-crawlies. That Paul thought otherwise is interesting, but, heck, that Paul guy? Whattadude... Really into slaves n stuff too.** That the RCC interprets what Paul means by "death" as being of the soul probably has something to do with the idea of Jesus conquering "death", which some (mortal) Christians seem to think is important.So presumably it doesn't refer to bodies.

Please give it up, Floyd. It's utterly wearisome. Your argument was stuffed long long ago. I realise you can't admit you even might be wrong, but please admit that you have failed to convince anyone here. Nobody: atheist, Christian, agnostic or None of the Above.



* Cue altarboy joke

** Speaking of which, any word from the SBC?

Date: 2009/10/20 16:51:42, Link
Author: Amadan
Quote (FloydLee @ Oct. 20 2009,15:42)
     
Quote
On checking, I find that you have only raised four that I recall, Floyd: see here. Unless there's a super-secret double incompatibility somewhere.

Hmmm.  You missed one; the fifth one.  Very big.

Evolutionist Jason Rosenhouse explains the Fifth Incompatibility:

       
Quote
Evolution by natural selection, you see, is an awful process. It is bloody, sadistic, and cruel.

It flouts every moral precept we humans hold dear. It recognizes only survival and gene propagation, and even on those rare occasions where you find altruism and non-selfishness you can be certain that blind self-interest is lurking somewhere behind the scenes.

All of this suffering, pain and misery, mind you, to reach a foreordained moment when self-awae creature finally appeared.

What theological purpose was served by all this bloodsport?

If humans were inevitable why didn't God simply fast-forward the tape himself, thereby sparing all of those animals that died horrible deaths in the preceding hundreds of millions of years?

       
Quote
Reconciling evolution and Christianity is not as simple as theistic evolutionists often try to pretend.

That's the fifth incompatibility.  Your refutation, Amadan?

You do realise that this is entirely irrelevant, don't you Floyd? Your 'incompatibilities' are secondary to your main argument that evolutionary theory is incompatible with Christianity, but we have found lots and lots of Christians who disagree and, to the extent that they consider your 'incompatibilities' relevant, dismiss your objections.

As the discussion of slavery indicates, Christianity wobbles from one interpretation to another as time and circumstances go by. That's the problem with patchwork scripture. You start off with a good creation story (or two), and someone goes and welds on a bit of tribal folklore here, rationalisation for stealing the neighbour's land or cattle there, your law-book onto that bit, a few poems over there, and after a while it looks like something from the Experimental Sculpture reject pile. That is why your attempt to constrain it to the bounds of your fallacies is ridiculous.

But seeing that you asked me for how I would reconcile the 'savagery' of evolutionary theory with the God of the Bible, here goes.

God seems to have no problem at all with wholesale death and mayhem. Gadarene swine get infected with Bad Fairies which promptly drive them off a cliff (and, being omniscient, God knew that would happen). No mention of compensation either. Try that to a farmer in the EU nowadays and you'll have traffic jams from one end of France to the other all summer long.

Not to mention God Himself condemning Himself to a verrry nasty death (which, despite His own request, he refused to prevent Himself from inflicting on Himself) to atone to Himself for sins committed by someone else (who, if we are to believe what we are told, didn't know right from wrong and so could not be said to have willed to offend God). Is that sadism or masochism? And does it make the Holy Spirit a voyeur? Mel Gibson could probably tell us.

Then there's all that slavery, rape and pillage in the Old Testament. Definitely one law for us, none for them. Marvellous example for the children, as my wife frequently says through clenched teeth.

The savagery to man and beast that is condoned or even ordered in the Bible is more than enough to make your last objection (like its dribbling siblings) completely otiose. I'm sure Jason Rosenhouse is great guy to have a beer with, but the death and destruction he refers to suggests that evolutionary 'savagery' deserves its very own book of the Bible. ("A reading from the Book of Evo: For God so loved Fred and Murgatroyd that he gave their sons haemophilia")

Now will you please accept that you have failed to persuade anyone to accept your argument and move on from this ridiculous game of nail-the-jelly-to-the-wall?

Date: 2009/10/21 08:58:54, Link
Author: Amadan
Drop all the new stuff, guys. It's not a debate about slavery. (More's the pity).

On to ID Floyd. Your case for teaching it as "science" in the classroom.












Floyd?

Date: 2009/10/21 10:51:39, Link
Author: Amadan
Oh dear. You miss the point again Floyd. Whether an incompatibility exists is irrelevant to this argument. You have conceded your main argument already.

The death we all see in nature occurs whether or not you attribute it to God, evolution, or the tooth fairy.

People who understand what evolutionary theory is about do not anthropomorphise evolution. It is not a person or a god. Maybe you missed that part of language comprehension. Evolution does not kill people or things.
Evolution, like all other scientific theories, has no moral content.

Death is a fact, it occurs whether or not you believe in God. Evolutionary theory seeks - in broad terms - to explain why some populations have members who breed fertile young before they die. In other words, it takes all that death as a given. And so, in general, does the Bible. Likewise, so do Christians (I'm excluding the ones on Rapture Ready who seem to know something the rest of us don't)

So we have all the trillions of deaths in the world every day (let's include bacteria etc).Humans do some of it, often through malevolence, neglect and error. God has certainly offed a few people in His time. But let's be kind to God and not blame him for the rest: we'll just put it down to the nature of the world. Nothing more natural than for a pensioner to drop dead.

Does evolution kill them? No, Floyd. Evolution is a description, not a moral actor. It has the same will and power to act as the colour blue. That is why the number of deaths in world history does not make it incompatible with Christianity.

Your attempt to hand-wave away God's cruelty in the Bible is both pathetic and irrelevant.

Get onto ID Floyd.

Date: 2009/10/21 10:58:21, Link
Author: Amadan
Quote (FloydLee @ Oct. 21 2009,10:15)
 
Quote
That says that God caused life to exist. It doesn't say what methods were used in doing so. It doesn't say what methods weren't used in doing so; specifically it doesn't rule out methods that some humans find offensive.

It does rule out evolution though.   Common descent too, btw.

Unless you're trying to say that evolution, which works strictly on material things, can produce an immaterial thing (the human soul.)  
Is that what you're claiming Henry?

Dammit! Floyd has found the Secret Chapter of the Descent of Man where Darwin says the soul is a product of Evolution!

Hmmm. Maybe the EAC Fiendish Plots Sub-Committee will find a way to silence Floyd before Banana Press publishes it.

How many signatures do we need to propose a motion for the next meeting?

Date: 2009/10/21 11:12:56, Link
Author: Amadan
Bullshit.

Weapons-grade ignorance.

Date: 2009/10/21 14:32:37, Link
Author: Amadan
Oh my sweet sainted guinea-pig Gertrude...

Not the first time this passage has been brought to your attention, Floyd:

Quote

It can therefore be said that, from the viewpoint of the doctrine of the faith, there are no difficulties in explaining the origin of man in regard to the body, by means of the theory of evolution. But it must be added that this hypothesis proposes only a probability, not a scientific certainty. However, the doctrine of faith invariably affirms that man's spiritual soul is created directly by God. According to the hypothesis mentioned, it is possible that the human body, following the order impressed by the Creator on the energies of life, could have been gradually prepared in the forms of antecedent living beings. However, the human soul, on which man's humanity definitively depends, cannot emerge from matter, since the soul is of a spiritual nature.


To put it in terms you might understand....

comes from

BUT

comes from

The Pope does not have a problem with evolution.

Get over it.

Date: 2009/10/21 15:38:44, Link
Author: Amadan
Floyd belongs to the Church of the Good Waitress.

The sacred scripture of that church can be found, bound and laminated in plastic, on the altars in its temple. Scripture clearly states "Ask the waitress for coffee and she'll be glad to get you some!"

Floyd opposes Bean Theory, which he says is incompatible with scripture. Bean Theory is proposed by a group known as Evidenciarists who maintain that coffee comes from dirt-grown objects called beans. Floyd tells us this is inconsistent with Scripture because the Waitress is a Good Waitress and would never inflict something on us that comes from a known source of flatulence. What's more, Bean Theory flies in the face of Scripture, which states it right there, plain as you like, that it's the Waitress who gives you coffee.

But Floyd's killer argument is the Proof by Sugar. Floyd likes two spoons of sugar in his coffee. The Waitress knows this, and he get sugar every time. It is an essential part of his coffee.

Floyd is explaining the errors of Bean Theory to the Pope.

Pope: "You know Floyd, I think the Evidenciarists might have got you there. They've got beans in the lab, they've detected caffeine in them, and they've dug up lots of ground up stuff that looks almost certainly to be old coffee-bean remains."

Floyd: "Doesn't matter. Coffee has sugar, right?"

Pope: "Well, I have to admit, I like a spoon in mine."

Floyd: "Bean Theory is incompatible with Scripture, Popey! Sugar doesn't come from beans!"



   
Quote (deadman_932 @ Oct. 21 2009,14:58)
I think you're right about the Floyd avoi-dance, Ogre.



Deadman: The word you're looking for is afloydance

Date: 2009/10/21 15:55:05, Link
Author: Amadan
Apropos nothing, it is said of WB Yeats that his party trick was to challenge people to find a word that rhymed with 'mahogany'. Nobody could.

Eventually however, in the lost bogs of Sligo, Seánie Pádraig Bán Óg Mac Giollaeaspaig pondered and slowly recited

My new chest of drawers is mahogany
And I polish it with Eau de Cologany

Date: 2009/10/21 16:26:08, Link
Author: Amadan
Leave it, folks. Floyd is just exhuming points that were disposed of before. His Five Frilly Failures are irrelevant.

Catholicism is unequivocally supportive of evolutionary theory. This has been made clear in this thread at least three times by me and many more times by others. (The fact that the RCC requires a divine origin for the soul is not a problem for them or evolutionary theory because evolutionary theory, like the rest of science and EU Council Regulation 1786/2003 on the common organisation of the market in dried fodder, is silent on the question of souls)

Whether Floyd's Frilly Failures matter to Catholics or anyone else is of no importance. Don't feed the troll.

Date: 2009/10/21 16:54:16, Link
Author: Amadan
Quote (FloydLee @ Oct. 21 2009,16:42)
 
Quote
Actually, Floyd, instead of an irrelevant and incorrect screed about Darwin and Hitler, I was hoping to find out more about your description of Holocaust victims as pests.

I figured that you would try to change the subject quickly, once I started talking about historical and ideological connections between your pet evolution belief and the Holocaust itself.  Confirmed.  


Troll-bait. Quit veering off topic, Floyd.


Quote
And of course, YOU want no part of exploring evolution's denial of the Image-Of-God-Thesis as a potential source of denying human dignity and ultimately supporting genocide.


Correct, WE don't want to explore it because

1. we have already established that Christianity is compatible with evolutionary theory

2. We have already gone down the image-of-God lane hand in hand with the Pope and come back up smiling

3. You are making a tendentious and inflammatory argument that is patently intended to spare you fulfilling your promise to argue in favour of teaching ID in science classrooms.

Get on with ID, Floyd.

Date: 2009/10/21 17:01:34, Link
Author: Amadan
If he is, he is surely the Moe of Poes.

(Moe is their leader.)



eta :@£* submit button....

Date: 2009/10/21 17:11:56, Link
Author: Amadan
Quote (FloydLee @ Oct. 21 2009,17:07)
Quote
Troll-bait. Quit veering off topic, Floyd.


At this point you guys are no longer making rational sense.  

Reading comprehension zero, just talking stupid and arrogant really.  
(Am I including you?  Yep, you too.)

Sorry Floyd, not biting.

Get on to ID, Floyd.

Date: 2009/10/21 17:48:55, Link
Author: Amadan
Quote (deadman_932 @ Oct. 21 2009,17:25)
Quote (Schroedinger's Dog @ Oct. 21 2009,17:20)
 
Quote (improvius @ Oct. 22 2009,00:15)
 
Quote (deadman_932 @ Oct. 21 2009,18:08)
Shocking as it may seem, I think he's as real as Dave Hawkins, although (also shockingly) even dumber.

I guess that's the most puzzling aspect for me.  I never would have believed that AFDave's absurdity could be topped without intentionally doing so.

yeah, I think deadman deserves some kind of award for bringing this chew-toy in...

I SAID I WAS SORRY!*

*Please don't let it be "a go at Arden," or "dress Louis for Halloween." I've suffered enough.

Worse.

You shall listen to Schroedinger's Dog's entire metal collection.


Bwaha ha ha hajesuswhydoibother

Date: 2009/10/21 18:32:00, Link
Author: Amadan
Quote (FloydLee @ Oct. 21 2009,18:11)
 On Sunday, I'll go ahead and write my final summary of "Evolution is Incompatible With Christianity" ...



Why, Floyd? You have already conceded that Catholics are Christian. The Catholic Church has expressly stated that it doesn't disapprove of evolution. You are attempting to reopen an argument you have conceded.

Better luck with ID, Floyd.

Date: 2009/10/21 18:57:08, Link
Author: Amadan
No photoshopping required!

Date: 2009/10/22 10:00:43, Link
Author: Amadan
Has anyone here ever heard of a theory of evolution "...that insist[s] that the soul is a product of naturalist development"?

Me neither.

Date: 2009/10/26 09:18:46, Link
Author: Amadan
I don't think it's quite that. Remember that, at its basic level, the YEC cult is part of a simplistic, anti-intellectual and paternalistic group identity. The dynamic works as long as members remained focused on the next life (or a fantasy apotheosis in this life where Jeebus comes and We watch the Others get skewered)  rather than the complicated, messy realities of this one. A form of emotional coercion, whereby you stick with Received Wisdom or face exclusion and damnation, keeps them doing just that. It is a very shallow faith that is easily threatened when (as with Floyd here) it is questioned by outsiders.

As far as I can see, "evolution" (like "socialism" or "atheism") is just a place-holder term for stuff that threatens that group identity. Because they are Wrong, it isn't important to examine the truth of their claims (or non-claims, in the case of atheism).

I suspect that Floyd sees Catholics as not-quite Christians, but can't trust his ability to handle the theological and doctrinal side of the argument, hence his concession (which pretty much punctured the rest of his argument). To be consistent, Floyd should have stuck to the approach that his version of Christianity is the only correct one. But I think Floyd has academic pretensions, as well as being an attention whore.

Date: 2009/10/26 12:24:37, Link
Author: Amadan
Quote (OgreMkV @ Oct. 26 2009,11:22)
     
Quote (deadman_932 @ Oct. 26 2009,09:41)
Frank Zappa once observed that the symbology of being punished for eating fruits of the tree of knowledge of life and death indicated a profound anti-intellectualism at the core, yet to have real power in this world, information is an absolute necessity.  

I would disagree with this part of the statement.  I guess it depends on how you define power.  

In terms of political power, intelligence appears to be not required, perhaps even selected against.  It seems to me that the smart people are off busy with things that are important, like saving lives and keep aircraft in the air.  While politicians (and lawyers for that matter) sit around and ignore the reams of data that shows their pet ideology is stupid.  Instead they create false dichotomies to convince people that their very lives are at stake unless they follow the 'leader'.  


I disagree. I often work with politicians and many of them are very very intelligent. I suspect you're conflating intelligence with academic eminence.

And lay off the lawyers or I'll sue you in the Admiralty Courts, from which nobody has ever emerged alive, sane or solvent.

   
Quote


The smart people keep saying, 'look you idiots...', but unless the smart people are willing to try for political power, we will always have the least intelligent people as leaders... some with access to squadrons of fighter-bombers and nuclear weapons.


Politicians are aware that Adam Smith's notion of the rational actor as the basis for economics is utter crap. Many, if not most decisions, are taken on non-rational grounds and only rationalised after the fact. That is particularly true for voting, where perceptions of identity, affirmation and such like are powerful influences (even determinants). And clever politicians, who want to get and keep power, use this. So they talk dumb just like we does, and they manipulate our fears because we like them to.If there is a demand for intelligent discussion of policy someone will eventually spot the gap and sell to it. But don't underestimate the irrationality of politics, or the intelligence of (most of) those who play the game.

   
Quote
Consider monetary power.  There are few smart people that are really wealthy.  (Bill Gates does NOT count.)  Again, the smart people seem to just want to do their thing.  The unethical take advantage of smart people (and the system) to gain monetary power... and do whatever they have to to keep that power.


Not wishing to be completely cynical, but was it ever different?
(I pause to savour the moment while the terms 'Microsoft' and 'ethical' compete for the same space in my brain)


   
Quote
Unless the smart people want to pull an Atlas Shrugged (and I'm not saying that's a bad plan), the smart people will have to step up into the political and monetary arenas and fight to keep things even reasonable.  I mean, you really ought to see what these idiots are trying to do in Texas.  Our "history expert" hired by the school board at great expense doesn't even know where Rosa Parks made her stand (as it where).


The thing I always loved about the notion of 'Going Galt' is that you would have to enforce trade-union style discipline if you wanted to stop an enterprising free-market blackleg Galt stepping in to take your place at a discount. Ironic, much?

Date: 2009/10/26 13:24:19, Link
Author: Amadan
A teacher in my son's school does the Irish-language voice-over for one of the Power Rangers.

Is that kewel or whah?

Date: 2009/10/26 15:42:08, Link
Author: Amadan
It may have escaped your attention, Floyd, but your literalist position is one held by a very small minority of Christians. Or are they not Christians, Floyd? (It is also one that you hold only when it suits you, as previous discussion on this thread shows.) In any event, it it hardly incumbent on them to justify their position to you: the fact is that you are the one advocating the unconventional opinion, and you, not they, should justify the break with mainstream Christianity. (I believe they call that heresy in some circles. Just saying.)

The only worthwhile thing to come out of this thread (apart from Lou's pictures) is the clear picture of the coronation of ignorance that would follow from permitting positions such as yours to be taught as science.

Date: 2009/10/28 08:34:03, Link
Author: Amadan
In fairness to Floyd, he at least hasn't sold out.

Date: 2009/10/28 13:19:47, Link
Author: Amadan
Why are we wasting synapse time on exegetics? The purpose of this thread is to discuss

1. whether Christianity is compatible with evolution: that discussion was settled when it was demonstrated that the RCC (which is representative for these purposes of mainstream Christianity) is perfectly happy with evolution. Floyd, in conceding that the RCC is Christian, conceded this point;

2. whether ID should be taught as science in school classrooms: echoing silence.

The last ten pages or so have simply demonstrated that Floyd clings to a biblical literalism that has been discarded as naïve or erroneous by mainstream Christianity. Quelle surprise! Floyd is a YEC.

Can we drop the bible battles and get on to ID please?

Date: 2009/10/28 13:32:15, Link
Author: Amadan
Floyd, to reiterate:

Your Five 'incompatibilities' are irrelevant. They became irrelevant to this discussion when you conceded that Catholicism, which accepts evolution, is nevertheless still Christian.

(They are irrelevant in a wider sense because the points you raise in them have been addressed by Christians who have approached the question of Christians' attitude to science with far greater intelligence and depth of understanding that you have shown here. But your concession on the RCC makes that moot here).

Whether Genesis is factual, myth or metaphor is of no consequence anywhere outside the Southern Baptist Convention. If you want to run away shouting that you've won, please do. But sometime when you reflect on this thread, consider whether you have been a persuasive example of Christianity or of the purpose of science education. And when you refer to your great victory, don't forget to link back here so others can see the devastating clarity and the unimpeachable integrity of your arguments.

Date: 2009/10/29 06:23:49, Link
Author: Amadan
Quack, I like your new avatar. A relation of yours?

Date: 2009/10/29 08:48:25, Link
Author: Amadan
Which of the High Priests* of UD will be first to denounce this?

There's scope here for a game of CreoBingo. Your word list:

       
Quote
NPR     socialism     atheist     darwinian     agenda     orthodoxy     Nebraska Man

Flintstones Documentary     My book     pleonasticprotolatching     feticide

just a knee joint     were you there?     genetic entropy     liberal professor     cucumber

cabal     COLB     Fox     Lucy the chimp     both sides     Goebbels     singin' in the cotton fields




* Interestingly, in Irish, 'the high priest' is rendered an tArd Sagart. Imagine that.

Date: 2009/10/29 10:28:48, Link
Author: Amadan
Ah, some balance from NPR: Densye will be reassured: Babyjeebus does haunt our heads after all:

Date: 2009/10/29 18:16:29, Link
Author: Amadan
I'm deeply disappointed that none of the regulars has been described as having a trans sister yet.

BTW, where is Arden these days?

Date: 2009/10/29 19:02:01, Link
Author: Amadan

Date: 2009/10/30 06:04:06, Link
Author: Amadan
Quote (didymos @ Oct. 30 2009,03:08)
Wow. Playing catch-up and, I can't believe that no one jumped on this bit he addressed to Robin (bolding mine):

   
Quote (FloydLee @ Oct. 29 2009,08:43)
(However, if she IS a Christian, why aren't you following her example and hooking up with Jesus?  You could always sign up with Him as a theistic evolutionist, you know.)


I know he answered directly later, but I still think this is pretty funny, especially with how he was still dragging his heels right after posting it. That was some nice self-pwnage there, Floyd.  Only topped by finally just answering the damned question.  

I'd also like Floyd to note that the phrase 'hooking up with Jesus' is probably ill-advised and best avoided in the future as it does not mean what he thinks it means.  Or maybe it does, which is just really way too fucking disturbing to contemplate...

Maybe Floyd and this lady could hook up.

I'd pay to see that.

Date: 2009/10/30 19:09:15, Link
Author: Amadan
Quote (FloydLee @ Oct. 30 2009,15:26)
And now.....let's specifically see why ID is science.


Amadan stirs from under sheaves of pages of scripture that have been tossed around pointlessly for weeks now. Can it really be the time? How will the world have changed after this Bible battle?

   
Quote
Here before you is a scientific (and scientifically falsifiable) ID hypothesis.  


Amadan blinks. Surely this must be . . .


   
Quote
Have you read Gonzalez's and Richards' book The Privileged Planet? It's an excellent book, and the film version of it was even shown at the Smithsonian Institution.  


Grooaaaaaannnnnnn . . .

   
Quote
It presents one variety of the Intelligent Design hypothesis that's known as the cosmological or "fine-tuning" ID hypothesis.  The fact that our universe, our galaxy, our solar system, our planet, our EVERYTHING, is so very finely tuned in dozens of ways, leads to a rational inference that our universe (including solar system, planet Earth, etc) is the product of intelligent design.


Correction, Floyd: It presents an unscientific hypothesis. Specifically, it is unscientific because it assumes that the conditions in which we on Earth find ourselves are improbably attuned to suit our existence. In doing so, they

 (a) assume their conclusion, namely that those conditions were designed; and
 (b) ignore the probability that nearly identical conditions exist (or have existed, or will exist) in the vastness of the Universe. In other words, they fail to apply Occam's Razor;
 ( c) fail to explain how they concluded that the conditions are improbable. With which universes did they compare our own?

   
Quote
And in their book, Gonzalez and Richards specifically write about how to Falsify their ID hypothesis.
       
Quote
The most decisive way to falsify our argument as a whole would be to find a distant and very different environment, which, while quite hostile to life, nevertheless offers a superior platform for making as many diverse scientific discoveries as does our local environment.

The opposite of this would have the same effect—finding an extremely habitable and inhabited place that was a lousy platform for observation.

Less devastating but still relevant, would be discoveries that contradict individual parts of our argument. Most such discoveries would also show that the conditions for habitability of complex life are much wider and more diverse than we claim.

For instance, discovering intelligent life inside a gas giant with an opaque atmosphere, near an X-ray emitting star in the Galactic center, or on a planet without a dark night would do it serious damage.

Or take a less extreme example. We suggested in Chapter 1 that conditions that produce perfect solar eclipses also contribute to the habitability of a planetary environment.

Thus, if intelligent extraterrestrial beings exist, they probably enjoy good to perfect solar eclipses.
However, if we find complex, intelligent, indigenous life on a planet without a largish natural satellite, this plank in our argument would collapse.

Our argument presupposes that all complex life, at least in this universe, will almost certainly be based on carbon.

Find a non-carbon based life form, and one of our presuppositions collapses. It’s clear that a number of discoveries would either directly or indirectly contradict our argument.

Similarly, there are future discoveries that would count in favor of it. Virtually any discovery in astrobiology is likely to bear on our argument one way or the other. If we find still more strict conditions that are important for habitability, this will strengthen our case.

---pages 314-315

So now, we clearly have a scientifically falsifiable ID hypothesis.   It can be falsified via observation.  This ID hypothesis is a scientific hypothesis.


To reiterate, it is not a scientific hypothesis because it assumes its conclusion and it makes a ludicrous assumption that similar conditions could not exist anywhere or at any time in the Universe.

Their proposed falsification is indeed empirical, but it does not prove or disprove design. It tests the proposition that life could never have, and never will, be observed elsewhere than originating from Earth.

   
Quote
In an Evolution News And Views article, Jay Richards and Jonathan Witt quote the above snippet from the Privileged Planet book, as well as offering clarifying comments on what terms like "testable" and "falsification" mean:
       
Quote
"Empirical testability" is the genus, of which falsification and confirmation are species. Something is empirically testable when it is either falsifiable, confirmable, or both.

http://www.evolutionnews.org/2006....ca.html  


***


I disagree. Logical propositions are falsifiable but need not be empirical. This statement is of no relevance to the question of whether ID is science.


   
Quote
"Science is all about what is testable, not necessarily what is naturalistic."  (chemist Dr. John Millam.)  Now you have good warrant for the claim "ID is science."


I call this the Sherlock Holmes approach: exclude the impossible and whatever remains, however improbable,  is the answer. It's useful in fiction when, like Conan Doyle, you create the universe of possibilities. Sadly, we are not in that position. We also cannot treat your Bible as the Manufacturer's Instructions either. So we have to fall back on logic, observation, and the working assumption that if you haven't found the answer, you'll find it if you keep looking. You base your hypotheses on the available evidence, but not on the assumption that there is no more evidence.

You have not justified treating ID as science, Floyd.

Date: 2009/10/30 19:37:58, Link
Author: Amadan
Jasper, you remind me of remarks that some Polish priest made about ID that got Dembski's knickers into a reef knot. As I recall, his point was that God as creator of the Universe was also the creator of the laws of logic, chance etc. I'm half a bottle into a rather good Rioja so I couldn't be arsed to look it up, but the point was that it is derogatory of God to suggest that His Ways can be fingerprinted by statistical finagling: God can act in ways that we perceive as random.

On the one hand, I was delighted to see Dembski get a dose of the Jesuits (my sons go/went to a Jesuit school and WOW are they good), but on the other it's sad that the argument is essentially the same as the Fastest Draw in the West ("Wanna see it? There it was, ya missed it")

Date: 2009/10/30 19:45:52, Link
Author: Amadan
Quote (Quack @ Oct. 30 2009,17:24)
Quote
If a Christian rejects the evolutionary history of life because it has involved unpredictable processes that could have resulted in a very different outcome, then those same Christians should also be required to reject all other scientific explanations that include unpredictable processes.

They ought at least thank God the Romans did not invent the guillotine...

It's fascinating to speculate on what might have happened if Roman culture had lost its reverence for Greece. Technologists in the army never rose above what we might call non-commissioned rank (decurion) but, if their unquestionable ability had been allowed to develop capital, we might have seen the Industrial Revolution 1000 years earlier.

We probably need a new thread for this. Bullshit Hypotheses: All Comers Welcome (Bring Your Own Bottle)

Date: 2009/10/30 20:21:03, Link
Author: Amadan
Quote (J-Dog @ Oct. 30 2009,19:43)
Suggestion:

5.  Put Floyd in closer touch with his proper soul-mate - Kent Hovind.


Kent is going to be incarcerated for only a few more months. Floyd is staring down the smoking-hot barrels of Eternity.

   
Quote
Floyd!  You're Going To Be A Starshes!

FTFY

Date: 2009/10/30 21:55:58, Link
Author: Amadan
Time for a song. Yiz can make up yer own tunes for it:



If I was a Bible-believer,
Which I'm not, thank the Lord, which I'm not;
I'd be quite overjoyed
That I wasn't like Floyd
Who, quite hypocritical,
Claims to be literal
Though he perfectly clearly is not.

If I was a Bible-believer,
Which Floyd claims to be, claims to be;
I'd write off the Flud
As a historical dud
And I'd say that the point
Was to chasten the joint
Though the thinking's too subtle for he.

If I was a Bible-believer,
I'd figure the point of the joke
Was to do unto others
And honour our mothers
And gener'ly be a good bloke.

If I was a Bible-believer
I surely would not be like Floyd.

Date: 2009/10/30 22:28:57, Link
Author: Amadan
Henry, it's a emotional argument that is intended to appeal to the gut, not reason. The purpose isn't to persuade. It's to reinforce the group identity.

Date: 2009/11/02 14:20:38, Link
Author: Amadan
Quote (FrankH @ Nov. 02 2009,13:58)
Now about ID:

What is the best evidence you have for ID?

Remember for ID to be a Theory, it must make predictions on its own and not rely on perceived flaws in something else.

Expect:

1. clouds of biblical squid ink as Floyd digresses to avoid discussing science

2. "select" quotations (or ahem near-quotations) about science or ID, but nothing that can't be described as vicarious argumentation.

This thread should be required reading for every vulnerable young mind tempted to sign up for Bible college.

Date: 2009/11/03 06:31:49, Link
Author: Amadan
Some Xtian Torture Pron admonitory guidance for Floyd.

Date: 2009/11/03 08:07:23, Link
Author: Amadan
Somehow, this report in today's NY Times didn't include a comment from their erstwhile star columnist who, you may recall, has some expertise in this area.

Just one of those random glitches, I'm sure.

Date: 2009/11/03 12:35:06, Link
Author: Amadan
Quote (CeilingCat @ Nov. 03 2009,06:34)
niwraD talks about ... science?      
Quote
About the infinite complexity Chaitin is correct. But the language of Chaitin is a bit misleading where he says that “God plays dice”. In reality also all apparently random results are wanted by God. Otherwise His will would be limited by dice and this is nonsense. Also randomness is under the governance of God. To deny this would mean to deny its Omnipotence, then deny the Total Possibility (which is another name for what theology calls God’s Omnipotence). From this point of view any result that appears random to us is simply an event which unique cause is directly God himself (the First Cause), while a result due to a physical law is an event wanted by the Laws-Giver too obviously, but by mean of an intermediary law (which works as secunda causa). So events divide in two sets: those wanted by God not compressible into laws and those wanted by God compressible into laws. After all there is no reason to believe that God should limit himself to the latter only.


ALL SCIENCE SO FAR!

Ah. Interesting to see this argument come up again.

As I mentioned recently on the FL peanut gallery thread, I last saw this being used by Fr Michael Heller, winner of the Templeton Prize in 2008 to rebut ID. This provoked something of a meltdown among the UD regulars (but not, as I suggested on the FL pg thread, Dembski, as I now see). Somehow I doubt that we'll see a similar reaction to the same argument being used to support ID: situational ethics and all that, don't ya know.

Ah yes, here it is. And here is the UD response. Comment 3 is priceless:

 
Quote
I just don’t get why professors at religious schools feel that they can dictate to scientists what exactly science is. They need to just stick to their knitting.


Quite

Date: 2009/11/03 18:52:16, Link
Author: Amadan


Overwhelming Evidence of Design

Date: 2009/11/03 18:56:19, Link
Author: Amadan
Quote (FloydLee @ Nov. 03 2009,17:46)
Now, I'm NOT arguing that "ID is science" based upon OEC Hugh Ross's writings.  That's absolutely clear, or I hope it is.  I'm strictly going by Gonzalez and Richard's cosmological ID hypothesis from "The Privileged Planet."

However, a classic laundry list by which a person might choose to infer cosmological design, happens to come from Ross.  Here are a few selections.  
 
Quote

strong nuclear force constant

if larger: no hydrogen; nuclei essential for life would be unstable

if smaller: no elements other than hydrogen

weak nuclear force constant

if larger: too much hydrogen converted to helium in big bang, hence too much heavy element material made by star burning; no expulsion of heavy elements from stars

if smaller: too little helium produced from big bang, hence too little heavy element material made by star burning; no expulsion of heavy elements from stars

gravitational force constant

if larger: stars would be too hot and would burn up quickly and unevenly

if smaller: stars would be so cool that nuclear fusion would not ignite, thus no heavy element production

electromagnetic force constant

if larger: insufficient chemical bonding; elements more massive than boron would be unstable to fission

if smaller: insufficient chemical bonding

ratio of electromagnetic force constant to gravitational force constant

if larger: no stars less than 1.4 solar masses, hence short and uneven stellar burning

if smaller: no stars more than 0.8 solar masses, hence no heavy element production

ratio of electron to proton mass

if larger: insufficient chemical bonding

if smaller: insufficient chemical bonding

ratio of number of protons to number of electrons

if larger: electromagnetism dominates gravity preventing galaxy, star, and planet formation

if smaller: electromagnetism dominates gravity preventing galaxy, star, and planet formation

expansion rate of the universe

if larger: no galaxy formation

if smaller: universe collapses prior to star formation

entropy level of the universe

if larger: no star condensation within the proto-galaxies

if smaller: no proto-galaxy formation

mass density of the universe

if larger: too much deuterium from big bang, hence stars burn too rapidly

if smaller: insufficient helium from big bang, hence too few heavy elements forming

average distance between galaxies

if larger: insufficient gas would be infused into our galaxy to sustain star formation for a long enough time

if smaller: the sun’s orbit would be too radically disturbed

galaxy cluster type

if too rich: galaxy collisions and mergers would disrupt solar orbit

if too sparse: insufficient infusion of gas to sustain star formation for a long enough time

average distance between stars

if larger: heavy element density too thin for rocky planets to form

if smaller: planetary orbits would become destabilized

fine structure constant (a number used to describe the fine structure splitting of spectral lines)

if larger: no stars more than 0.7 solar masses

if smaller: no stars less than 1.8 solar masses

if larger than 0.06: matter is unstable in large magnetic fields

decay rate of the proton

if greater: life would be exterminated by the release of radiation

if smaller: insufficient matter in the universe for life

12C to 16O nuclear energy level ratio

if larger: insufficient oxygen

if smaller: insufficient carbon

ground state energy level for 4He

if larger: insufficient carbon and oxygen

if smaller: insufficient carbon and oxygen

decay rate of 8Be

if slower: heavy element fusion would generate catastrophic explosions in all the stars

if faster: no element production beyond beryllium and, hence, no life chemistry possible

mass excess of the neutron over the proton

if greater: neutron decay would leave too few neutrons to form the heavy elements essential for life

if smaller: proton decay would cause all stars to rapidly collapse into neutron stars or black holes

polarity of the water molecule

if greater: heat of fusion and vaporization would be too great for life to exist

if smaller: heat of fusion and vaporization would be too small for life; liquid water would be too inferior of solvent for life chemistry to proceed; ice would not float, leading to a runaway freeze-up

supernovae eruptions

if too close: radiation would exterminate life on the planet

if too far: not enough heavy element ashes for the formation of rocky planets

if too infrequent: not enough heavy element ashes for the formation of rocky planets

if too frequent: life on the planet would be exterminated

if too soon: not enough heavy element ashes for the formation of rocky planets

if too late: life on the planet would be exterminated by radiation

white dwarf binaries

if too few: insufficient flourine produced for life chemistry to proceed

if too many: disruption of planetary orbits from stellar density; life on the planet would be exterminated

if too soon: not enough heavy elements made for efficient flourine production

if too late: flourine made too late for incorporation in protoplanet

---Hugh Ross, http://www.origins.org/articles/ross_evidencescosmos.html


Just food 4 thought, that's all.

FloydLee

Are you suggesting that these are improbable, Floyd?

Compared to what, precisely?

Date: 2009/11/03 19:02:17, Link
Author: Amadan
Oh, J-Dog, thank you for your Intelligent Design Verses. Truly laxative moving stuff.

Date: 2009/11/03 19:08:32, Link
Author: Amadan
Quote (Peter Henderson @ Nov. 03 2009,18:30)
According to AiG, there are a growing number of geologists who reject evolution:

http://blogs.answersingenesis.org/aroundt....e-point

 
Quote
Interestingly, Dr. Mortenson has a PhD in the history of geology and is thus aware that there are a growing number of geologists who reject evolution (e.g., Dr. Andrew Snelling of Answers in Genesis).

2
2
2
2
2
2


This growing number was brought to you by Truth in Creationism, an AiG company.

Date: 2009/11/04 02:40:55, Link
Author: Amadan
Quote (Henry J @ Nov. 03 2009,22:09)
 
Quote
Are you suggesting that these are improbable, Floyd?

Compared to what, precisely?

He seems to be saying that if things were different than they are, then any occupants of the universe would be different than us.

Henry

Az der bubbe vot gehat baytzim vot zie geven mein zayde, as Auntie Livnat used to say.

Date: 2009/11/04 11:26:33, Link
Author: Amadan
Quote (FloydLee @ Nov. 04 2009,10:51)
Refuted.


No Floyd, you supplied a rebuttal, and a pretty lame one too. A refutation addresses and overturns the opponent's argument, which you have not done.

   
Quote
 No evidence of any pre-assumptions in the book itself.  Their hypothesis starts with observations and data, not assumptions.


You yourself state their hypothesis (here) in these terms:

   
Quote
The fact that our universe, our galaxy, our solar system, our planet, our EVERYTHING, is so very finely tuned in dozens of ways, leads to a rational inference that our universe (including solar system, planet Earth, etc) is the product of intelligent design.


To state as a fact that our universe etc "is so very finely tuned" is a 'pre-assumption' (remember that word, Floyd?) that they were "finely tuned". Or do you have evidence that universes etc tend not to be like ours? Does that lead you believe that the conditions in ours (and not, of course, just in our little corner of it) reflect the intention of someone or something able to "fine-tune" those conditions? Why?

   
Quote
2.  "subjective."

Refuted.  Fine tuning cosmo and planetary situations have been empirically observed.  Many many times, btw.  
They're just going off what has been observed already, and were themselves careful to distinguish between well-observed phenomena, less-well-observed, reasonably theoretical, and speculative.


And in each such situation there is a natural explanation that can be traced back by empirical and logical means to the inferred conditions of the universe at its beginning. Why do you infer intention? Where's your evidence?

   
Quote
3.  "argumentum ad ignorantium."

Hardly.  We humans ARE astonishingly well-placed for the huge astronomical discoveries we make.  That's not ignorance, that's what we know scientifically.


Compared to a blind man in a coal shed, certainly. But on an astronomical scale, do we have a better-than-average view of things? Do you have any ideal of the scale of the Universe compared to our solar system, or even our Galaxy?

   
Quote
 Taken together with all the other fine tuning facts, one could rationally infer design instead of accident.


Why do you assume that the conditions you describe as "fine tuning" are improbable (i.e. unlikely to occur through simple action of natural forces)? What other universes have you been comparing our one to?

 
Quote
Check out this one little co-inky-dink, one of many:
         
Quote
"Thanks to its large, angular size, the Moon occults many stars along its path.  In this way, the Earth-Moon system acts like a giant telescope, allowing astronomers to resolve objects normally to small or close together to measure from the ground.

A slow angular speed of a moon across its host planet's sky, like our own, allows for more detailed measurements.  This method works best with a large moon without an atmosphere--which produces a crisp, knife-edge sharp edge on its limb--orbiting far from its host planet (but not too far, because the smaller a moon is, the fewer stars it occults over a month.) [

---pg 110


The same argument can be used to show that Ursa Major was designed to point to the North Star. Gimme a break.

   
Quote
No wonder Earth is called the privileged planet!!


Once again, compared to which other planets in which other solar systems?

Date: 2009/11/04 15:30:39, Link
Author: Amadan
Quote (Erasmus @ FCD,Nov. 04 2009,15:02)
what if "bollocks" are a form of life that doesn't require heavy metals?  

Well, I dunno, BUT

Heavy Metal is a form of life that requires this bollocks:

Date: 2009/11/05 06:42:58, Link
Author: Amadan
Quote (Robert Byers @ Nov. 05 2009,04:30)
Yet like in the Sherlock Holmes stories it matters who is Sherlock and who is scotland yard detectives. Both sincere seekers of the truth but one is wrong.
YEC is Sherlock Holmes.

Golly. I knew I'd heard that name recently.

But there are some undeniable similarities: Holmes was a notorious fiddler and came back from the dead thanks to the power of fiction.

A question for you, Robert: as a YEC, how do you distinguish between evidence for historical events and  evidence for miraculous ones?

Date: 2009/11/05 14:16:30, Link
Author: Amadan
Floyd, try to remember 99 pages ago when you entered this debate. Not Gonzales or any of his chums.

Are you able to (a) state and (b) defend your argument in your own words?

If not, why not just send over your big brother to do your fighting for you instead of holding up a picture of him and saying that he's so tough he's beaten us up without our even knowing it.

Date: 2009/11/05 17:05:53, Link
Author: Amadan
But ID isn't a mechanistic theory! Why would they need tools?

Aaaaaahhh. I seeeeee. It's the Hitachi WH12DAF2. That's the one you can use for wingnuts.

Date: 2009/11/05 19:14:23, Link
Author: Amadan
... which seems to imply that their point is about as significant as stating that life can only develop on round planets. Or have I missed something again?

Date: 2009/11/05 19:28:14, Link
Author: Amadan
Akshully, my astronomical magisterium* leads me to recall that our Sun, while dragging us around the Galaxy, runs through clouds of dust and gas that would greatly reduce the observable Universe (at least in most spectra). This would not affect the suitability of this Earth for life. Conversely, even without dust clouds etc, there are mind-buggering** amounts of the Universe that we simply can't observe. So why are any statements about observability from Here in any way meaningful in this context, let alone in terms of correlation with the possibility of us evolving as we [think we] have?



* Sufficient to give the kids a master-class in profanity while I fail to locate the Andromeda galaxy in my bottom-of-the-range scope.

** Thank you Douglas Adams. We miss you.

Date: 2009/11/06 13:13:09, Link
Author: Amadan
... having made it clear that, despite our despicable behaviour, you easily saw off our blinkered and bigoted arguments.

Date: 2009/11/06 13:34:01, Link
Author: Amadan
Quote (Chayanov @ Nov. 06 2009,13:12)
Quote
Look, I am a Catholic Christian and am busy and don’t know how the world is going to end.


So O'Leary has no interest or curiosity in either the past or the future. Blogging is probably a good place for her, where she can always live in the moment of the latest story, and never be concerned with what was or might be.

But she doesn't need to!

Quote
That is why I admire Dr Dembski’s work (though I imagine we differ on matters doctrinal!): by giving us logical proof of design, he has made it unnecessary to join the Darwinists in their foetid laboratories. Excelsior!




In fact, she's better off avoiding it.

Quote
But undirected speculation is, in my view, an occasion of sin. Origins research not conducted under appropriate guidance will inevitably lead to ungodly conclusions and is to be condemned and, as a political matter, discouraged.

Date: 2009/11/06 15:01:52, Link
Author: Amadan
Quote (Dr.GH @ Nov. 06 2009,14:42)
Arguments could be data, data could become arguments. Lovely.

There's a joke somewhere in there about Weasel. Sadly, my brain has knocked off for the weekend.

Please laugh anyway.

Date: 2009/11/07 11:20:16, Link
Author: Amadan
Quote (OgreMkV @ Nov. 07 2009,09:51)
Tell you what, call the Biology department at your local university and ask each Biologist there what their views on the fact of evolution is.  That ought to give you pretty good sample.

As a further exercise, ask them what their views on the theory of evolution are. Chances are, for every N biologists, you'll get N+1 opinions.

Date: 2009/11/09 14:54:47, Link
Author: Amadan
Quote (Henry J @ Nov. 09 2009,14:37)
Correction to my previous post:

It's almost as if they think that different branches of science are independent of each other.

Almost.

Date: 2009/11/10 16:37:06, Link
Author: Amadan

Date: 2009/11/11 06:46:10, Link
Author: Amadan
Especially for yooooooo

Date: 2009/11/12 03:36:40, Link
Author: Amadan
It's aliiiiiiiive!!!!

Date: 2009/11/16 03:11:22, Link
Author: Amadan
You are teddibbly, teddibbly kaynd.

My favourite moment during my brief (and long-since obliviated) career as UD's one-and-only resident atheist ID proponensist was this, in which I attempted to introduce a new popular meme to describe the movement.

For some reason it never really caught on.

Date: 2009/11/19 15:49:05, Link
Author: Amadan
Someone's got a present for you!



... and it has a special introduction too!

Hoppy Birdy.


PS "Dover Thrift Edition"? Is that all they could afford after Kitzmiller?

Date: 2009/11/21 20:25:29, Link
Author: Amadan
Hoopy Bjürdæ

and remember, you're only as old as you feel:

Date: 2009/11/22 14:17:41, Link
Author: Amadan
The End Is Nigh!

(It helps to have followed the three threads of this "paper's" gestation. Febble has won the Nobel Prize for Patience, as far as I'm concerned.)

Anyone with a kamikaze sock want to ask what The Great One thinks of it?

Date: 2009/11/23 06:05:37, Link
Author: Amadan
Grandad


says you don't need to eat so much after they put you out to grass.

He's like that some days.

Date: 2009/11/24 04:54:15, Link
Author: Amadan
Quote (Quack @ Nov. 24 2009,03:07)
A human will never give birth to anything but a human.


Ummmmmmm, Quack. . . .




. . . . are you sure?

Date: 2009/12/03 03:15:00, Link
Author: Amadan
Quote (Robert Byers @ Dec. 03 2009,01:54)
If your ideas can't take scrunity then they don't deserve hugh positiob .

... they'll just have to make to with his friend, Mr Jass.

(Thanks, J-Dog)

Date: 2009/12/03 04:56:05, Link
Author: Amadan
Quote (Robert Byers @ Dec. 03 2009,02:14)
People asking me for evidence. About what? If its my ideas on marsupials well i wrote an essay "Post Flood Marsupial Migration Explained" by Robert Byers. Just google.

Well Robert, that gives us evidence that you wrote an essay. I suppose that's a start.
               
Quote
In it i give the biblical and living/fossil evidence for why same shaped creatures are the same and not convergent evolution.

The pillars of science tremble! Let's have a look at your essay, shall we?

               
Quote
Science organizes them according to shared body structure attributes that they believe indicate a common origin for each group. It is the inner skeleton or biological workings that they say indicate relationships of mammals. Other then this they have no evidence of evolution.

So stratigraphy, environmental science, and biogeography have no bearing on the subject? Care to explain why? Of course, if they are irrelevant, you should be able explain why fossil marsupial are different from present-day ones, and why there aren't herds of wallabies roaming the Gobi desert.
             
Quote
It is all interpretation of what can be observed in living and fossil mammals.

Bing! Robert makes a (nearly) correct statement! (It's only nearly because you have to consider the environment as well as evidence from life forms other than mammals too.)

About convergent evolution, you say
             
Quote
The problem is that this is actually a definition masquerading as an explanation. Giving a phenomenon an evolutionary name does not explain the phenomenon.

Oh good. This must be where Robert is going to show us the "evidence".

           
Quote
The remarkable similarity of creatures in the fossil record (yet said to be unrelated orders) is better explained by saying that they are designed as the same creatures after all.

Have you ever seen a graviton, Robert? Me neither. So the reason why we don't float off into the sky is "better explained" by pixies pushing us down. Or am I wrong? No doubt you'll explain one way or the other.

         
Quote
There has been no “convergent evolution” on such a major and repeating scale but rather these animals with similar morphology are the same kind from the same pair off the Ark.

I'm sure you must be right - after all, you told us that you are. But can you explain why you think that having the "same morphology" mean that animals descend "from the same pair off the Ark"? Could there have been just a Mummy and Daddy marsupial on the Ark who, through a series of comic mishaps and thrilling adventures, arrived on Botany Bay? ("Disney's Pouch Tales, coming sooooon to a ...") Is it more or less likely that there is just a marsupial 'kind' that diversified into grazers, carnivores, etc etc, rather than mouse, dog etc 'kinds? Why do you say so?

         
Quote
After the migration from the Ark minor or micro-evolution by environmental influences brought relatively minor changes to the geographically separated descendents. These changes would of affected all the creatures in that area in the same way.


Wonderful place, Oz. Apart from waving your hands around, can you tell us what "environmental influences
" made all the wolves there turn placental? Will the same thing happen to rabbits? Or Kylie Minogue?* Please explain why.

 
Quote
Using the same line of reasoning, creationists can boldly say the Marsupial creatures of Australia are simply the same creatures as elsewhere on the earth now or in the past.

That's it????

Robert, you promised us evidence!! You just gave us a few assertions!

Where's the comparative anatomy? The DNA sequences? The embyology?

Robert, the ninth commandment is very clear.

Robert, why did you lie to us by saying that your essay provided evidence for your explanation?


               
Quote (Robert Byers @ Dec. 03 2009,02:14)
I am confident I'm right and believe classification sysems one day will correct themselves with or without my help.


Without, I'm sure. Because you are a liar and will go to Hell for it. Don't you believe in the Bible, Robert?

*Omigod, it's already started! From "Do the Locomotion":
    Come on baby, jump up, hmmm jump back
    Oh well I think you got the knack



ETA: Edited to complete after truly skilful premature pressing of Submit button. And to correct a few goofs.

Date: 2009/12/03 09:43:47, Link
Author: Amadan
Quote (OgreMkV @ Dec. 03 2009,08:05)
NOT KYLIE!??!?!?!  [sniffle]


You should be so lucky.

 
Quote
... explain why the "inner skeleton" is so very different between Tasmanian (marsupial) wolfs and North American (placental) wolfs...


Don't be ridiculous. They even spell it the same way as placental wolves!

Date: 2009/12/05 19:43:47, Link
Author: Amadan
I doubt any of you lot would even know who they are, but I have just enjoyed  Horslips playing an absolutely feckin dynamite gig (after the best part of 30 years or whatever) in the O2 here in Dublin. The best part was seeing an old college buddy (now expanded to spherical dimensions and an Eminent Barrister) going completely apeshit in the mosh pit (zimmer frames accommodated).

Thank you for letting me share that with yiz. If you never sweated like a pig in a parish hall while the lads belted out Dearg Doom, you never lived.

Date: 2009/12/13 07:21:06, Link
Author: Amadan
A birthday?

You can't be Sirius.

Date: 2009/12/17 08:46:09, Link
Author: Amadan
Quote (CeilingCat @ Dec. 17 2009,04:40)
   
Quote (Quack @ Dec. 17 2009,02:16)
     
Quote
Sometimes celebrity look-alikes are dead ringers for the celebrities. How does that happen? Mostly we take this phenomenon for granted, but how could it possibly be that someone more closely resembles Beyoncé than her own mother?

Guess they could use Robert on the staff.

That probably explains the so-called "common descent" we see in the fossils.  They were just celebrity fossil look-alikes.  Could fool anybody.



(Inverted to aid legibility while hanging from ceiling)

Date: 2009/12/17 09:17:46, Link
Author: Amadan
Alas! Time, money, latitude and longitude conspire against me.

But have a virtual drink on me

Date: 2009/12/17 09:20:22, Link
Author: Amadan
Robert, I look much more like my father than I look like my mother.

Am I more closely related to him than to her?

Date: 2009/12/21 14:26:43, Link
Author: Amadan
Quote (J-Dog @ Dec. 21 2009,13:01)
Quote (Lou FCD @ Dec. 21 2009,11:34)
Quote (carlsonjok @ Dec. 21 2009,09:33)
I took a bunch of pictures, but being a (very) amateur photographer**, they are going to need a lot of cleanup to be presentable.  

Feel free to email the files if you want, and I'll see what I can do with them.

Speaking of reputations -

Be very careful carlsonjock! You might wind up voted Best Supporting Actress in a Made For UTube vid, starring you and the Wright Brothers, with you wearing nothing but a smile and a fetching little red off-the shoulder dress!

Sounds like what my mother used to refer to (in glacial tones, as my younger sister pranced out the door of a Saturday) as "a gownless evening strap".

Date: 2009/12/21 18:21:00, Link
Author: Amadan
Khan,

Did a little tinkering with your pic to bring out its revanchist imperialist running dog glories:



Third Omsk Spartacist Turnip-Pickling-and-Photoshop Kollectiv eagerly awaits exceeding glorious quota of your inherently contradictory capitalist photografs!

Date: 2009/12/21 18:35:29, Link
Author: Amadan
Happy Solstice from Ireland!

Now, did anyone remember to bring a goat?

Date: 2010/01/11 06:14:11, Link
Author: Amadan
Clearly evidence of dodgy design. A stiff dose of Enlightenment will, we all hope, do the job.

A few cute nurses wouldn't hurt, either.

Date: 2010/01/17 13:31:14, Link
Author: Amadan
Quote
Advocatus Diaboli Can Has Birfday



Hmmm. Without eye-witnesses, how can we be sure?


No reason not to have a party, though.

Date: 2010/01/18 08:32:25, Link
Author: Amadan
Quote (Lou FCD @ Jan. 18 2010,07:03)
Doesn't really matter who wins, the head of the cheerleading squad isn't really interested in snogging a second grader.

Speak for yourself!

(And St Gobnait's school for the blind had some HOT cheerleader! And I chose to repeat that grade until I was sixteen. Honest.)

Date: 2010/01/18 10:45:19, Link
Author: Amadan
Kwokfight over at PT.

It really gets quite squirmy towards the end of page 3.

Date: 2010/01/19 05:06:16, Link
Author: Amadan
Robert,

Morbid curiosity prompts me to ask whether you have ever had a job in which any one or more people had to place reliance on your reasoning skills?

If so, how did it work out?

Date: 2010/01/22 11:29:00, Link
Author: Amadan
Doesn't suit the Amadanian timetable to see PZ i nGaillimhe. But at lease the RIA are doing something I might attend:


Is thinking really good for us? Celebrating Thinking panel discussion

2nd March, 6pm.
Venue: Academy House

Does a lively public culture of thinking make for a better society? Why we do celebrate our writers, artists, musicians, sporting personalities but not the achievements of our thinkers? Is critical thinking the great casualty of our educational system? Do we need more thinkers in public life? Is the unexamined life really that bad?

Panellists:
Kevin Mitchell, TCD
Maeve Cooke, UCD
Mary Corcoran, NUI Maynooth
Myles Dungan, Broadcaster and historian
Chair: Michael Cronin, DCU

Date: 2010/01/22 17:52:21, Link
Author: Amadan
Happy Birthday both of youse.

And thank you Wes for providing the Very Model of a Tardobservatorium.

Date: 2010/01/28 04:45:33, Link
Author: Amadan
This is a bit late for the Strylya Dye bahby, but maybe the difference in time zones and the fact that clocks run backwards on the other hemisphere will make up the difference.

Just imagine the effect this will have on junk mail! ("Pssst! Satisfy her tonight! Sausages in unmarked packages!"

Date: 2010/01/29 11:33:52, Link
Author: Amadan
Humans, despite the recurring incidence of parenthood throughout recorded history (and possible earlier), have not yet developed eyes in the back of their heads.

PS: Don't tell the kids

Date: 2010/01/31 18:51:24, Link
Author: Amadan
This popped (or maybe dribbled) into my head this evening.

It's Obvious

The natural world, in all its glory
Beckons to all humankind
To turn the pages of its story
Using senses and and the mind.
It’s obvious! Immense reliance
Should be placed on using the King James Bible.

Life unfolds, each generation
Show the traits of those before.
Some, of course, show variation;
Accidentals in the score.
It's obvious! This gene-pollution
Must give rise to a few biblically defined baramin.

Clades and species branch and nest
In a phylogenic tree.
What solution answers best?
Why this linked diversity?
It’s obvious! The guess that’s bester
Is that we share just one creator as described in Genesis.

In schools and all across the nation,
We confront those who still doubt.
Hell-fire, damn- and bannination
Face those would keep us out.
It’s obvious! They’re simply jealots
And we’re all religiously following the scientific method.

When the battle has been settled
And our victory is great,
Scientists who our cause have nettled
Off to Yurrup can migrate.
It’s obvious! We must work hard
To haste’ the triumph of The Argument Regarding Design!


"It needs a capital T" says Mr I-Know-Better-Than-You J-Dog, and who am I to argue, I'm just the guy who wrote it, what would I know? So it won't be right until he gets his capital T, will it? And then just wait, it'll be something like "Don't you think the last verse should have something about 'Shuddup coz I'm speaking' and, maybe, petunias?' coz Mr Critic knows what's right, and it would be like soooooo wrong to, y'know, do it the way that I like?


ETA: Capital T and whinge





Date: 2010/02/01 14:51:47, Link
Author: Amadan
§@%&!! critics, never bloody pleased.....



ETA: So. Happy now?

Date: 2010/02/01 15:53:15, Link
Author: Amadan
I'll try to write something appealing, kumquat may.
Orange you glad I'm so diligent about raisin the tone of this place?

I really am such a grape guy.

Date: 2010/02/01 16:56:16, Link
Author: Amadan
Quote (Richardthughes @ Feb. 01 2010,16:25)
What's the commonality:

Tomato
Green Pepper
Amadan

?

Oh! I know! I know!

They're all under court order to keep 250m away from kinderg .. . .


Ummm, I give up.

Date: 2010/02/02 10:00:43, Link
Author: Amadan
This is just too bizarre.

Quote
Mr. Renken’s ministry is one of a small but growing number of evangelical churches that have embraced mixed martial arts — a sport with a reputation for violence and blood that combines kickboxing, wrestling and other fighting styles — to reach and convert young men, whose church attendance has been persistently low.


How will this play out in the Baylor-Cafeteria-in-Exile that is UD?

A virtual medal to the author of the best ringside commentary.

Date: 2010/02/02 10:03:03, Link
Author: Amadan
Quote (Wesley R. Elsberry @ Jan. 29 2010,19:52)
There is now a Creation Letter Project in opposition to the Clergy Letter Project.

An old song comes to mind.

Date: 2010/02/02 14:21:15, Link
Author: Amadan
Quote (oldmanintheskydidntdoit @ Feb. 02 2010,14:15)
StephenB:
 
Quote
By my definition, a mind is an immaterial faculty of an immaterial soul. A brain is a physical organ, without which the mind cannot function. At the same time, the mind is not “grounded in, nor an extension of, the brain.” By my definition, the individual literally lives in two worlds–the world of spirit and the world of matter, each of which influences the other. Plainer than that I cannot be. If I go into any greater detail, I will have to abandon the theme of the post, which while attractive to the methodological naturalists, does not serve rational discourse.

Oh go on StephenB, abandon the theme of the post. Throw caution to the winds!

So:

- you can have a brain without a mind

  but

- you can't have a mind without a brain.


There's something very profound and insightful there about Densye, Dembski, and the Discoverrhoids.  Can anyone help me to articulate it?

Date: 2010/02/02 17:27:44, Link
Author: Amadan
Naaaah, he hasn't gone!

He's just . . . . . . resting!

Yeah.  


Resting.

Date: 2010/02/04 05:50:09, Link
Author: Amadan
Stumbled upon this this excellent riff on the Intelligent Falling meme, this time aimed at new agey woo and the likes.

Date: 2010/02/04 14:16:02, Link
Author: Amadan
Ut:

Have a lovely time at UD (should you choose to go there).  We'll be watching with great interest. Keep an eye on the peanut gallery for observations and encouragement.

And when they torch-'n'-pitchfork you out, do come back to join us here. It's not unlike the public passageway through Bedlam from which people could poke the inmates with sticks.

PS: While you're there, you could give them a bit of the Catholic view on evolution. An (ahem) acquaintance of mine goes all Tridentine on them every now and again, which has caused no small discomfort to the very Reformed management.

Date: 2010/02/06 13:21:55, Link
Author: Amadan
... and the kangaroo asks for a tequila with a jumping bean in it.

The zebra turns to the barman and says

"Wow! A talking kangaroo!"




This joke brought to you by Give An Old Joke A Home Week.

Date: 2010/02/08 05:10:58, Link
Author: Amadan
Hmm. Two questions occur:

1. It is suspected that at least some of the UD squad lurk here. Does that mean we should take a vow of silence here too? Maybe we could just confine the discussion to important stuff like Danii Minogue's pregnancy (my daughter told me about it, honest. What copy of Hello? Oh that one. Must have picked it up on the bus, never seen it before)

2. Wouldn't the Silence of the Socks (good film title, that) on UD be a giveaway? Can we the world of science afford the loss of these valuable counter-intelligence* assets?




* In the sense that, whatever intelligence may be, commenters on UD are definitely counter to it.

Date: 2010/02/10 05:18:05, Link
Author: Amadan
Quote (carlsonjok @ Feb. 10 2010,04:10)
Divine power? I thought that ID only purports to be able to detect the hallmarks of intelligence and draw any conclusions about it's source?

Category Error

It's theology when you say it in church.

It's science when you say it on your blog.


You're new here, aren't you?

Date: 2010/02/11 14:36:50, Link
Author: Amadan
Funny that this came up here. I just happened to be reading about the University of Coimbra today and came across this article, which discusses the introduction of 'modern' science teaching in the 18th century.

Dodgy translation:

 
Quote
One argument showing that, before Pombal's reforms, an atmosphere of scientific stagnation prevailed in Portugal is the fact that the works of Galileo, Descartes, Newton and others were, until the middle of the 18th century, banned from being taught in [Coimbra]. An edict of the Rector in 1746 decreed this prohibition, a significant setback relative to the scientific development of Europe.

An exception to this was the work of the Jesuit Inácio Monteiro. But Monteiro was imprisoned on Pombal's orders in 1759 and exiled to Ferrara in Italy, in which university he conducted worthwhile teaching and scientific work...


Academic freedom, in the best Catholic tradition!

(and yes, Ut, I know that things are a bit different now. But you don't see too many liberation theology papers coming from the Gregorian University either)

Date: 2010/02/11 15:39:13, Link
Author: Amadan
What about the Evil Darwinathenazi Conspiracy HQ? Don't tell me that you're a splitter!

Date: 2010/02/12 19:40:57, Link
Author: Amadan
What do you mean by 'definition'? Eh?

Date: 2010/02/14 18:18:51, Link
Author: Amadan
I didn't think this sort of thing still got published:

 
Quote
Population and Environment, vol. 23, 2002, pp. 365-375. Professor Lynn writes that it: “Presents new evidence showing conclusively for the first time that lighter skinned blacks have higher IQs than darker skinned blacks. This supports the theory that the proportion of white ancestry in African Americans is significantly determined by the proportion of Caucasian genes.”


Ahh!! "Professor Emeritus University of Ulster".  No doubt misses having Enoch Powell there to fight the good fight.

Quote
“The lower IQ in southern Italy may be attributable to genetic admixture with populations from the Near East and North Africa.”


Further comment would be superfluous.

Date: 2010/02/23 16:04:12, Link
Author: Amadan
Quote (Schroedinger's Dog @ Feb. 20 2010,14:22)
Thanks for the Ebert link. It raises my interest in the movie.

Funny drawing I found somewhere on the web:


In the same vein...

http://scienceblogs.com/insolence/2010/02/how_does_homeopathy_work.php

Date: 2010/02/24 11:06:47, Link
Author: Amadan


Thank you all.

Showeragobshites, reminding me how old I am

Date: 2010/02/26 11:25:57, Link
Author: Amadan
"On Liberalism and Religious Indifferentism".

Perfectly unobjectionable. With minor adaptation is would fit in on most Faux Noose commentaries.

Date: 2010/02/27 15:05:25, Link
Author: Amadan
Anyone got a match?



HHaappyy BBiirrtthhddaayy  yyoouu gguuyyss

Date: 2010/03/02 08:25:52, Link
Author: Amadan
Quote (Robert Byers @ Mar. 02 2010,02:48)
The marsupial wolf does not look like a marsupial mole. Even if it has a few details like the reproductive system or this or that.



Stoned Baby . . .


. . . says "Dude, ah, whut?"

Date: 2010/03/04 04:45:41, Link
Author: Amadan
Education in Texas seems a bit better off this morning as the Divine Dentist Macleroy has incurred the selfish ingratutude of the voters.

But he can console himself with the the NCSE's UpChucky Award, which he so richly deserved.

Date: 2010/03/07 17:58:27, Link
Author: Amadan
In Italy, the news for the deaf doesn't use subtitles: they act it out for you.

Date: 2010/03/08 15:57:01, Link
Author: Amadan

Date: 2010/03/12 02:25:22, Link
Author: Amadan
Quote (KCdgw @ Mar. 10 2010,21:50)
Quote (Richardthughes @ Mar. 10 2010,17:26)
[tangent] I went here for fodder [/tangent].

"Roughing up the suspect"! priceless.

"Answering the Bat Phone" Har!

Date: 2010/03/15 12:20:38, Link
Author: Amadan
The correct phrase is "Wuntuuh, wuntuuh"

Date: 2010/03/16 09:54:31, Link
Author: Amadan
Shhh J-Dog.

Down Boy!

Date: 2010/03/16 13:56:39, Link
Author: Amadan
TP, you are mistaken!

Allow me to quote from Dembski's testimony at Dover:

   
Quote










                                                                                                  .





















                                                                                         .


(Sung to the tune of 4:33 by John Cage)

Date: 2010/03/19 10:40:00, Link
Author: Amadan
We've just got ourselves a new National Anthem.




I'll get me hat.

Date: 2010/03/21 18:31:05, Link
Author: Amadan
Quote (Louis @ Mar. 21 2010,04:49)
Oh dear, oh dear, oh dear. Mornington Crescent eh?

Tut tut.

Fairlop.

Louis

Totteridge & Whetstone (Ha! It's still Sunday here! Bet you forgot about low tide too.)

 
Quote
P.S. Given the rugby result last night, it's bloody lucky I'm French, that's all I can say.

P.P.S.  Och aye, the noo!

Date: 2010/03/22 06:23:19, Link
Author: Amadan


Hoppy Burdy.

The same day as my wife and my sister* too!



* Two separate people, J-Dog. Shame on you for thinking that.

Date: 2010/03/22 11:21:42, Link
Author: Amadan
Quote (BillB @ Mar. 22 2010,03:42)
 
Quote (Amadan @ Mar. 22 2010,00:31)
     
Quote (Louis @ Mar. 21 2010,04:49)
Oh dear, oh dear, oh dear. Mornington Crescent eh?

Tut tut.

Fairlop.

Louis

Totteridge & Whetstone (Ha! It's still Sunday here! Bet you forgot about low tide too.)

It ain't Sunday any more, and it's the 22nd so ...

Mansion House.

Oh dear God, you're playing Purley Rules???

What a noob. Pathetic.

Date: 2010/03/23 06:24:49, Link
Author: Amadan
Quote (DiEb @ Mar. 23 2010,04:20)
Quote (fnxtr @ Mar. 22 2010,23:03)
   
Quote (Tom Ames @ Mar. 22 2010,20:24)
       
Quote (fnxtr @ Mar. 22 2010,18:40)
         
Quote (Amadan @ Mar. 22 2010,09:21)
           
Quote (BillB @ Mar. 22 2010,03:42)
             
Quote (Amadan @ Mar. 22 2010,00:31)
                 
Quote (Louis @ Mar. 21 2010,04:49)
Oh dear, oh dear, oh dear. Mornington Crescent eh?

Tut tut.

Fairlop.

Louis

Totteridge & Whetstone (Ha! It's still Sunday here! Bet you forgot about low tide too.)

It ain't Sunday any more, and it's the 22nd so ...

Mansion House.

Oh dear God, you're playing Purley Rules???

What a noob. Pathetic.

Pathetic?

Okay, I'm still a pre-novice, but I don't see that one on the map anywhere.

Is it near Parsons Green?

I see what you're doing. Screw you guys.

Dollis Hill.




(cough)daylightsavingstime(cough cough)

(I'll wait my turn)

Sorry to mention the obvious: Standard Greenwich Rule. Daylight-saving-time is unobserved  in correspondence Mornington Crescent.

[Polite applause]

Date: 2010/03/23 12:37:30, Link
Author: Amadan
A simple synopsis of the rules can be read here.

Date: 2010/03/23 15:44:45, Link
Author: Amadan
Well sprogged, Erasmus. Treasure all the wonderful moments, like the ones when you get to sleep.

I'm reminded for some reason of a remark that a grand-uncle allegedly made when shown The Latest Arrival: "Jaysus he looks like a boiled tomato on half a sack of porridge!"

He wasn't asked back.

Date: 2010/03/23 19:12:03, Link
Author: Amadan
Quote (fnxtr @ Mar. 23 2010,18:58)
Quote (Arden Chatfield @ Mar. 23 2010,11:12)
I have just found out that Erasmus's new baby daughter just entered the world yesterday!

I know I predicted earlier that the child would look just like their mailman, but I want to say here and now that this was cruel, groundless innuendo. If Ras shares any pictures, you will see that in fact she's a dead ringer for the guy who comes round once a month to read the meter.

Congratulations!

Congratulations, 'Ras.

Don't worry, you can catch up on your sleep when the little rascal is between 5 and 12.

The deficit is restored thereafter.

*Yawn*

What, dear?

Date: 2010/03/24 09:06:41, Link
Author: Amadan
Or as she's getting ready, ask her date to remind her to  take her antibiotic for that boil on her tongue.

Date: 2010/03/24 12:26:50, Link
Author: Amadan
Middle-aged men entertain themselves by making cryptic reference to arcane and abstruse rules that may or may not exist in a discussion of a subject matter of no apparent relevance to humans of the normal 46-chromosome type.

This absorbs the participants' interests and energies to a remarkable degree. It inexplicably provides amusement to them, derived, it would seem, as much by the exclusion of non-initiates as by any intrinsic wit or worth their exchanges may have.

My God, we've all become LAWYERS!!!!

Date: 2010/03/24 14:29:08, Link
Author: Amadan
Thank goodness for that Louis, I was nearly forced to play Schlump.

Date: 2010/03/25 10:02:03, Link
Author: Amadan
I hate it when it a game descends into frantic diagonals like this. Remember the '74 Quarter Finals when Lobanov-Rostovskii played through Embankment six times, insisting that it only had escalators for the District line? Gladsby had to threaten a puce card before he'd shut up.

Anyway, I'm fed up with this. Balham. And I'm passing the niblet stick.

Date: 2010/03/25 11:21:18, Link
Author: Amadan
Quote (fnxtr @ Mar. 25 2010,10:57)
Monument?  From Balham?!?!?.

Okay I'm officially lost.  I thought the previous Elephant and Castle play broke the Northern to District/Circle transfer, and jeffox could only reach Monument via Tottenham?

Oh, right, Open Orifice.

Well played, sir!

ahem

Date: 2010/03/25 14:38:12, Link
Author: Amadan
Quote
Kansas Politics and Religion


I didn't think they made that distinction!

Date: 2010/03/26 03:21:37, Link
Author: Amadan
I claim ullage over Canada Water and cite Louis fess on a field Or with stoat rampant poursuivant.

Southfields.

Date: 2010/03/26 11:12:08, Link
Author: Amadan
I object. Ullage has been invoked.

Date: 2010/03/26 11:20:30, Link
Author: Amadan
Overground it is.

Ball's Pond Road.

If any of you lot fancy yourselves as co-parceners you're welcome to enfeoff the turbary rights, but I'll still be in MC before you.

Date: 2010/03/26 15:06:36, Link
Author: Amadan
Poor Algie. A truly sensitive soul, much misunderstood. And that dreadful business in court... Years afterwards, Monsignor Jaakontytär told me that it all could have been hushed up if the herdsman hadn't paid tax on the compensation.

Algie's cousin Gershorn Simon was another sort altogether. I could have forgiven him for making that cheese commercial - we all have to make a living - but in the very same dress?  Simply crass.

But I digress. Northwick Park, unless I'm very much mistaken.

Date: 2010/03/26 15:13:57, Link
Author: Amadan
Quote (Tom Ames @ Mar. 26 2010,15:10)
Quote (Amadan @ Mar. 26 2010,13:06)
Poor Algie. A truly sensitive soul, much misunderstood. And that dreadful business in court... Years afterwards, Monsignor Jaakontytär told me that it all could have been hushed up if the herdsman hadn't paid tax on the compensation.

Algie's cousin Gershorn Simon was another sort altogether. I could have forgiven him for making that cheese commercial - we all have to make a living - but in the very same dress?  Simply crass.

But I digress. Northwick Park, unless I'm very much mistaken.

Ah, from Hills-and-Valleys to Parks-and-Greens, eh?

Nice.

Nice is in France. It's not on the Tube.

Date: 2010/03/26 16:02:24, Link
Author: Amadan
Quote (Doc Bill @ Mar. 26 2010,15:59)
Quote
But I digress. Northwick Park, unless I'm very much mistaken.


You are very much mistaken, sir!  Northwick Park is so small a station there's nothing there, not even Northwick Park.  You have to walk halfway across the sports field before you're even near the middle of nowhere.

Chump move, doofus!

... leading to the hospital, which is wholly NHS.

Neophyte.

Date: 2010/03/26 16:10:55, Link
Author: Amadan
<Exasperated>

... which means that, without suitable A&E facilities, I simply have to simulate a coronary seizure or break a major limb and I get a free ride to Charing Cross without use of my Egg card.

I call Spoon. There are too many bloody amateurs about the place.

Date: 2010/03/26 16:20:59, Link
Author: Amadan
Quote (Doc Bill @ Mar. 26 2010,16:05)
Where they do mostly research.  More likely to get an autopsy than a diagnosis.

*Fun Fact*

Mrs Amadan used to deliver babies in Northwick Park. In fact, Amadan 1.1 was born there!

Mrs Amadan agrees with your observation.

Date: 2010/03/26 16:57:55, Link
Author: Amadan
Quote (Louis @ Mar. 26 2010,16:39)
Quote (Amadan @ Mar. 26 2010,21:10)
<Exasperated>

... which means that, without suitable A&E facilities, I simply have to simulate a coronary seizure or break a major limb and I get a free ride to Charing Cross without use of my Egg card.

I call Spoon. There are too many bloody amateurs about the place.

I agree. I'm blooming well staying in Spoon until someone discovers another out of use station.

Louis

Lords!


Ha!! Got you Louis!

Date: 2010/03/26 16:59:42, Link
Author: Amadan
Doc Bill: Thanks for helping to set up the pincer. Louis walked into it.

Date: 2010/03/26 17:15:21, Link
Author: Amadan
Quote (fnxtr @ Mar. 26 2010,15:01)
Quote (oldmanintheskydidntdoit @ Mar. 26 2010,12:57)
Quote (midwifetoad @ Mar. 26 2010,14:25)
Bill didn't win. again.

http://www.uncommondescent.com/religio....eligion

From that thread nullasalus shows how he can read minds:
     
Quote
But I also realize that atheists are perpetually freaked out by the organization, and struggle to cope with (and rationalize) the fact that people can be scientists, intellectuals, and still religious.

Speaking an an atheist, I'm perpetually freaked out by furrys. Not by the fact that scientists and intellectuals can be religious.

Can I rationalize furrys? No.

Oh, man that is so wrong.

Who in the world is that colour of pink?

*speechless*

A trellis? How utterly . . . suburban.

Date: 2010/03/26 17:17:13, Link
Author: Amadan
I think it's OK though: Mother appears to be wearing a wedding ring.

Date: 2010/03/26 17:33:19, Link
Author: Amadan
Quote (J-Dog @ Mar. 26 2010,17:20)
 
Quote

Oh you can find anything on the internet. I cite UD as an example.


Anyway, back to the fray. I can see that the last move put me in Spoon again.

Clever. Clever.

Louis

Quote
Actually, this hard-fought MC game is a lot like UD...

Names tossed about at random, a plethora of appeals to authority, posters up at arms over miniscule details.  

Of course unlike UD, we do have Jesus, Dr. Dr. Dembski and the Irish Catholic Priests sitting this one out, and to protect our game from them,  I think it is time make a play for Cambridge over Upton on the Green.

Feckssake J-Dog, would you ever learn the bloody rules?  This isn't a joke.

Date: 2010/03/26 18:57:24, Link
Author: Amadan
We seem to have received some correspondence!

Date: 2010/03/26 19:09:20, Link
Author: Amadan
Quote (Louis @ Mar. 26 2010,19:03)
Everyone miss a turn in rememberance.

Louis

B(l)ank.

Date: 2010/03/28 19:11:43, Link
Author: Amadan
Remember what Dembski’s students are there for. This is not High Academia, an Ivory Tower where ideas and knowledge are explored for their own sake. This is a missionary school.

The whole point of Dembski’s course is to rub up intellectual callouses that will let students survive contact with The Enemy with The Message intact, in their minds, if not in the other bloke’s.

This serves two purposes:

1. Positive reinforcement for the infantry: “The atheists could only swear at me” / “They just keep repeating the arguments I was inoculated against in Apologetics last October” / “The need for missionary work is so much greater than I thought!”

2. Feedback for the marketing bureau: “Hmmm, I’ll give a comprehensive criticism of that data in my next peer-reviewed paper in Nature dismiss that argument as irrelevant/unscientific/absurd in my next sermon.”

This is not about science. Science is not the ground on which this battle is being fought.

Where Dembski is vulnerable is in his expectation that students (as self-selected missionaries rather than academics) will equate refutation with rejection. Most, but not all, of these people are saturated with an authoritarian mindset. Some of the brighter, more empathetic ones, will compare the arguments they have been given as Holy Writ with those they have heard described as Wrong. Seepage will occur.

So lay off the abuse, if only on the kids' thread here, guys.


Edit: cuz yur wurthit

Date: 2010/03/29 10:04:29, Link
Author: Amadan
In honour of Louis's sub-meteorological state, I was considering

Hanger Lane


but memories of several wearisome journies of my own through the twilit ordeal that he now endures lead me instead to

Ickenham

(and "gag me with a Spoon!" as Moon Zappa said)

Date: 2010/03/30 06:13:17, Link
Author: Amadan
Stumbled across this while discussing the many well-established benefits of homeopathy with a pal.

It discusses the uses of a remedy distilled (sorry, diluted) from a lump of the Berlin Wall. The diluted 'remedy' was then subjected to testing:

 
Quote
This remedy has never been proved classically but information was gained about it through a particular form of proving called a ‘meditative proving’, carried out by a group of homeopaths who had meditated together over a period of years. Each member of the group would take a particular remedy and then proceed to meditate on its effects over a period of some 3-5 hours. The remedy picture would then be written up and published in a homeopathic journal created for the express purpose of publishing some of these provings. The meditative proving of Berlin Wall can be found in the journal Prometheus Unbound Spring 95, No2. The remedy was made from a chunk of the original wall after it was reduced to rubble. It was a composite piece of concrete and stone with pieces of painted blue cement.


These people charge for this mumbo-jumbo. More astonishingly, they get paid!

There must be an ID angle...

Date: 2010/03/30 09:39:06, Link
Author: Amadan
Further comment would be superfluous.

Date: 2010/03/31 11:33:02, Link
Author: Amadan
Reposted because I'll never get an opening like this again:

Date: 2010/04/01 04:46:27, Link
Author: Amadan
Bloody neo-Stovoldites.  No sense of tradition.

*sigh*

Ealing Broadway.

Date: 2010/04/01 04:50:43, Link
Author: Amadan
Quote (Louis @ April 01 2010,04:08)
 
Quote (qetzal @ Mar. 31 2010,23:51)
Well I'm not gonna look there!

NTTAWWT.

NTTAWWT?

Louis

"Naked Tibetan Tangerines Are Well Worth Trying".

Don't you know anything?

Date: 2010/04/01 05:09:24, Link
Author: Amadan
Incredible article in Wissenschaftlich Zeitung für betruglichen Forderungen. Excuse my rough translation:

Quote
WZbF: It has been alleged that the Intelligent Design postulate is essentially a political strategy under the guise of scientific language.

Dembski: That is tendentious. What we are seeking is to restore the practice of science to what we have identified, with great precision, as its Aristotelian ideal. That political consequences would flow from this is secondary, though undoubtedly to be desired. In a sense, we are seeking to destroy science in order to save it.


Full article available here.

Date: 2010/04/01 05:23:44, Link
Author: Amadan
Not sure if this belongs here or on the MC thread.

Date: 2010/04/01 07:28:47, Link
Author: Amadan
Quote (afarensis @ April 01 2010,07:17)
Quote (Louis @ April 01 2010,04:33)
Well since I've just found out that Simon Singh has just won the right to appeal a previous ruling that he libelled some chiropractors I can only move to Chancery Lane in celebration.*

Louis

*Although I suppose Temple would also be appropriate in terms of location. However this would have involved a Northern Approach without an appropriate shift of the Diagonals. Also, since no one has applied for a repeal, elevators are still wild, and I think we all know what that means for a move to Temple from a Major Interchange. {Snigger}

Correction in italics modified in edit.

I apply for a repeal...elevators blech...did I mention my experience with the mime? By the way why is Amadan complaining about neo-Stovoldites when he has just made the quintessential neo-Stovoldite move?

At any rate he forgot to renumberate the denomberator which sets up a cross digital flux in the lycanthrope contingency  which sets it to 007 and allows me to play:

Bond Street

Afarensis fails to appreciate that my complaints, like the rails of the Underground, are ironic.

Date: 2010/04/01 08:23:30, Link
Author: Amadan
Quote (Louis @ April 01 2010,08:13)
I should remind you also that Paley Street is not even on the Underground system, and thus does in no way form part of the game of Mornington Crescent

Is that by design?

Date: 2010/04/01 11:30:10, Link
Author: Amadan
Quote (Louis @ April 01 2010,10:55)
Any more of this sort of nonsense and I'll have to start invoking Crebbit's Rule.

Not  . . . the
                 

Date: 2010/04/01 17:07:01, Link
Author: Amadan
Post!

Date: 2010/04/02 16:23:05, Link
Author: Amadan
Quote (JohnW @ April 02 2010,16:16)
Quote (Aardvark @ April 02 2010,13:34)
Quote (Richardthughes @ April 02 2010,11:58)
These universal, transcendent, self-evident and absolute morals... people can't seem to agree on them or interpret them with consistency, can they?


Let's just agree to disagree on them , OK?

That would be wrong.

You're right.

Date: 2010/04/06 12:54:22, Link
Author: Amadan
Wes (or should I say 'Ding'?)

You are honoured indeed! I'd treat that as a creo-antiNobel!

http://scienceblogs.com/dispatc....hp#more

Date: 2010/04/10 19:14:54, Link
Author: Amadan
Quote (J-Dog @ April 09 2010,16:39)
 
Quote (Kristine @ April 09 2010,15:43)
 
Quote (Schroedinger's Dog @ April 04 2010,20:04)


First, that picture is AMAZING! Thanks for posting it! but it makes Farfarman look too nice, IMHO...

Second, I had my girl discover your blog, and I think she might be as jealous as I am about your Galapagos trip.

All in all, I should by right totally hate you, but instead I'm just thinking: shimmies!



ps: had to go back to France in a hurry :(

I'm going to be working (and even getting PAID for a change) this summer in DC. Hate me yet? ;)

Shimmies to you, as always!

I pulled some risky financial tricks to afford that Galapagos trip...but if you ever want to go there or somewhere, check out the Center for Inquiry. I called Toni Van Pelt the second I saw that trip advertised, and explained my situation. She found roommates for me so that I could afford it. She was awesome.

Yes!  Now I hate you for having more money than me, instead of being prettier than me! :)

Prettier? Says who? With that beard? And the rough-hewed knurls on that club match your brow-ridge just exquisitely!













The usual tenner through PayPal, OK, J-Dog?

Date: 2010/04/11 08:45:17, Link
Author: Amadan


What? Whaddaya mean 'you were keeping it for something'?

Date: 2010/04/14 03:59:26, Link
Author: Amadan
Quote (Louis @ April 14 2010,03:11)
We're still playing. Some of us are just considering our next move.

Louis

Ha! "Louis." is not a station, even under the Halibut Exception. Please either pay ullage or perform Civil Kaddish.

Upney (or as crossword fans call it, 'Yen')

Date: 2010/04/14 04:02:41, Link
Author: Amadan
PS:

Fnxtr - Your sig is (as they say American TV shows) Absolutely Ossm.

Date: 2010/04/14 05:14:38, Link
Author: Amadan
Quote (Ptaylor @ April 14 2010,04:57)
Isn't this thread getting a bit tiresome?

Highbury & Islington.

Yes. "For the love of the game" and all that.

It's remarkably similar to cricket in that way.

Lords.

Date: 2010/04/14 11:17:39, Link
Author: Amadan
Quote (huwp @ April 14 2010,07:39)
No, I'm sorry, but "Lords" just isn't a valid move.  Possibly "St.John's Wood" or "Westminster" but not "Lords".

I've consulted Stovold's on this and it's just not allowed, not even under the (later) Mortimer Variations or even the Armitage guidelines.

You'll just have to miss a turn or throw a double six.

Anyway...

Fairlop.

Of course it's not in Stovold: see Wisden Appendix XXVII Spooning and Spoon. The rule was in abeyance until the Serbian War of 1912.

Lords it is.

Date: 2010/04/15 04:26:55, Link
Author: Amadan
[Furious sulk: determined silence]

Date: 2010/04/15 10:56:41, Link
Author: Amadan
Quote (dvunkannon @ April 15 2010,10:30)
Playing a Carrom off another player or bystander was declared legal in the Australian Tests of '56, no matter the subsequent rioting.

Quite right. Funny thing is, you'll still hear some British blaming Eisenhower for Suez later that year.

 
Quote

King's Cross (Platform 9 3/4, to be exact)


Which brings us to . . .

Mornington Crescent.

Date: 2010/04/15 11:33:38, Link
Author: Amadan
Quote (Richardthughes @ April 15 2010,11:05)
Yes! I was hoping someone would fall for that. That's THREE parallel shunts, so I'm well within my rights to invoke and AF DAVE reversal:




Hmmm. Farringdon, for reasons that will become apparent..

Sustained applause

Date: 2010/04/17 15:34:33, Link
Author: Amadan
In honour of the volcano that is currently keeping our feet firmly on the ground,

Mudchute.

(It was that or Burnt Oak, I guess)

Date: 2010/04/19 05:23:38, Link
Author: Amadan
Quote (dvunkannon @ April 18 2010,21:27)
There is only one valid reply to Mudchute (according to the Loomis Twins).

Arsenal.

Soory, lost 3-2 to Wigan SNORF

You've been been derailed to the North-East. Miss a turn or take up rugby.

Date: 2010/04/19 05:27:37, Link
Author: Amadan
I'm trying to remember what this story reminds me of.

Quote
An extraordinary literary "whodunnit" over the identity of a mystery reviewer who savaged works by some of Britain's leading academics on the Amazon website has culminated in a top historian admitting that the culprit was, in fact, his wife.



Can anyone help?

Date: 2010/04/19 06:39:59, Link
Author: Amadan
Quote (Reciprocating Bill @ April 19 2010,06:20)
Dembski:
 
Quote
ID has no beef with this. As I’ve said (till the cows come home, though Thomist critics never seem to get it)...

Will ID have beef when the cows come home?

Where IS the beef, WAD?

And the sheeple will continue to be fleeced, while the preachers will grind out more books and help themselves to the pork.

Let's not mince our words about this: There's an awful lot at steak, particularly for the likes of Ken Ham.

Date: 2010/04/21 06:05:04, Link
Author: Amadan
1. If an atheist does such a deed without ANYONE ever finding out, how can Andrew say whether or not the atheist has done it?

2. If it transpires that there is a god who rewards pure altruism, won't the atheist, who acted without expectation of a posthumous bonus prize, get a bigger reward than the believer? ("Sorry Andrew, your place in Heaven has been allocated to an atheist")

A true tour de tard.

Date: 2010/04/21 07:50:16, Link
Author: Amadan
Quote
This is backfiring as donors are asking themselves why are these ministries now exclusively evolutionist and thus are putting their money elsewhere.


How to measure the success of a Christian Minstry, from the mouth of the Loser Master himself.

Date: 2010/05/07 04:01:16, Link
Author: Amadan
Some Distinctly Different Delicacies:

Spiegel Food Quiz

Date: 2010/05/07 06:28:11, Link
Author: Amadan
Meanwhile, the pinnacle of peer reviewed science that is Baptist Press carries the DrDr's's latest whinge*:

H/t The Sensuous Curmudgeon

     
Quote
Former Baylor president Robert Sloan's "2012 Vision" continues, at least for now. This vision rests on two pillars, seeking to establish Baylor both as a top research university and as a school faithful to its Christian heritage. Secularized faculty, who are in the majority at Baylor and forced Sloan's removal (he is now president of Houston Baptist University), see Baylor's Christian heritage as a liability and would like to make the university's slide into secularization complete.
...
Ken Starr, who becomes Baylor's new president June 1, therefore faces a crucial test: ...  The question is what he will do regarding Baylor's Christian identity.
...
Such optimism would be better justified if incoming Baylor president Ken Starr were to reinstate the Evolutionary Informatics Lab's website on the Baylor server and to recognize Intelligent Design as a legitimate area of research for Baylor faculty. That would constitute a true vindication of Marks' work on Intelligent Design. It would also constitute a true validation of Starr's commitment to the full Baylor 2012 Vision.


So, would giving ID a free pass back into Baylor help the "research" or "Christian heritage" bit of the 2012 Vision? I wonder if there might be room for an underappreciated statistical theologian somewhere on Baylor's prestigious faculty as well?

Suggested New Baylor Motto: Omnes Scientia Hactenus


*OK, it was published on a Thursday, but I saw it on a Friday, so creationally it qualifies as an Authentic Meltdown

Date: 2010/05/07 09:45:08, Link
Author: Amadan
Quote (Richardthughes @ May 07 2010,09:31)
 
Quote (keiths @ May 07 2010,08:52)
[URL=http://www.uncommondescent.com/atheism/coffee-new-york-times-pundit-book-rather-weakens-the-case-for-the-existence-of-antony-flew




/#comment-353753]Denyse[/URL]:
   
Quote
When one leads a person gently back into the past, they may display a very good sense of what they really believe. If Flew changed his mind in 2004, I know no reason to doubt that he did.

If Denyse thinks that, she probably does.

Flawed premise...

Date: 2010/05/11 07:22:36, Link
Author: Amadan
Quote (Henry J @ May 10 2010,22:09)
I'm puzzled by why anybody would want to discredit big bang theory. It does after all point to a singlular origin of our universe (at least the part of it that's visible), and the alternative is an enternal infinite universe that always was - which isn't what most science deniers would want, as I understand it.

Besides, as I understand it, the big bang is way more consistent with observation than any known variant of the steady state, as it would require assuming continual creation of matter in empty space, in order to explain the red shift, and the fact that the microwave background is less than the temperature of the surface of the sun (which would be implied by a non-expanding infinite universe with regularly spaced galaxies).

Henry

Your mistake is to think it's just a choice of Big Bang v. Steady State. You forgot the preferred Option 3

Date: 2010/05/11 14:42:47, Link
Author: Amadan
Quote (MichaelJ @ May 07 2010,22:23)
The church is blaming everything except themselves for the loss of kids from SRE.
I'm not surprised at the numbers dropping out. 10% of Australians go to church and a lot of parents send their kids to SRE because they think it will do them some good to learn ethics and morals. On the other hand some Christians take their kids out because some of the SRE teachers are truly awful (think afdave)

I was disapplighted to see that Dave is still lashed to the tiller and fulfilling his mission objectives over at TR. He's quite remarkably consistent too.

I think I once tried to shoehorn a joke about YECs-as-phoenixes into something I scrawled about Dumbskidore and Hogwash Baptist Academy, but Dave surely makes life stranger than 'art'.

I can think of nobody who makes a more compelling case against creationism and fundiism. Not even Hovind.

Date: 2010/05/17 06:13:43, Link
Author: Amadan
Quote (Stephen Elliott @ May 16 2010,05:39)
What I should have said that I like to be able to vote for an individual rather than just a political party. As an example, my local MP came out very well when the expenses where published and so I voted for him. I don't think that PR would give me that option. That doesn't matter for the Lords but I think it important for a MP.

BTW, so far I quite like the after election consequences.

Stephen, a lot depends on the type of PR. Here in the Eye of the PIGS, we use the STV system, where you rank your choices numerically. The first candidate to get over the quota is elected, his or her surplus votes are distributed, and if nobody makes the quota on a count, the chaps on the bottom are eliminated and their votes are distributed,and so on until the seats (3 - 5 per constituency) are filled.

Marvellously complicated, and the public have absolutely no difficulty with it. You just give a Number One to the chap you like, and you can even give a Number Two to the certifiably mad idiot in the other party to register your protest vote. Strategic voting becomes a fine art, and everyone is an expert. We recently sent an osculospumatory trotskyist tothe European Parliament (where he could do no harm to anyone important) that way, handily keeping out a Banker's-Best-Pal sort of candidate.

It creates ferocious competition between elected reps (even from the same party), so all their attention stays focused the next election and on local or short-term issues. So nothing useful gets done in our parliament until the horse has bolted. (On the other hand, would you really want that shower of gobshites to have any real responsibility?)

You can get around the local-issues problem by having PR in single-seat constituencies, but that would detract from the fun of our election counts, which are absolute circuses (Will the surplus go from the Relatively Sane Party to the Gibbering Loons or the Vegetable Liberation Front?)

If you want to make it even more Sensible, you could add a list system like in Germany or the Netherlands. Boring and unrepresentative but effective.

Date: 2010/05/17 06:51:07, Link
Author: Amadan
Quote (Louis @ May 17 2010,06:40)
.... one keyboard and a quadruple ristretto*.

*I call it the Defibrillator.

Like this?

Date: 2010/05/19 10:16:55, Link
Author: Amadan
Quote
Gibbering creobot:

" . . . the Berlin wall in 1986"


Francis Bacon (a well-known Christian and a scientist) surveys the Berlin Wall in 1986:



That must have been what made it fall three years later. Maybe.

Date: 2010/05/19 10:18:59, Link
Author: Amadan
Quote (curiousgeorge @ May 19 2010,10:07)
I would be interested in hearing the counter arguments to what he is saying rather than seeing people try to brush it off.

Anyone care to do so?

Hello Perry.  Good of you to join us.

Date: 2010/05/20 07:19:31, Link
Author: Amadan
Your wine, Sir Doctor:




Congratulations: may your PH always be Deed, but your Doc never a Turd.*





*No, I don't understand it either, but it was the Right Thing to Say

Date: 2010/05/21 04:49:10, Link
Author: Amadan



HB!

Date: 2010/06/01 06:08:29, Link
Author: Amadan


And a Mallard Fizz with that, bartender . . .



Happy Birdy!

Date: 2010/06/10 07:39:05, Link
Author: Amadan
A nice comment I ran across in an old company law case. Keep it around for the next quote-miner to visit:

Quote
Supposing you state a thing partially, you may make as false a statement as much as if you misstated it altogether. Every word may be true, but if you leave out something which qualifies it, you may make a false statement.

Lord Justice James
25 February 1881

Arkwright  v Newbold, 17 Ch D 301

Date: 2010/06/16 12:14:43, Link
Author: Amadan
In honour of Bloomsday, though the travails of travaille have deprived it of the attention it deserved:

 
Quote
Stately, dumb Barry Arrogant came from behind an assumption bearing an argument of lather on which a banstick and sneer lay crossed. A yellow dressingdown, unwarranted, was waved gently around him at the minds boring there. He held the CSI aloft and droned –

Se non potete tagliare la senape, è migliore da essere pensato un martire alla vostra credenza religiosa che un semplice fuckup.

Halted, he peered down the dark winding stairs and called up coarsely:

-- Come up, Clinch! Come up, you fearful jesuit!



-- God! he said quietly. Isn't the CSI what Dembski calls it: a great sweet earner? The snotgreen CSI. The scrotumtightening CSI. ?? ???? ??? ?????. Ah, Clinch, the Greeks! I must teach you. You must read them in the original. Tardatta! Tardatta! She is our great sweet mother. Come and look.


Yours, with a fine tang of faintly scented urine.

Date: 2010/07/07 04:14:56, Link
Author: Amadan
Evolutionary explanations of humour.

Sufficiently slow and painstaking explanation to IDiots of what humour is still not achieved.

Date: 2010/07/07 06:49:12, Link
Author: Amadan
Sorry, doesn't refer to farting. Couldn't be Bronze Age humour.

Date: 2010/07/14 19:45:29, Link
Author: Amadan
In front of my office there is a mosaic dealing with the Bronze Age tale of Setanta (who grew up to become the hero Cú Chulainn).



(Sorry, crap photo, taken with a cheap phone on a fumatory break.)

This story was passed on orally and, no doubt, embellished, misquoted and blended with completely unrelated myths for a few centuries, until it was eventually written down in the 10th century or thereabouts.

The scribe monk was kind enough to add a marginal note that could usefully be appended to some other Bronze Age tales we can think of:

Date: 2010/07/15 11:29:38, Link
Author: Amadan
Welcome Madbat.

Not only have I been banned, every single one of my posts has been obliviated.

A few dim echoes remain, quoted in others' posts on UD. I treasure these, and shall not prejudice them by revealing their locations. But it was fun.

Date: 2010/07/16 04:14:43, Link
Author: Amadan


Pleasant memories of your joint and several decantings.

PS: The web page I took that picture from described the pictured confectionaries as "nappy cakes".   eeeeeeewwwwwww

Date: 2010/07/16 18:11:43, Link
Author: Amadan
I disagree. I think it is motivated by a knee-jerk antipathy towards The Other, that it will polarise positions, and is condescending and frankly illiberal. It strikes me as doctrinaire secularism that has forgotten what secularism is there for.

Hitchens' point about the KKK highlights his wrongness. What makes the likes of them impotent is exposure they get in open discourse. Freedom of speech (and expression generally) is freedom to be utterly offensive. When you ban hate speech, you validate it: The KKK (and the proto-Taliban types) thrive on victimhood and alienation.

I'm not so naive as to think that women aren't coerced into wearing the burqa and the subjugation it represents and reinforces. But in a liberal democracy they have the right not to accept that. Banning the burqa is telling women that the liberties of western society are insufficient to prevent them being forced to wear it - they need a wardrobe law instead of free will.

You won't overcome mediaeval patriarchy that way.

Date: 2010/07/18 16:36:51, Link
Author: Amadan
Nobody is fooled that the issue in France is the rampant confusion caused by thousands of unidentifiable females demanding driving licenses or seeking to inspect building regulations. This is about antipathy to Muslim people of a particular background and the reaction they provoke by their appearance. By an association whose mechanisms have not been explained to us, this is linked to the despicable pronouncements of jihadist nutjobs. I am not aware of a wave of female bombers concealing explosives under face-scarves. And if there were a threat of attack by bombers carrying bulky devices under clothing, the matter could be addressed by requiring all people to wear skin-tight apparel, which would be a very French thing to do. I'm sure...

I do not suspect that there has been a sudden outbreak in France of concern for the protection of girls from ignorant domineering men. [Insert bottom-pinching joke here] I have to see this measure as simply illiberal and condescending.

Date: 2010/07/22 05:31:23, Link
Author: Amadan
Quote (gravity well @ July 22 2010,05:07)
stop everything! they've found Woodhenge!!

Only Strawhenge left....

um, ok, carry on I guess.

If only there were some way to rule out a natural cause for this. . .

Date: 2010/07/22 05:37:13, Link
Author: Amadan
Hello Gravity Well, welcome to the Bemuseum.

The lads will organise your induction tour in a little while. Please make sure you have a wetsuit, an avocado and either a copy of Twilight or a rubber chicken.

Date: 2010/07/23 05:10:11, Link
Author: Amadan
Kattarina, at least you have a basis for calling your state secular.

     
Quote
Preamble to the Irish Constitution, 1937
In the Name of the Most Holy Trinity, from Whom is all authority and to Whom, as our final end, all actions both of men and States must be referred,

We, the people of Éire,

Humbly acknowledging all our obligations to our Divine Lord, Jesus Christ, Who sustained our fathers through centuries of trial,

Gratefully remembering their heroic and unremitting struggle to regain the rightful independence of our Nation,

And seeking to promote the common good, with due observance of Prudence, Justice and Charity, so that the dignity and freedom of the individual may be assured, true social order attained, the unity of our country restored, and concord established with other nations,

Do hereby adopt, enact, and give to ourselves this Constitution.


Over the years, this (along with a few other choice bits of Vaticania) has been used to justify explicitly pro-Catholic rules including a ban on importation of contraceptives, censorship of publications that advertised abortion services, the criminalisation of homosexual acts, the evidencially privileged status of discussions with priests, pro-"family" rules on custody etc that sheltered abuse, and sundry other bits of legal arcania I shall not detain you with.

Most of these are now gone, for which the influence of the EU, the ECHR and the glacial intrusion of modernity are much to be credited. But that ridiculous piece of ultramontanism remains.

Date: 2010/07/23 05:50:44, Link
Author: Amadan
I prophesise spilt lukewarm Coffee! over this.

Date: 2010/07/23 20:05:20, Link
Author: Amadan
Quote (Stephen Elliott @ July 23 2010,18:14)
 
Quote (Texas Teach @ July 23 2010,11:59)
   
Quote (JLT @ July 23 2010,07:33)
     
Quote (Wolfhound @ July 23 2010,06:11)
Way to fuck with the blind folks, guys!   :angry:

As a service to the blind folks a translation of this important exchange in morse code:

S? (S = three dots in morse code) What is that an abbreviation of?

LOL POTW

Seconded (Google rocks)

Why would I want to Google rocks?

I'll get my coat...

I expect that you anticipated this, but.


How many coats?



Oh sorry! I thought you asked "How many cats?"

Date: 2010/07/26 08:53:07, Link
Author: Amadan
The domestic bliss of the Amadanian household was shattered by an unexpected text message from No. 2 Son (aged 17), on holiday in Germany visiting his cousins. The message informed us he was OK, no worries etc.

In the absence of information about what the Hell was going on (arrest for drunken molestation of innocent females seemed a plausible explanation), we rang, to be told that he & the gang he was with had missed the train to Duisburg they had planned to take, and so arrived at the Love Parade an hour after the disaster.

I look at the pictures of the chalk outlines of bodies and just shiver.

Date: 2010/07/26 10:40:42, Link
Author: Amadan
Quote (Kattarina98 @ July 26 2010,10:22)
Quote (CeilingCat @ July 26 2010,00:50)
Read Ham's article, you won't be disappointed.

And to think that DoubleDoctor must swallow it for the sake of the Big Tent ...

[Mental image censored]

Date: 2010/07/26 10:56:31, Link
Author: Amadan
Quote (fnxtr @ July 26 2010,10:52)
Quote (Richardthughes @ July 26 2010,08:48)
Quote (Amadan @ July 26 2010,10:40)
 
Quote (Kattarina98 @ July 26 2010,10:22)
 
Quote (CeilingCat @ July 26 2010,00:50)
Read Ham's article, you won't be disappointed.

And to think that DoubleDoctor must swallow it for the sake of the Big Tent ...

[Mental image censored]

One swallow does not a hummer make!

You're a little pun gent today, richardthughes.

It may all come to nothing. We'll just have to wait and see what goes down.

Date: 2010/07/30 04:45:02, Link
Author: Amadan
And I read Caseykin's screed, lost 10 IQ points, but in Darwinian terms gained dumbness.

Date: 2010/08/03 15:15:22, Link
Author: Amadan
Evvydens uv Dzine!

Date: 2010/08/03 15:16:44, Link
Author: Amadan
Quote (J-Dog @ Aug. 03 2010,14:50)
Happy Birthday Frank.

Where would we be without your invention?


Still in Hamburg?

PS Happy Birthday Frank

Date: 2010/08/04 05:19:31, Link
Author: Amadan
and quite ahem . . . ardent too.

But I'm indiscrete. I should keep mum.

Date: 2010/08/12 18:51:55, Link
Author: Amadan
Quote (Wesley R. Elsberry @ Aug. 12 2010,16:57)
"Persons with frontal lobe damage are often unable to cease applying the original rule and begin a search for a new rule."

Not "often"; always. It's called perseveration, and the people taking the test are often quite capable of describing the protocol and the strategy for switching rules. They just end up incapable of applying what they rationally know needs to happen.

You don't even need cards!

1968: Epperson v Arkansas
1975: Daniel v Waters
1982: McLean v Arkansas
1987: Edwards v Aguillard
2005: Kitzmiller v Dover

As Lenny Flank always says, they just can't help reverting to type.

Edit: Missperred Renny's sulname





Date: 2010/08/13 11:24:08, Link
Author: Amadan
This is a marvellous idea. I think we should extend it to funerals.
A bright business opportunity beckons in the provision of:

  • Insta-Sniff pre-soggied tissues so that absent relatives don’t have to come hundreds of miles to generate their own
  • Mumbled Platitude Tokens to be sent to the relict (premium tokens count for a fleeting handshake as well!)
  • Web-based software allowing family members not present to bitch about the deceased (oh, I see Facebook got there already)
  • Proxy-pigs, who will eat all food in the deceased’s family’s house so you don’t have to!


Next: The BRIS FINE…

Date: 2010/08/13 11:47:25, Link
Author: Amadan
Ummm, can I just send out a memo asking everyone to do it for themselves?

Date: 2010/08/13 13:27:19, Link
Author: Amadan
At least it's not his Bosie.


(Not that there's anything wrong with that, of course)

Date: 2010/08/13 19:15:04, Link
Author: Amadan
Febble is not "a commenter".

Febble is The Goddess Who Dwells Amongst Us.

Date: 2010/08/13 20:36:50, Link
Author: Amadan
In light of my latest Visa statement, I shall avail of the immunity from arrest for debt in Southwark.

Date: 2010/08/16 04:09:04, Link
Author: Amadan
Completely Autonomous Limited Voluntary Intentionality Number

Date: 2010/08/16 07:47:36, Link
Author: Amadan
Quote (Schroedinger's Dog @ Aug. 16 2010,07:08)
Quote (BillB @ Aug. 16 2010,13:07)
Teleologically Autonomous Righteously Determined

Me likey! Although, I do thing TARD stands as an acronym for something already. Can't remember what, though...

It's inscribed on the Presidential Medal:

Date: 2010/08/23 07:39:30, Link
Author: Amadan
But despite drubbing Blackpool 6 - 0, I'm afraid Arsenal are still 2 points behind Chelsea, which means that

    Sloane Square

leaves you somewhat astern of me.

Besides, who'd support a club with a name that mean bottom and everything?  Just silly, is what it is.

Date: 2010/08/25 07:01:42, Link
Author: Amadan
I'd like to take this opportunity to clear up confusion about the varieties of CSI. It's really not that hard (if you cook it right):




Ed: Spelling





Date: 2010/08/25 10:25:14, Link
Author: Amadan
Rich, I am, as always, flattened by your attentions (Thursday OK? And fer fecksake bring smooth, not crunchy this time!), but I must decline POTW in favour of Zachriel's massive erudition (that's what Louis's mum called it, anyway).

Date: 2010/08/25 11:24:51, Link
Author: Amadan

Date: 2010/08/26 11:11:51, Link
Author: Amadan
Looks like the Daily Mail was right about the EU and its evil war on the noble British Banana!

http://watchermeetup.50.forumer.com/viewtop....#p27215


(h/t: FSTDT)

Date: 2010/08/27 15:16:01, Link
Author: Amadan
Haven't you ever wanted to ask creationists "What grounds do you base your argument on?"


Veal. Tip. I'll get me coat.

Date: 2010/08/27 15:18:26, Link
Author: Amadan


HB

Date: 2010/08/27 15:19:23, Link
Author: Amadan
Oops, late!

Happy Afterbirthday!

Date: 2010/08/29 05:40:19, Link
Author: Amadan
( c) all of the above

Date: 2010/09/01 04:07:10, Link
Author: Amadan
Quote (Ptaylor @ Sep. 01 2010,03:23)
I'm not sure what to make of Dr Dr D's latest post in which he simply links to this rather good pastiche of the London Underground* map, which, instead of tube stations, scientists are named along 'train' lines representing various scientific disciplines.

I'm not sure how the average UDer will take this, seeing their loathed enemies - Dawkins, Coyne, the D man himself - appear alongside uncontroversial personalities who they sometimes even support - e.g. Newton, Watson & Crick.

My pick - he's playing for "where's Behe, Wells and Dembski on that list" comments. I may be wrong, but it seems to me as if he's attempting to re-live his famous Dawkin's birthday bitterfest** vicariously. (Sorry, can't be arsed to find a link at this hour).

As I said, I may be wrong - anyone else have any thoughts?

*Clive, please tell Dr D it's the Underground, not Subway, map.
**The irony at the time was that he was claiming that he was not on Dawkins's acknowledgment list after having sent a mean spirited 'congratulations' note, where in fact he had been mentioned, in a realcomprehension fail. On this sort of diagram the name W A Demsbski will never appear.

Oh yes it does!

Date: 2010/09/01 08:27:11, Link
Author: Amadan
[img="The Emperor's New Lolcat.jpg"]


HB, most khanny one

Date: 2010/09/01 10:14:55, Link
Author: Amadan
Thank you J-Dog. I'll pm you the usual fiver.

Date: 2010/09/01 12:07:20, Link
Author: Amadan
Well, Ken Ham himself is a pretty successful gold digger...

Date: 2010/09/02 07:27:22, Link
Author: Amadan
God Didn't Create Universe, Says Hawking

How long before Densye doubles up in a tardic spasm?

Bonus point: how long before a commenter drags Hawking's disability into it?

Date: 2010/09/02 09:53:26, Link
Author: Amadan
Well said, stout fellow!

I'm a supPorter of that motion.

Date: 2010/09/03 09:47:16, Link
Author: Amadan
"euphemism"?

Sweet Mother of Dog the woman is illiterate...

Date: 2010/09/04 09:47:22, Link
Author: Amadan
Quote (socle @ Sep. 03 2010,22:08)
*sniff*
 
Quote

Note to readers

Because I am writing a book, I probably will not be blogging much before December, but expect to see me then, if not before. I did post some new material today. For stories on the intelligent design controversy, go to Uncommon Descent - Denyse


Until December...


Why is Densye wearing a red collar?

Date: 2010/09/07 03:40:55, Link
Author: Amadan
Is there a major V-D problem in Germany?

Date: 2010/09/07 03:59:18, Link
Author: Amadan
Quote (Lou FCD @ Sep. 06 2010,20:29)
Quote (Schroedinger's Dog @ Sep. 06 2010,14:21)
Horseboy:

Why didn't you ever get a POTW for that masterpiece?

Because I am waiting for one of you lazy bastards to make a "Most Useful, Longest Lasting, Funniest Fucking Comment EVAH" graphic to hang on it.

Sorry, Lou.

Here you are.

Date: 2010/09/10 05:05:26, Link
Author: Amadan
Quote (Quack @ Sep. 10 2010,03:11)
Quote (Quack @ Sep. 09 2010,15:27)

In the house's smallest room before going to bed, the subject was still rummaging my brain and I got to thinking about a certain chimp researcher in Africa and all 'her' chimpanzees eternal search for and effort to get bananas. The only name that came up was Dian Fossey, probably because the story of her life made such an impression on me but googling today got me the name I knew was there, of course Jane Goodall.

I could have told you that!

Date: 2010/09/10 11:49:05, Link
Author: Amadan
Quote (sparc @ Sep. 10 2010,09:59)
Seems like nobody is willing to comment on the the newest detailed version of GilDo's conversion.
All this self centered self-pitying attitude of being one of the indiviually selected. It's just embarrassing to watch somebode embasing himself. Especially, if a cartoon for children is presented as the cause of ones personal epiphany.

Creationism: Science on a whinge and a prayer

Date: 2010/09/13 16:07:29, Link
Author: Amadan
Shriek!!!!

They're getting closer!!!


This guy's book is being launched by our esteemed "Minister of State at the Departments of Enterprise, Trade and Innovation, Education and Skills and Communications, Energy and Natural Resources with special responsibility for Science, Technology, Innovation and Natural Resources".

The esteened Conor Lenihan is definitely more at home towards the left side of the bell-curve. (He kisses babies, charms grannies, is the son of one Party Deity, nephew of another, and is the perhaps-not-quite-as-gifted brother of the Finance Minister. That's how we select ministers, folks).

On reflection, this will not work to the advantage of our intrepid author (read his web site and lose 5 pounds of those unsightly brain cells NOW!!!) or the bould Conor, who will cement his reputation as a genial idiot (Fr Dougal springs to mind).

So perhaps it's not such bad news after all. Not to mention the "Gorillas & Girls Party" after the book launch.


Hmmmmmm.  Gorillas . . .



Edit: H/T politics.ie

Date: 2010/09/14 09:06:33, Link
Author: Amadan
It is with deep sadness* that I inform my friends and colleagues that Ireland's contribution to The Academic Riposte to Darwin will not be graced by Minister Lenihan's presence. The author and promoter of the book launch withdrew their invitation in light of the "scurrilous" attacks on the Minister on the web.

The Minister is pleased to note that the headlines have now moved away from his contribution to Things Argued Really Deeply. The small matter of our Taoiseach being almost contagiously sub-meteorological on the radio this morning has distracted the proto-simians of the press like a shiny metal object.



* Really

Date: 2010/09/16 15:26:47, Link
Author: Amadan
Quote (Quack @ Sep. 16 2010,15:51)
Just wanna say hi! to our brave commuters. I don't know why, I don't understand anything of the game you are playing but nevertheless I get on the thread (not train) now and then just to see how you are faring. I even read the thread! So better watch your tongue.

It's not too complcated, Quack, as long as you disregard the unsporting (and, in historical terms, highly dubious) neo-Trellisites (yes, you Louis!) The DLR is for chavs and bankers, and is eschewed by gentlemen.

The object, of course, is to arrive at Mornington Crescent before the other players. You may use an Oyster card, but you must pay particular care to the zones for which it is valid and the area (in roods and perches) they cover.

The first thing to bear in mind is that left turns out of Knid must be followed by Northern or Central Line stations ordered by Fruitfield's Rule. Diagonal southings will incur two rounds in Ravenscourt Park unless the last preceding saint's day fell on a Thursday, Friday or (within three weeks of either equinox) the birthday of any person mentioned in the credits of Steven Seagal's Out For a Kill, though this is reduced to one round if the opposite player holds the Niblet Stick (under Magdalene Rules, that is: lapsarians ignore this rule for reasons that are obscure.)

"Round" moves are always preferable to Stonkers or Gobs, because they help avoid Heisenberg's Dillemma, whereby you must either move at a fixed speed or attend Mass.

But above all else, just enjoy the game for its simple pleasures.

Date: 2010/09/18 04:45:51, Link
Author: Amadan
It's the old cliché about the Cock-Up versus Conspiracy schools of history & politics. Regardless of religion etc there is always a temptation to reach for a Blame Button, preferably the one furthest away from you. I also think it appeals to our Curious George facility pattern-recognition: we want there to be A Solution because Shit Happens is just not satisfying.

Date: 2010/09/24 05:34:31, Link
Author: Amadan
Hmm. Opposite Speaker's Corner....

hence

Finsbury Park (which had the same traditional role, though the claim of privilege in defamation cases is, sadly apocryphal).

Date: 2010/09/24 15:29:39, Link
Author: Amadan
Quote (Seversky @ Sep. 24 2010,19:56)
Those with atavistic royalist tendencies, however, need to be reminded of how the will of the people as expressed in Parliament prevailed over that of the Crown.

Westminster!

Personally, I would have thought that Banqueting House would express the notion better!

Hence, Embankment

(over which I claim a profit à prendre, and you may all now savour the delights of Spoon)

Date: 2010/09/25 05:24:37, Link
Author: Amadan
Psssst! Rob!

The UD - da Vinci Code stuff was a satire.

Date: 2010/10/12 04:51:05, Link
Author: Amadan
How to interview politicians:

But first, some context.

It may have come to your attention that Ireland's financial situation bears comparison to that of Nagasaki Ultra-Delicate Crystal Souvenirs Ltd on August 10 1945. This came about in large part because of the tender affection and deep mutual regard among and between venal politicians, builders, and banks that Knew Better Than You and which were therefore Essential To The National Interest. (We shall gloss over the role of the supine gobshites who elected the said politicians.) The ensuing financial wreckage has inspired Our Betters to a brilliant solution: Let the people who didn't get us into this mess pay to get us out of it! Simple, and, above all else, In The National Interest.

Last week, a gentleman who imagined some sort of flaw in this compelling plan lodged a protest by driving a cement mixer truck into the gates of our national parliament at Leinster House. (He can expect a few weeks of prison time and to never have to pay for a drink again in his life.)

Madam K interviewed some of our Ruling Class at the scene, asking them in particular how we should (ahem) plug the deficit: (NQSFW, but nobody watches Youtube at work, do they?)

Enjoy!

http://www.youtube.com/watch?v=UyKzzpW5O7s

Date: 2010/10/13 10:45:41, Link
Author: Amadan
Also, you don't type when you're sitting nekkid at a computer.


Or so I'm told.

Date: 2010/10/16 07:01:17, Link
Author: Amadan
Quote (Badger3k @ Oct. 15 2010,23:59)
Quote (midwifetoad @ Oct. 15 2010,16:32)
Quote (Badger3k @ Oct. 15 2010,10:47)
 
Quote (Henry J @ Oct. 15 2010,10:13)
What, you mean actually seek out some breathtaking inanities? But I don't want my breath taken away; I need it!  :O   :p

So, no autoerrotic asphyxiation for you?

Well, there goes the wet suit I was going to get for your birthday. (ok, it's old, but still funny)

Some rabbit holes you just don't want to go down...

http://www.metro.co.uk/news....it-hole

If he can suffocate in a real rabbit hole, how can the IDiots survive where their heads are shoved up?

An abundant supply of ahem hot air.

Date: 2010/10/19 10:46:55, Link
Author: Amadan
J-Dog,

I remember a flurry of potery that night, but can't recall what prompted it. Was it the Davefenstration?

Date: 2010/10/20 09:36:55, Link
Author: Amadan
The world is a worse ummm better ahhhh . . . place without DaveTard.

Surely there must be some slimetrail trace of him somewhere?

Date: 2010/10/21 08:15:10, Link
Author: Amadan
Quote (keiths @ Oct. 21 2010,05:29)
Quote (keiths @ Oct. 20 2010,12:38)
Patterson said that when Dembski’s questionable statements came to light, he convened a meeting with Dembski and several high-ranking administrators at the seminary. At that meeting, Dembski was quick to admit that he was wrong about the flood, Patterson said.

Oh, to have been a fly on the wall at that meeting.

I think we need a dramatization.  Amadan?

At work. Will come up with something ASAP.

The Moment Demands It.

Date: 2010/10/21 09:38:25, Link
Author: Amadan
In the meanwhile, a favourite quotation:

 
Quote
O cruel needless misunderstanding! O stubborn, self-willed exile from the loving beast. Two gin-scented tears trickled down the sides of his nose. But it was all right, everything was all right, the struggle was finished. He had won the victory over himself. He loved Big Brother.

Date: 2010/10/21 09:46:19, Link
Author: Amadan
Indeed.

You could call it Flank's Law.

Date: 2010/10/22 04:24:24, Link
Author: Amadan
Happy Birthday Earth!

6014 years old at sunset today and doesn't look a day over 4.6 billion.

Have some cake:

Date: 2010/10/23 17:41:00, Link
Author: Amadan
Quote (Bob O'H @ Oct. 23 2010,23:04)
he keeps his integrity,

Citation required

Date: 2010/11/03 12:39:31, Link
Author: Amadan
Read and Weep at Your Leisure

Quote
On joining the staff of Trinity [College, Dublin], [Sir Terry] Pratchett will now find out what academic life is really like from the inside.

He will give his first lecture next Thursday (4 November) and will focus on creative writing and popular literature for post-grad students.


... and I shall be among them, having blagged a ticket!

Date: 2010/11/04 18:52:32, Link
Author: Amadan
Quote (BillB @ Nov. 04 2010,23:17)
Hmmm. Handed in my corrected and neatly bound PhD thesis today ... all thats left is to don a silly outfit and collect a piece of paper whilst my parents try not to cry... maybe I'll post some photos!

Teh Fowndin Fathurs dint nead pHds.

You Mooslum r sumthin?

Date: 2010/11/05 12:11:17, Link
Author: Amadan
The only absolute is Heat Death (Unless someone has evidence to the contrary?)

Date: 2010/11/05 12:22:27, Link
Author: Amadan
USAian food has reached new heights of nutritional excellence too.

Date: 2010/11/10 07:29:15, Link
Author: Amadan
Quote (carlsonjok @ Nov. 10 2010,12:31)
Shorter KF: I have nothing to add to what others say, but will be sure to not add anything in as many words as possible. (906 words to be exact.)

Followed by:
Footnote:
F/N 2:
Null:
F/N 3:
Null:

For an additional 688 words.

The man must still be saying "Good night" to his poor wife when she's making the breakfast.

Date: 2010/11/11 05:48:47, Link
Author: Amadan
What this really means is that goddidit.

Genes Still Adapting in Effort to Beat Cancer

Date: 2010/11/11 09:09:17, Link
Author: Amadan

Date: 2010/11/12 10:41:53, Link
Author: Amadan
Quote (Louis @ Nov. 12 2010,16:00)
Quote (fnxtr @ Nov. 12 2010,14:59)
Quote (Louis @ Nov. 12 2010,02:17)
 
Quote (Henry J @ Nov. 12 2010,01:32)
 
Quote (MadPanda @ FCD,Nov. 11 2010,16:11)
You almost lost your virginity on a fig?  (blinka blinka)  There isn't a lot of room on top of one of those things...

:D


The MadPanda, FCD

Well that's plum silly!

Orange you glad we aren't going to make a pun cascade out of this?

Louis

Yes it's become a fruitless excersize.

The entire thing will turn into a lemon*, you know it will.

Louis

*Is this obscurish (perhaps British) colloquialism suitable?

Kumquat may, we'll find a pun for it.

Date: 2010/11/15 07:49:41, Link
Author: Amadan
Gil isn't afraid to probe the hard questions:


PS Note the lamp on the piano. Significant, eh?

Date: 2010/11/15 11:20:01, Link
Author: Amadan
Quote (Badger3k @ Nov. 15 2010,16:40)
Is this a Liberace reference, or am I missing something?

Yes and Yes*





* according to Louis's mum


ETA Cheap joke. Just because they're tired and wheezy doesn't mean they don't need an outing every now and again.

Date: 2010/11/16 10:09:53, Link
Author: Amadan
Quote (Zachriel @ Nov. 16 2010,12:51)
Beethoven had been a rotting corpse for years. Just people pretended not to notice the smell. (Sorry, Ludwig, but it's true. They did that to you.)

Perhaps the greatest decomposer of all time.

Date: 2010/11/17 08:12:05, Link
Author: Amadan
"Children", my mother used to tell me "are their grandparents' revenge".

Congratulations. I'm a bit disappointed nobody thought of a nice Irish girl's name like Gobnait* Concepta** or Sophie***




* Pronounced gub nit. Common in Co. Kerry.

** Pronounced Septa! C'meeyah an lookah de airse on dis fella!. Vulgar Common in North Dublin

*** Pronounced EwMyGawd Sewfy. Nawt, loik, common at allll? But Daddy droives a big Beemer? And always speaks in, loik, questions?

Date: 2010/11/18 06:43:27, Link
Author: Amadan
WHO'S PAYING YOU TO SAY THAT, EH?

Date: 2010/11/18 07:59:59, Link
Author: Amadan
They're here in Dublin now.




ETA linky

Date: 2010/11/18 15:38:31, Link
Author: Amadan

Date: 2010/11/18 16:40:21, Link
Author: Amadan
Quote (Maya @ Nov. 18 2010,21:38)
 
Quote (Louis @ Nov. 18 2010,14:38)
I'd have a beer with Dembski, if only to ask about his sweaters.

I'd have a beer with Dembski, but I probably couldn't resist the temptation to slip him a mickie and get some artistic photos of him with farm animals.

ETA: Please don't Photoshop my idea, Amadan!

...shudder...

Date: 2010/11/19 09:43:43, Link
Author: Amadan
Quote (oldmanintheskydidntdoit @ Nov. 19 2010,14:51)
Quote
[URL=http://www.uncommondescent.com/intelligent-design/the-earth-not-our-mother-not-our-sister-not-a-living-thing-but-our-treasure-trove-our-obse

rvatory-our-library-our-spaceship-and-our-home/#comment-367747]StephenB: [/URL]If the universe shows evidence of having been designed for life—and if life exists as a hierarchy such that elements nourish plants, which in turn, nourish animals, which in turn, nourish humans—that fact alone points to a human centered creation.


And if it should turn out the planet earth is just a long term "farm" for aliens to grow tasty humans...

... and as Dmitri von Tennyson pointed out, we are all worms' meat.

I, for one, welcome out annelid overlords.

Date: 2010/11/19 11:27:16, Link
Author: Amadan
"If you invent something idiot-proof, they'll invent a better idiot."

Date: 2010/11/22 15:09:43, Link
Author: Amadan
Prof. Pratchett's Inaugural Lecture!

And yes, I was there, about 3m to the right of the camera.

Date: 2010/11/22 15:10:41, Link
Author: Amadan
Quote (OgreMkV @ Nov. 07 2010,17:55)
Finally got Surface Detail, Iain M. Banks latest Culture novel.

Since the book is really about heaven and hell in technological societies, I thought this passage very telling.

 
Quote
Almost every developing species had a creation myth buried somewhere in its past, even if by the time they'd become space-faring it was no more than a quaint and dusty irrelevance (though, granted, some were downright embarrassing).  Talking utter drivel about thunderclouds having sex with the sun, lonely old sadists inventing something to amuse themselves with, a big fish spawning the stars, planets, moons and your own ever-so-special People - or whatever other nonsense had wandered into the most likely feverish mind of the enthusiast who had come up with the idea in the first place - at least showed you were interested in trying to provide an explanation for the world around you, and so was generally held to be a promising first step towards coming up with the belief system that provably worked and genuinely did produce miracles: reason, science and technology.


I dare any religious person to defy that reason, science and technology are provably better than whatever beliefs that they hold to.

JUst read it. Wocha think?

Date: 2010/11/29 01:39:28, Link
Author: Amadan
Quote (OgreMkV @ Nov. 28 2010,23:49)
Quote (Amadan @ Nov. 22 2010,15:10)
 
Quote (OgreMkV @ Nov. 07 2010,17:55)
Finally got Surface Detail, Iain M. Banks latest Culture novel.

Since the book is really about heaven and hell in technological societies, I thought this passage very telling.

   
Quote
Almost every developing species had a creation myth buried somewhere in its past, even if by the time they'd become space-faring it was no more than a quaint and dusty irrelevance (though, granted, some were downright embarrassing).  Talking utter drivel about thunderclouds having sex with the sun, lonely old sadists inventing something to amuse themselves with, a big fish spawning the stars, planets, moons and your own ever-so-special People - or whatever other nonsense had wandered into the most likely feverish mind of the enthusiast who had come up with the idea in the first place - at least showed you were interested in trying to provide an explanation for the world around you, and so was generally held to be a promising first step towards coming up with the belief system that provably worked and genuinely did produce miracles: reason, science and technology.


I dare any religious person to defy that reason, science and technology are provably better than whatever beliefs that they hold to.

JUst read it. Wocha think?

All I have to say about the ending it What The Fucking, Goat-Humping, Sheep-Raping, Sexual Encounter With a Three Week Dead Sperm Whale Was That?>!??!?!?!?!?!?!?

Zakelwe was before the Iridian War, that was like 2000+ years ago.  

Crap, now I have to go read all the damn things again.

It all felt either a bit thrown together or something. A  few good ideas (and ship names!) but a bit of a mish-mash.  I preferred Matter.

Date: 2010/12/01 06:16:54, Link
Author: Amadan
Quote (Louis @ Dec. 01 2010,09:43)
Actually I know they're not, they're just like everybody else, a wonderful human smorgasbord. But dammit, jingoism and nationalistic stupidity isn't about accuracy is it? It's about the pointless, ratty exchange of unexamined prejudice and the trading of common stereotypes. I mean, where would we be if we sat back and carefully examined our own failings and shortcomings before entering into conversation with a light heart, a view to dialogue and a determination to use reason at all times? Nirvana, that's where. And who wants that? It would ruin the economy for starters.

Typical Brit.








If only they'd followed our example, they'd be so grateful. I mean, in our debt...

Date: 2010/12/01 11:10:43, Link
Author: Amadan
Don't get me started on Dem Feckers in Guvermint. There may be children reading this.


But enough of these childish fantasies. Important tardology to be done!

Date: 2010/12/01 12:32:14, Link
Author: Amadan
Quote (Louis @ Dec. 01 2010,17:48)
 
Quote (Richardthughes @ Dec. 01 2010,17:26)
Gobshites? Is scouse permeating the vernacular?

No, but Irish is. I think our chums from the Emerald Isle have a prior claim on the term.

Louis

Scouse?

You mean the dialect spoken in our colonial capital 60 miles to the east?

PS it may be your language (and your money, to address the Burning Issue du jour, but by feck we'll colonise the two of 'em!

Subversion! Ireland's greatest native talent!


Ed: Orthographe

Date: 2010/12/02 09:51:08, Link
Author: Amadan
A fnew ppints cn RILLLEYmesh up yuor spl . . . psellign . .  .'way yo write stuff . . .*hic*

Date: 2010/12/04 03:58:56, Link
Author: Amadan
Doesn't California have one of those provisions? And isn't that the reason why it's bankrupt?

There are times (in business, government, or while pursuing a bout of Bedroom Olympics with Lasciviella in the photocopying dept) whe it is necessary to borrow beyond your immediate means.

This is the same old GOP 'Starve the Beast' politics. Cut everything except (a) the military budget and (b) local pork.

Date: 2010/12/04 19:09:17, Link
Author: Amadan
That's because politics in this world of ours is a playground for egotists and masochists. Power lies elsewhere.

Perhaps it always has.

Date: 2010/12/07 12:14:15, Link
Author: Amadan
Quote (Louis @ Dec. 07 2010,15:48)
Maybe Stephen B can furnish us with a complet Shaggers Charter on detailed acts that we can perform and precisely the level of enjoyment that we can obtain by doing so without getting all pervy.

Ah, someone I met somewhere* suggested that an illustrated Charter showing what we can't do would be useful to, ah, stop us doing it. Yeah.



*Similar to, but not necessarily the same as Louis' friend**.

** No, not you Arden.

Date: 2010/12/13 05:14:53, Link
Author: Amadan
Quote (Woodbine @ Dec. 13 2010,08:06)
Quote
Artificially generating a new human life in a Petri dish in a laboratory is an ugly, mechanical, inhuman act, which divorces the act of love from the procreation of new life. That’s no way to make a baby.

Puts that whole virgin birth thing into perspective.

What did you average Roman-era Jew use instead of a turkey-baster?

"Joshua, I have to tell you that you're a goat-ladle baby..."

Date: 2010/12/13 09:38:56, Link
Author: Amadan
Quote (JonF @ Dec. 13 2010,00:55)
Buttock-cupping: A New Form Of Alternative Medicine?

Cheeky!

Butt I couldn't really be arsed.

Date: 2010/12/14 04:00:50, Link
Author: Amadan
Beautiful plumage. you have to admit.

Date: 2010/12/14 04:05:47, Link
Author: Amadan
Well, that's me convinced.

Date: 2010/12/14 10:34:08, Link
Author: Amadan
The Wonders of Modern(ish) Technology!

Date: 2010/12/16 11:49:50, Link
Author: Amadan
Quote (Richardthughes @ Dec. 16 2010,15:23)
The trick they've missed is reprinting the guff from the old rags. They could create a new journal each time.. and nearly fill it.

This is the secret behind brides and babies magazines. Those 20 hot tips for seating ex-spouses and their squeezes without offending your new in-laws, or sure-fire ways of knowing which end of your offspring you're meant to speak to, are only of interest to one-time buyers: anyone who's been around the block in question isn't particularly bothered to read it all again.

As a result, you can happily recycle articles with minimal editing and a few new glossy photos. I had a publisher for a client who specialised in it and paid lots of lovely fees to me. Happy days indeed.

Date: 2010/12/20 03:58:27, Link
Author: Amadan
Cool!

Quote
THE FACT that dawn sunlight will beam into the passage grave at Newgrange tomorrow at the very moment that a full moon begins to pass out of a total lunar eclipse is a remarkable and rare coincidence, according to Prof Tom Ray, an astronomer at the Dublin Institute for Advanced Studies.

“It is the first time it has happened in about 450 years so that is a coincidence enough. The Tudors were in power in England at the time,” he said.

It is even more remarkable that light from the sun and the moon will appear together, with the first sunbeams at dawn coming just as the moon emerges from eclipse.

“That will happen at exactly eight minutes to nine. The two happen to coincide to within a minute.”

This kind of connection is unbelievably rare, Prof Ray said. “It would not have occurred since Newgrange was built.”


Of course, we all know that this was prophesised in thuh Babble

Date: 2010/12/20 04:31:39, Link
Author: Amadan
Quote (MadPanda, FCD @ Dec. 20 2010,01:08)
So of course I had to resort to an unfortunate excess of e e cummings in self defense.  

That is hardly a capital offence.

Date: 2010/12/20 10:07:42, Link
Author: Amadan
Quote (dvunkannon @ Dec. 20 2010,13:52)
Quote (Amadan @ Dec. 20 2010,04:58)
Cool!

 
Quote
THE FACT that dawn sunlight will beam into the passage grave at Newgrange tomorrow at the very moment that a full moon begins to pass out of a total lunar eclipse is a remarkable and rare coincidence, according to Prof Tom Ray, an astronomer at the Dublin Institute for Advanced Studies.

“It is the first time it has happened in about 450 years so that is a coincidence enough. The Tudors were in power in England at the time,” he said.

It is even more remarkable that light from the sun and the moon will appear together, with the first sunbeams at dawn coming just as the moon emerges from eclipse.

“That will happen at exactly eight minutes to nine. The two happen to coincide to within a minute.”

This kind of connection is unbelievably rare, Prof Ray said. “It would not have occurred since Newgrange was built.”


Of course, we all know that this was prophesised in thuh Babble

I'm not getting the distinction in rarities that the professor is making.

Newgrange * dawn * solstice * lunar eclipse  = once in 450 yrs

?? = not since Newgrange was built

Plus, exactly what is the force of  
Quote
light from the sun and the moon will appear together, with the first sunbeams at dawn coming just as the moon emerges from eclipse


If you were in the Newgrange chamber, you wouldn't see the moon. It would be setting behind you, with tons of rock and dirt between you and that horizon.

I take it that precession of the equinoxes does not affect sites such as Newgrange. The solstice dawn hapens at the same point on the horizon, no matter what day the solstice happens to be.

What's rare is the coincidence of the eclipse and solstice dawn. As the eclipse ends you'll just have enough time to get inside, scramble down the passage and turn around to see the sun light up the inside.

Mind you, you have to be lucky to win a place in there for the morning of the solstice. (There's a lottery of some sort, places are liable to be gazumped by visiting dignitaries etc etc) The rest of us mere peasants have to make do with the simulated dawn they do with electric lights six times a day on the tours.

Date: 2010/12/23 18:14:14, Link
Author: Amadan
The late lamented John Wadham was brought in at one stage to try to teach Larry Mullen of U2 which end of the stick he was meant to hold.

The great man's verdict on Larry:

Quote
That eejit doesn't have enough rhythm to masturbate.

Date: 2010/12/31 06:11:28, Link
Author: Amadan
A quick flashback to Behind the Bike Shed, circa 1973:

Quote
Mary had a little sheep
And with that sheep she used to sleep.
The sheep turned out to be a ram
And Mary had a little lamb.


Happy 2011, omnes!

Date: 2010/12/31 19:03:20, Link
Author: Amadan
Sod that, I'll settle for lolcatz and dirty limericks.

But Happy 2011 anyway.

Date: 2010/12/31 19:09:10, Link
Author: Amadan
P.S.: Speaking of dirty Limerick[s], I have to be fairly sure that this will be utterly incomprehensible to fardners generally, the Limerick accent being not noted for its elocutionarily crystal nature. But it is a quite lovely tribute to to skanger culture, and for this we shall be grateful.

PPs: and to its credit, there was a huge campaign to have that song boosted to be the Christmas No. 1 ahead of of the Onanist du jour who won the X-Factor. Nearly won, too, as far as I know.

Date: 2011/01/05 02:02:26, Link
Author: Amadan
Quote (fnxtr @ Jan. 05 2011,05:27)
Quote (Wolfhound @ Jan. 04 2011,21:02)
To make up for my feelings of Heinz 57 inferiority...

Think of it as "hybrid vigour". ;-}

Or as Dave Hawkins calls it, 'genetic richness'. As I vaguely recall, Noah had a few hundred alleles for everything from eye colour to different flavours of haemoglobin. Sadly, it's all been whooshed away since then.

Date: 2011/01/05 13:50:37, Link
Author: Amadan
I was an apprentice in a solicitors' firm run by a distant cousin. In the 1930s the firm had represented an unpleasant character (a clockmaker here in Dublin, a German immigrant) who objected to a new tenant who was Jewish. In a landmark case that stands as a tribute to Irish Catholic legal principles, Herr Schlegel won, it being found by the High Court that anti-semitism was a "reasonable ground" for the rejection of the assignment.

Of course that would have no standing today, but the kicker comes with the story of my great grand-aunt (or thereabouts), sister of the founder of that firm. She took it into her pretty head about that time to do some genealogical research. The exercise came to an undignified halt and was Never Mentioned Again after she ran across the Tel Aviv branch of the family.

This still causes me to cackle with malevolent laughter.

Date: 2011/01/07 02:07:45, Link
Author: Amadan
If someone says "kill me now" to you three times, you'll have to do it.

Date: 2011/01/10 09:27:29, Link
Author: Amadan
Quote (dvunkannon @ Jan. 10 2011,13:00)
What good is an explanation (Nature exists because...) if it is attached to an obviously wrong description (World is 6000 years old, rides on back of turtle, etc.).

Heretic!

Date: 2011/01/26 11:20:44, Link
Author: Amadan
The fact that a UD in-patient actually espouses inflation (and, by implication, the Big Bang) is what strikes me as worthy of comment - preferably by a suitably outraged sock. (Alas, mine are all holed below the ankle-line!)

Date: 2011/01/28 08:29:40, Link
Author: Amadan
Louis,

do they use the phrase "pulling the wire" (same meaning) over there in Perfidious Albion, or is it confined this German colony?

Date: 2011/01/31 11:24:30, Link
Author: Amadan
Evolution: Doing the same thing over and over, expecting the same results, and getting different ones.

Date: 2011/02/02 07:10:03, Link
Author: Amadan
Quote (sparc @ Feb. 02 2011,05:15)
Quote
21
GilDodgen
02/01/2011
10:42 pm

Jimpithecus: “Dr. Dogen writes:”

Thanks for the honorary Ph.D.! I’ve always wanted one. Unfortunately, my three college degrees are in music (concert pianist) and foreign language and literature (French).
Dumbest Asshat EVER.

Lemme guess: the third one was for something to do with sequins?

Date: 2011/02/07 04:52:51, Link
Author: Amadan
Quote (CeilingCat @ Feb. 07 2011,08:14)
What the hell is she thinking of when she writes crap like that?

... and herein we glimpse the kernel of the answer.

Date: 2011/02/10 06:26:35, Link
Author: Amadan
The real question is where KF's opus rates on the Bristol scale.

Date: 2011/02/10 09:53:32, Link
Author: Amadan
ID: it's a Movement!

Date: 2011/02/18 04:44:45, Link
Author: Amadan
Oh dear. Our National Voice of Ignorant Indignation, Kevin Myers (no relation) has caught a dose of the O'Leary's:

Quote
Why did the human brain create such vast capacities, in advance? How did it know how to repair itself? How did it create an entire language region that knows how to both create and understand the impossible complexities of linguistic grammar -- universal to all peoples -- which other parts of the brain are able to emulate after cerebral injury to the language area?

...

Can it be that when the founding cells of life were formed, someone, or something, planned for a rainy day or two? Yet such is the dogmatic power of the secular religion of Natural Selection that even to ask such logical and obvious questions is to court ridicule, in this New & Liberal Age of Enlightenment.

Date: 2011/02/18 15:35:27, Link
Author: Amadan


HB

Amadán

Date: 2011/02/21 03:46:46, Link
Author: Amadan
Quote (Amadan @ Feb. 18 2011,10:44)
Oh dear. Our National Voice of Ignorant Indignation, Kevin Myers (no relation) has caught a dose of the O'Leary's:

 
Quote
Why did the human brain create such vast capacities, in advance? How did it know how to repair itself? How did it create an entire language region that knows how to both create and understand the impossible complexities of linguistic grammar -- universal to all peoples -- which other parts of the brain are able to emulate after cerebral injury to the language area?

...

Can it be that when the founding cells of life were formed, someone, or something, planned for a rainy day or two? Yet such is the dogmatic power of the secular religion of Natural Selection that even to ask such logical and obvious questions is to court ridicule, in this New & Liberal Age of Enlightenment.

Update: A response to that nonsense appears today, penned by some remarkably clever and insightful chap.

Date: 2011/02/22 03:49:10, Link
Author: Amadan
Proof of design! But how will Densye explain the Designer's appalling attitude towards the Sacred Laws of Private Property?

Date: 2011/02/22 08:05:33, Link
Author: Amadan
Except the Mooslum bit, of course

Date: 2011/02/22 10:50:19, Link
Author: Amadan
Hmmm. But I thought homeopathic remedies were most effective when you don't take them.

Date: 2011/02/24 10:47:18, Link
Author: Amadan
Quote (k.e.. @ Feb. 24 2011,16:06)
respect

EVOTARD!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

And thus does the hate-filled voice of blind materialist dogma reinforce its bloated "peer-reviewed" groupthink, despising honest intellectual enquiry, wrapping lies around a skeleton of snivelling innuendo and meretricious mendacity, the whole saturated with a laving of catachrestic distortion and torched upon a pyre of invective spewing from the pseudo-rational maws of miseducated dilettantes lorem ipsum dolor Lewontin sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna CPSCI aliqua. Ut enim ad minim veniam, FCSCSI quis nostrud exercitation ullamco laboris nisi ut aliquip ex ea commodo consequat. Duis aute irure dolor in reprehenderit Lewontin in voluptate velit esse cillum dolore eu fugiat nulla pariatur. Excepteur Lewontin sint occaecat cupidatat non proident, sunt in culpa qui officia deserunt mollit anim id est laborum TCASRDI Lewontin.

PS: Lewontin.

PPS: Thanks all.

PPPS: Wot no locatz?

Date: 2011/02/24 11:04:13, Link
Author: Amadan
I truly appreciate the gesture, J-Dog. Sadly, I shall decline your offer of Baileys.

Kevin Myers (whose Densyesque ramblings I deplored here recently) has, in fairness to him, the occasionally marvelous turn of phrase. He once characterised Bailey's (a mixture of cheap whiskey and room-temperature ice-cream) as having "the appearance and texture of something that oozed from an old war wound."

Date: 2011/02/24 11:23:47, Link
Author: Amadan
Cause and effect.

Date: 2011/02/25 17:44:20, Link
Author: Amadan
Quote (Kristine @ Feb. 25 2011,21:34)
[quote=Amadan,Feb. 24 2011,10:47]  
Quote (k.e.. @ Feb. 24 2011,16:06)

PS: Lewontin.

PPS: Thanks all.

PPPS: Wot no locatz?


Cauze I R bizzy baking you caek!



There. Caek fall now. Hope you R happy on YR happy birfday (wifout caek)!

No, you can't has shimmy for your birfday. Not yours. ;)

Wontz shimmmmmie!!!!!!!!!!!

Date: 2011/02/25 17:49:45, Link
Author: Amadan
Quote (J-Dog @ Feb. 25 2011,18:54)
It's a good thing I'm done having kids,

... you're speaking for  Mrs J-D, presumably.

PS: Vonda in Accounts asked me to remind you about the Christmas party approximately 9 weeks ago. She seemed a bit upset.

Date: 2011/02/25 17:56:10, Link
Author: Amadan
Quote (Dr.GH @ Feb. 25 2011,23:39)
Three cheers for dvunkannon!

1
2
3

I have a headache, and so I cheered very softly.

Seconded.

It was a marvellous birthday dinner (excuse reference to another thread) and I too am somewhat sub-meteorological.

Date: 2011/02/27 14:37:55, Link
Author: Amadan


Thankz waz grait party uuuuuuurgggggghhhhhh

Date: 2011/03/09 04:09:59, Link
Author: Amadan
Good to see that someone is doing important scientific work.

So, what are the chances of that happening by random coincidence, eh, evilushinists?

Date: 2011/03/09 10:17:32, Link
Author: Amadan
Anyone know what's up with Scienceblogs?

Date: 2011/03/10 16:04:37, Link
Author: Amadan
40? Is that all??

Mere pup! cub! whatever...

Happy Birthday.

And happy afterbirth day tomorrow.





ewww

Date: 2011/03/14 07:37:23, Link
Author: Amadan
Sure you didn't mean "Schlump"?



If so, you should be aware that the Lancaster Approach is unlikely to endear you to the natives.

Date: 2011/03/16 14:50:33, Link
Author: Amadan
Igloogle?

Date: 2011/03/16 14:56:13, Link
Author: Amadan
SD: You and your lot have been ahem exposed by the ever-vigilant Rapture Ready!
 
Quote

Not only does France have nudity in their commercials and nude beaches, they have commercials for nude beaches. I'm not joking.

Truly a depraved culture. Honestly if I find out someone's French I assume the worst.


So don't mind him Arden & Louis. He probably wasn't wearing anything under his clothes when he wrote that.

Date: 2011/03/17 18:16:11, Link
Author: Amadan
Crap to creo?

Date: 2011/03/20 05:11:38, Link
Author: Amadan
So sorry, Louis,




tee hee...

Date: 2011/03/20 11:43:20, Link
Author: Amadan
Sorry about that J-Dog.

I was linking to a picture of Brian O'Driscoll scoring a try in the rugby yesterday when Ireland beat England 24-8, sadly preventing England from winning a Grand Slam in the 6 Nations. Unfortunately the picture I linked to (which showed one of the tries that led to Ireland beating England 24-8 and stopping them winning a Grand Slam) doesn't appear to be hot-linkable. Instead of that, please accept this picture of some avid sports fans:



Judging by the apparel it must be very warm there, so I doubt that they were in Lansdowne Road yesterday to watch Ireland beat England 24-8 and stop them winning a Grand Slam. But no doubt they would join Louis and me in celebrating a magnificent sporting occasion that should be enjoyed in a generous, magnanimous spirit and in the Corinthian tradition of not lording it over the hapless defeated wretches sent skulking home with their arrogant tails planted firmly between their collective legs by the victorious boots of their righteous vanquishers..

ETA: And it would be crass and insensitive to mention the cricket...

Date: 2011/03/20 14:04:56, Link
Author: Amadan
Quote (Louis @ Mar. 20 2011,19:22)
We still won the tournament though.

What a begrudging, bitter, poor-loser remark.

Date: 2011/03/20 18:40:36, Link
Author: Amadan
Tell you what. Why don't we laugh at the French instead?

Date: 2011/03/20 18:43:27, Link
Author: Amadan
PS Well done England on the winning the championship. Looking forward to welcoming Bessy Battenberg over in May.







[Mutters] Cromwell 800 years of oppression plantations 6 counties etc etc etc etc

Date: 2011/03/21 06:08:19, Link
Author: Amadan
... and one of my great-grandfathers was English.

Why can't everyone just get on??? Or at least not be German?

Date: 2011/03/21 09:55:37, Link
Author: Amadan
Quote (k.e.. @ Mar. 21 2011,15:19)
As for teh Irish beating Ingerland ...should have happened in 1169. They're nothing but frikken cheese eating Normans.

Our approach is much more futile subtle.

We cunningly let them rampage all over us for the best part of a millennium, throwing in a doomed rebellion every 80 years or so to distract them. We ditch our native language and adopt theirs, but use it in a manner that they'll never feckin cop on to. Disorientation (Latin: to deprive someone of an eastern half) is the name of the game: make them focus attention on troublesome cousins to the West.

In the meanwhile, we slyly infiltrate their country to the extent that something like 25% of their population has an Irish granny. This allows us to outsource our football breeding and training programmes for all the bloody good it ever does us.

Then, when they least expect it, we strike! Beating them at cricket. Few plans have been so patiently nurtured, or for so stupid a result. But it was fun.

This is a sign that the End Times are upon us, you know.

Date: 2011/03/21 18:04:12, Link
Author: Amadan
All this national self-effacement must not go unmatched!

Ladies and CBEBs, I give you

The Irish National Debt Clock!

(definitely not for the faint-hearted)

Date: 2011/03/22 04:41:53, Link
Author: Amadan
Quote (George @ Mar. 22 2011,01:30)
Quote (Amadan @ Mar. 21 2011,18:04)
All this national self-effacement must not go unmatched!

Ladies and CBEBs, I give you

The Irish National Debt Clock!

(definitely not for the faint-hearted)

Oh, holy God.  I wish I hadn't seen that.  Why doesn't pressing ESC repeatedly, really hard MAKE THE DAMN THING STOP?

That feature was decentralised.

(Irish political in-joke)

Date: 2011/03/22 09:37:56, Link
Author: Amadan
Quote
Just as I wouldn’t be the person who I am if I’d had different parents, so too I wouldn’t be the same individual if I’d been originally created in Heaven instead of on Earth. I’d be someone else.


I was actually a beautiful, intelligent baby. But the gypsies swapped me.

Date: 2011/03/22 17:05:23, Link
Author: Amadan
The Shimmering Memsahib of Shimmies!

A year more ageless.

I'd never have noticed.


Now go out and get pleasantly plastered and pick a fight - on me.

Date: 2011/03/23 11:04:02, Link
Author: Amadan
It strikes me that any religion that needs a Fiery Pit of Doom is banking on its followers not having any sort of moral compass. People who think about morality do good because it is good, not because they need trainer wheels.

And what value does Hell have as an incentive to worship a god? A confession made under the threat of torture is not admissible in evidence - in civilised countries, at least. Perhaps things are different where Kevin comes from.

Date: 2011/03/25 05:27:40, Link
Author: Amadan
So if I'm following Kevin's reasoning,* the good or bad, right or wrong, even the up or down of anything in the universe (or to cut it down to a manageable scale, the human bit of it) can only be evaluated by invoking an external reference point.

Why is that, Kevin? Is it intrinsic in the ideas of 'good' or 'right' (or 'up' for that matter)? Is an external reference point needed for any logical argument, or just moral ones?

And how do you know that? By use of reason? A slight logical problem there, donchathink? (Hint: "a way a lone a last a loved a long the | riverrun, past Eve and Adam's, from swerve of shore to bend of bay, brings us by a commodius vicus of recirculation back to Howth Castle and Environs.")

And if we were to concede the need for an external reference point, can tell us how you identify it? Does it just happen to resemble one you were immersed in since childhood, that you identified with in your adolescence and adult** life, and that you have built your social and working life around since then? Just asking.

Assuming for the sake of this discussion that deity-free reasoning has the rigour of blended jellyfish, why do those of us who don't belong to your club still manage to learn our multiplication tables (at least six times out four, anyway)?

And finally, why are we promised a long career shovelling coal after we die for (a) seeing how specious your argument is and (b) treating it accordingly?



* Tee hee


** Don't, Louis. It's not worth the effort.

Date: 2011/03/25 09:19:47, Link
Author: Amadan
Quote (Robin @ Mar. 25 2011,14:04)
Further, I double dog dare you to insist that sodium and chloride sitting in separate jars are the same thing as salt.

And so we identify the roots of Kevin's problems:

- defective seasoning
- waging an assalt on Enlightenment values
- his history as a cellar of propagandumentaries

No wonder his last film barely made a wooden nacl.

Date: 2011/03/25 19:55:39, Link
Author: Amadan
Scene: The Kitchen of Chateau Fermat

Enter MathSculleryWench

MathSculleryWench: The Maitre's theorem is unproven!

Chevalier du Tard: Tais toi, subservient reproductive facility! 'Tis written in the margin of Scripture that a proof exists.

MathSculleryWench: But...

Chevalier du Tard: Your uncivil protestations prove your incomprehension! Get thee hence to a bunnery or some similar culinary facility.

Madame de Concombre: Treat not this maid thusly, for 'twas I who invited her in!

Chevalier du Tard: Discipline the bint! You exceed your minimal mandate to provide hot beverages, person of socially esteemed third generationalhood!

[Upstairs, Fermat reaches for a fast-depleting bottle of Caledonian Single]





Date: 2011/03/27 06:37:57, Link
Author: Amadan
Could this be the (ahem) Last Battle?

Date: 2011/03/28 01:49:49, Link
Author: Amadan
Are they not hiring [wannabe] lawyers, community college accounting teachers or such like any more?

Standards are going to Hell ermmmm... improving ahhhhh much the same, so.

Date: 2011/03/28 09:38:45, Link
Author: Amadan
Interesting comment on all this by Joe Felsenstein over at PT:

Quote
[Dembski's Law of Conservation of Complex Specified Information] has been shown to be (a) unproven, and (b) of the wrong form to do what he needs it to do. And if it is put in the right form it is easily seen to be wrong.

That’s where the real body is buried in Dembski’s argument, and all the attempts to show that everything else is wrong too actually don’t help – they just distract from understanding where the real problem is in the argument. I would be interested in seeing whether Dembski could make any defense of his argument on this point (so far he has declined to, pointing instead to later arguments of his that are not about the same thing at all).

The fact that MathGrrl, as admirably as she has conducted herself, felt that the point to concentrate on was whether CSI could be precisely defined shows to me that anti-ID people have not understood the importance of concentrating on the issues involving the LCCSI.

Date: 2011/03/28 10:39:10, Link
Author: Amadan
Quote (Badger3k @ Mar. 28 2011,04:08)
Thanks again, everyone - big double-four for me (44, in case someone wants to calculate the CSI IQ for Joe).

FTFY.

Furry happy afterbirthday to you, Bro[c].

Date: 2011/03/29 17:49:43, Link
Author: Amadan
I get the impression that Mathgrrl is in a position (I hope she'll forgive an unflattering comparison) similar to the society grande dame who asked Louis Armstrong what jazz is. "Lady, if you have to ask, you'll never know!"

Design/Specification/Complexity/Salvation is in the <organ of choice> of the Tardholder.

Date: 2011/03/30 05:33:44, Link
Author: Amadan
A little seasonal light relief:

The Ten Best April Fool Hoaxes.

Mind you, there is more than a little scope for some Culture Jamming in a place we know and love know...

Date: 2011/03/30 05:36:56, Link
Author: Amadan
Quote (Erasmus, FCD @ Mar. 30 2011,06:44)
tgpeeler provides an example of what i was trying to say a few posts above

 
Quote
403
tgpeeler
03/29/2011
3:00 pm
mg @ 392 “There are a number of information theorists who would beg to differ.”

I’m sure there are. They’d be wrong, too. I will say again, boldly, if I may, that it is IMPOSSIBLE to account for the phenomenon of information in terms of the laws of physics.

Why do I say this? Because symbols, rules (language), rationality (logic), free will (freely assembling symbols according to the aforementioned language specific rules and laws of rational thought), and intentionality (for a reason, to communicate a message) are ALL necessary for human information/communication. Materialism or naturalism or physicalism, whatever ilk your particular version is, all fail to account for human language and information because the only “tool” they have to explain anything and everything are the laws of physics (embarrassingly, they happen to be immaterial but I’ll leave that alone for now).

Therefore, as metaphysical projects, all of these “isms” utterly fail. The “assumption” that the natural or material or physical is all there is is clearly and obviously false. Whatever incarnation of the naturalistic story of life is currently being discussed is just false. They are all false. It is impossible for any naturalistic account of life to be true. Anybody who can string a couple of thoughts together should be able to track this with no problem. I know this includes you. So if I’m wrong, tell me how I’m wrong. Then I’ll change my mind. But until you bring an actual argument to rebut the argument I’m making I’m afraid I will remain unmoved in my opinion that trying to explain information of any kind without symbols and rules is sheer lunacy.

If you would STOP and THINK about this for a moment before dashing off a dismissal of one kind or another, you would see that I am correct about this. Analyze your own posts. Do they not obey (generally) the laws of reason? Yes. You make use of the law of identity. Do you not freely use English symbols, arranged according to arbitrary convention, to purposefully communicate a message? Yes, you do.

I get it that this is a bold claim. Perhaps even grandiose. But that doesn’t make it any less true. The materialist project is defeated. That game is over. You can restart it by communicating something without using a language. Good luck with that.


This is the same ontological silly boogers game that Frill likes to play, where he winds up stuck with "you can't simulate gravity without having the computer fall out of the airplane".

Like, "this shit over here is not material and nothing known about matter applies to it and nothing known about it applies to matter but it really matters more than you will ever know, Darwinist, for you are without excuse".  something along those lines I believe

If somehow "the laws are physics are immaterial" makes sense to you, apply the dorsum of the nearest hand profusely about thy head and ears

The Aristotle Aquinas is strong in this one.

Date: 2011/04/01 05:01:54, Link
Author: Amadan
Quote (Zachriel @ Mar. 31 2011,20:54)
Quote (noncarborundum @ Mar. 31 2011,14:08)
Quote (carlsonjok @ Mar. 31 2011,08:31)
   However, I did come across a post that surely is the (still) high water mark for Uncommon Descent.

Behold!  Dembski at his finest!

I hadn't seen this before:

   
Quote (dembski @ Dec. 18 2006,18:21)
Calm yourselves everybody. An enhanced flatulent version is being worked on at this very moment. I will make it available. I do want to say this for the record, however. Many people regard the flatulent version as unsophisticated and even infantile. I want to suggest that in this postmodern age the flatulence in this animation actually serves as a sophisticated rhetorical device that mirrors the subtext of flatulence that runs throughout Judge Jones’s decision.


Anyone know if such an "enhanced flatulent version" ever saw the light of day?

Also, flatulence as "sophisticated rhetorical device"?  Really?

Here's some rhetoric for ya.

http://www.youtube.com/watch?v=R6dm9rN6oTs



Pathetic Level of Methane.

Date: 2011/04/01 19:20:32, Link
Author: Amadan
Quote
Pilar Pendeja


Thank you Tracey. I shall sleep happy tonight.

Date: 2011/04/04 14:44:59, Link
Author: Amadan
Quote (sparc @ April 04 2011,19:40)
Denyse at her best:  
Quote
People are always looking for natural selection to generate random mutation

Sig worthy!

Date: 2011/04/07 05:34:46, Link
Author: Amadan
Quote (Kristine @ April 07 2011,00:29)
Quote (noncarborundum @ April 06 2011,16:48)
 
Quote (Kristine @ April 06 2011,15:55)
     
Quote (Ptaylor @ April 05 2011,23:45)
Gil displays a little irritation at the way the “Atheists Don’t Have No Songs” comments are heading:
         
Quote
BACK ON TOPIC:

...because he wants to say something he hasn't said before...
         
Quote
I just got back from a rehearsal at our church playing piano with the many talented musicians in our worship team, in preparation for next Sunday’s service. This is such a joyful and life-enriching experience (which the atheist will never comprehend or experience), not just for the praise music but for the fellowship among us. At every rehearsal we have a time of prayer and share our personal lives and struggles with each other.

As a former Dawkins-style atheist I can offer the following observations: Atheism is hopelessly irrational and illogical. It is soul destroying.

...for at least a week.

Yeah, right. Because as a former pianist myself who, like Dawkins, sang in choir, and as a dancer who started at age practically zero singing in my crib (according to witnesses), I hate music about as much as the St.-Matthews-Passion-enjoying Dawkins does.

What a childish comment, even for Gilligan.

I just got back from a solo recital, singing with the many talented musicians in my voice teacher's studio. This is such a joyful and life-enriching experience, not just for the music but for the fellowship among us. After every recital we have a time of wine and cheese and sharing our personal lives and struggles with each other.

As a former C.S. Lewis-style Christian I can offer the following observation: Gil Dodgen is a git.

Yes, but Noncarb - you did not enjoy it in the right way!

I keep threatening to write a musical based on Kitzmiller. Well, I could write the libretto, at least. Sempre Li!

Hmmmm...that reminds me of something.

Count me in if you want a hand!

Date: 2011/04/07 05:45:23, Link
Author: Amadan
Quote (noncarborundum @ April 07 2011,03:24)
 
Quote (Texas Teach @ April 06 2011,18:43)
That reminds me of a joke I once saw at camp as a kid:

         
Quote
Why don't Unitarians sing?

Because we're too busy reading ahead to see if we agree with the lyrics.


"God Rest Ye, Unitarians"
Lyrics by the Rev. Christopher Gist Raible of the First Unitarian Church of Worcester
 
Quote
God rest ye, Unitarians, let nothing you dismay;
Remember there's no evidence there was a Christmas Day;
When Christ was born is just not known, no matter what they say,
O, Tidings of reason and fact, reason and fact,
Glad tidings of reason and fact.

There was no star of Bethlehem, there was no angels' song;
There could have been no wise men for the trip would take too long.
The stories in the Bible are historically wrong,
O, Tidings of reason and fact, reason and fact,
Glad tidings of reason and fact!

Our current Christmas customs come from Persia and from Greece,
From solstice celebrations of the ancient Middle East.
We know our so-called holiday is just a pagan feast,
O, Tidings of reason and fact, reason and fact,
Glad tidings of reason and fact.

If I may reprise from 3 years ago:*

 
Quote
Wander, Atheist soldiers, anywhere you may,
With the book of Darwin leading you astray.
As our moral compass swings an aimless arc,
We shall ever strive to lead all into the Dark.

Refrain

Wander, Atheist soldiers, anywhere you may,
With the book of Darwin leading you astray.

Barbecuing babies, crossing 'gainst the light;
No deed is too heinous for our evil fight.
Our big problem is, though, with no moral stuff
We can't tell which actions are evil enough.

Refrain

So we're left with Darwin, Evolution's source;
But nat'ral selection's an unguided force.
Chosing Bad o'er Good we must therefore defer;
Let our motto be, then, "Like, man, whatever..."


Slightly edited for your delectation


* You'd swear I didn't have something more important to do than remembering crap like this. Sad, isn't it?

Date: 2011/04/07 09:34:45, Link
Author: Amadan
I would like to see Gordon fight Silent Bob.

Date: 2011/04/07 09:35:29, Link
Author: Amadan
or Harpo Marx.

Date: 2011/04/07 16:43:49, Link
Author: Amadan
http://drjimsthinkingshop.com/2011....inosaur

Date: 2011/04/11 13:49:35, Link
Author: Amadan
Quote (oldmanintheskydidntdoit @ April 11 2011,18:19)
Gordon you fucking coward:
   
Quote
One would have thought that there would be a concern to be fair and accurate, but plainly, there is not. I don’t doubt that the picture being painted of us over at ATBC etc is not even faintly recognisable.

Why don't you correct the picture then?
   
Quote
Right from the beginning KL was challenged to provide evidence on Lucy and for the general thesis of blind watchmaker macroevo origin of humanity. To date there are a lot of assertions and turnabouts etc, but no evidence from that side on the main point.

Fucking liar. That was not the point of the thread(s) at all you gutless wonder.
 
Quote
On what we know, the FSCO/I itself is a strong sign pointing to design as the best explanation of our origin.

Yes, FSCO/I, a term that you made up.

Iiiiiiiiiitt's

SuperCarribbeanPreacherWaxesEloquocious!

Date: 2011/04/12 08:00:58, Link
Author: Amadan


HB x 3

Date: 2011/04/12 08:11:39, Link
Author: Amadan
That is utterly terrifying, Alan.

Thanks

Date: 2011/04/12 08:36:22, Link
Author: Amadan
Quote (OgreMkV @ April 12 2011,14:17)
Quote (Alan Fox @ April 12 2011,03:24)
As someone who is not up to speed on who is who in US culture, I am finding this site very handy.

And surprisingly the real kooks aren't on the list.

I guess that list is just those with power, influence, and money.  It has nothing to do with their ideas.

Whah???

Dr Dr Dino?

This loon?

Quote
Fred Hutchinson: An associate of Alan Keyes (writing on his website) Hutchison is the kind of guy who insists that he masters all sorts of sciences, but whose positions roughly correlates with that of the European church in the 15th century. A sample:

- He rejects Einstein, because the theory of relativity offers “no explanation of why an apple falling from a tree moves straight down” (as opposed to Newton). Of course Hutchison knows nothing about physics – he has managed to misunderstand some popular scientific presentation of Einstein.

- He rejects global warming because we have no “explanation of how CO2 differs from nitrogen and oxygen in its influence on the greenhouse effect”. He denies that gases can affect atmospheric temperature.

- He rejects the theory of evolution because, well, he doesn’t have any clue whatsoever how it is supposed to work.


The loon is strong in this one indeed, Sir!

Date: 2011/04/12 14:19:58, Link
Author: Amadan
Caek?



Hu Niedz?

Date: 2011/04/13 04:18:01, Link
Author: Amadan
Quote (Kristine @ April 13 2011,01:50)
Quote (carlsonjok @ April 12 2011,19:40)
 
Quote (Kristine @ April 12 2011,19:37)
There is a backstory...this was not guaranteed. I was privy to some conversations. Maybe some snowy night before the fire.

Would you like a glass of champagna?


Carsonjok, you know the secrets of my heart! :)


Have some Madeira, M'dear!

Date: 2011/04/15 11:13:17, Link
Author: Amadan
Quote (Alan Fox @ April 15 2011,08:29)
Does Barry Arrington's post confirm bannination with his "Case closed."? Isn't that somewhat dishonest? I know lawyers are supposed to not possess much in the way of integrity or honesty but I am a bit surprised at the blatancy.

Oi!!!

That's supposed to be a secret!

Date: 2011/04/15 18:23:26, Link
Author: Amadan
Quote (Schroedinger's Dog @ April 15 2011,13:27)
Coming out October 2011, and YEAH, it's a Watch book!!!


Hmmmm. Unseen Academicals was, shall we say, Pratchett-by-numbers.

I devoutly hope that this will be better.

Date: 2011/04/15 18:37:32, Link
Author: Amadan
Quote (JohnW @ April 15 2011,23:24)
Has anyone ever known nothing about so much?




You have to ask?

Date: 2011/04/19 05:16:06, Link
Author: Amadan
Quote (k.e.. @ April 19 2011,08:06)
Quote (noncarborundum @ April 19 2011,08:21)
Quote (paragwinn @ April 18 2011,22:57)
 
Quote (noncarborundum @ April 18 2011,21:44)
   
Quote (k.e.. @ April 18 2011,02:40)
     
Quote (Henry J @ April 18 2011,02:21)
       
Quote
First of all, our butt is an important muscle, helping us to stand erect.

That's getting to the bottom of things.

He's fighting a rear action.

Having gotten a little behind in his work.

Too busy playing "Truth or Derriere"

I'm a little surprised how long it tuchus to get this going.

Nothing assinine from Louis yet

I have to say, I'm glute to the screen waiting for the next pun.

Date: 2011/04/19 13:43:50, Link
Author: Amadan
Surely Dembski's big number in the Dover Trial scene should be set to John Cage's 4'33"?

Date: 2011/04/20 17:53:48, Link
Author: Amadan
Quote (Louis @ April 20 2011,22:25)
Is the "See if I give a fuck" Foundation twinned with the DILIGAF* Corporation?

*Do I look like I give a fuck.

Actually, both have been acquired by Europe's Favourite Airline.

Date: 2011/04/26 18:32:09, Link
Author: Amadan

Date: 2011/04/27 11:18:17, Link
Author: Amadan
Quote (Kristine @ Mar. 27 2011,00:33)
Quote (Dr.GH @ Mar. 25 2011,10:50)
Happy B'day

(I'm late again)

That's okay, I went to a visitation on my own birthday. (I skipped out on teh funeral.)

I owe you all shimmies. They are long overdue. I'm talking video of shimmies. A shimmy to out-shimmy the shimmiest of them all!  :)

Date: 2011/04/27 14:36:13, Link
Author: Amadan
Having hit the demi-ton a few months ago, I can confirm that yes, it does feel like you've put on your clothes. But with an awful lot of porridge in the pockets and your shoes are on the wrong feet. I also seem to have acquired someone else's teeth.

It wears off eventually, but nothing like as fast as when I was 20.

Feckin tequilla.

Date: 2011/05/02 16:43:12, Link
Author: Amadan
There is no Dark Side.

In fact, it's all dark.

Date: 2011/05/06 07:23:35, Link
Author: Amadan
Quote (Schroedinger's Dog @ May 06 2011,12:36)
Quote (noncarborundum @ May 06 2011,12:22)
Quote (CeilingCat @ May 06 2011,01:12)

I wasted a few bucks on reb Maverick's tome.  Here's a sample of his "reasoning":            
Quote
True devotees of naturalism

    Talmudic sources describe the practices of an ancient pagan cult called Ba'al Pe'or.  The adherents of this sect showed their devotion to their god by first defecating in front of his statue and then proceeding to engage in some of the more standard types of debauchery.  Defecation as a form of worship might seem odd to us in the 21st century, but the obvious meaning behind this act was to proclaim the glorification of, and an exclusive devotion to the physical and material aspects of existence.  If it were suggested that the above described scatology would be an appropriate expression of their own absolute commitment to naturalism and materialism, I imagine the reactions of Lewontin, Hitchens, Dawkiins, Ruse, Dennet, Pinker, et al., would be comically squeamish (although I don't rule out the possibility that they could surprise me).  Despite that, my guess is they would still feel right at home in a post-worship philosophical discussion with the naturalist/materialist "theologians" of the Ba'al Pe'or seminary.
That's from location 3820-3833 of the Kindle iPhone app and pages 225-226 of the book.

It's probably not relevant, but I found it amusing nonetheless, that Strong's Hebrew Lexicon defines Pe'or as "gap" (a geographical feature?).  Ba'al  being "lord" or "master" (as in Ba'al-Zebub, the Lord of the Flies), this would make Ba'al-Pe'or "Lord of the Gaps".

Who knew the God of the Gaps had worshipers back in Biblical times?  And that they were full of shit, even then?

POTW?

Seconded!


I, for one, welcome our interstitial overlords.

Date: 2011/05/07 18:25:17, Link
Author: Amadan
Hmmm. I can't speak for either side, but I detect a whiff of dried hay, at least as regards the Accomms. My understanding of the Accomm argument is that, when contradicting beliefs that are held as closely as one's own identity, one proceeds rather gently, even if those beliefs are antithetical to one's own.

In short, persuade, not browbeat. It's a bit judo when you think about it.

Date: 2011/05/11 08:10:40, Link
Author: Amadan
Quote (Cubist @ May 08 2011,08:34)
Quote (Amadan @ May 07 2011,18:25)
Hmmm. I can't speak for either side, but I detect a whiff of dried hay, at least as regards the Accomms. My understanding of the Accomm argument is that, when contradicting beliefs that are held as closely as one's own identity, one proceeds rather gently, even if those beliefs are antithetical to one's own.

In short, persuade, not browbeat. It's a bit judo when you think about it.

If that is indeed what the Accomodationists think, in what way is my "dealing with Religion in any way is political suicide" capsule summary a distorted/weakened version of the Accomodationist position? I ask because your 'whiff of dried hay' comment indicates that you think I was presenting a strawman (distorted, weakened) version of the Accomodationist position, and I don't see how my capsule summary is anything other than plain old accurate. Please to explain?

Hmmm. Perhaps a chemically-enhanced choice of words on my part: I don't believe you are misrepresenting anyone's position and apologise for suggesting it.

My main contention is that even outside the Gnu-Atheist camp, there are rational people, some of whom choose to be theistic. Those of us who choose not to be have to live with that.

Date: 2011/05/11 08:15:39, Link
Author: Amadan
Quote (Louis @ May 08 2011,03:36)
Amadan,

I need a favour. Nip over and talk to the Leinster boys. Make sure they give Northampton a damned good thrashing in the Heineken Cup final. If those tossers from the wrong part of the Midlands win, I'll never hear the end of it.

Louis

Well, I tried to, but when I told BOD who had sent me, he got pretty damn shirty about it. Something about the squad, training staff, your mum and a bulk discount.

You can probably sort it all out here.

Date: 2011/05/13 18:48:33, Link
Author: Amadan
But we hope and pray that BOD isn't cited for allowing his knuckles to be assaulted by <think it was Henry's> chin...

Date: 2011/05/13 18:58:10, Link
Author: Amadan
On mature recollection*, it probably doesn't matter, given that the Rapture is taking place on the day of the H Cup** Final.

* An untranslateable hibernicism

** Out of respect for our Francophone amis whose Etat Nounou permits not the mention of a certain Lowlands brewer

Date: 2011/05/21 04:00:05, Link
Author: Amadan
But I thought BOD was God?????

(Head explodes messily)

Date: 2011/05/21 14:57:58, Link
Author: Amadan
Feck but that put the heart across me!

At Louis's request, I had the lads let Northampton take the lead in the 1st half so that they could disappoint them that bit more acutely inthe 2nd. But I have to say they took me far far too literally for my liking. Must have a word with them: maybe after the Munster game...


Come on Ye Boys in Blue!!

Date: 2011/05/25 11:15:55, Link
Author: Amadan
Quote (George @ May 25 2011,15:32)
Quote (Schroedinger's Dog @ May 25 2011,08:56)
And a happy Towel Day to everyone!

By remarkable coincidence, it's also Geek Pride Day.

Not to mention National Fish and Chips Day.

Date: 2011/05/28 05:51:36, Link
Author: Amadan
Quote (Alan Fox @ May 27 2011,22:11)
OK. I was sort of thinking on consumer protection lines. If a seller makes a false claim about a product, they incur liability for loss incurred by a buyer who acts on the information. So there is no specific protection for a TV evangelist who promises life everlasting and disappoints?

As Dvunkannon points out, it centres on the existence of a contract and on voluntary behaviour.

Contract law in Common Law countries like the USA also generally requires the offer at the heart of the contract to be one that the offeree (awful word!) could reasonably expect the offeror to fulfil (or cause to be fulfilled). So if I offer to have lightning strike the top of your castle for your earth-shattering experiment* tomorrow at 1:00AM exactly, and you pay me to do so, the courts would most likely view that as something I  can't be expected to deliver on. If anything, the contract is a bet and (in most jurisdictions) would therefore be void for illegality. Which means you can't sue for your money. Sorry!




*The Fools! They laughed at me! But I'll show them . . .  Iiiiiigorrrr!!!! Fetch the spleens!!!!

Date: 2011/05/28 08:22:53, Link
Author: Amadan
Quote (dvunkannon @ May 28 2011,13:19)
By allowing 100% of religious contributions, the tax law is saying that I receive no benefit at all from them. Atheists might agree. Even the entertainment value of attending services would be hard to quantify.

Akshully, I think the rationale is simply that charities are generally A Good Thing and, to a certain extent, spare the State the expense of picking up the pieces that might otherwise be left lying around. Hence the argument in some 19th century English case where the charitable status a bequest to an order of enclosed [Catholic] nuns who did nothing but wear out their knees and Rosary beads* came under the very dubious eyes of their most Protestant Lordships. As a rule, gifts for the advancement of religion are considered charitable and hence tax deductible.

The rule about a lack of personal nexus to the charitable object was just a way of overcoming the time-honoured wheeze of setting up a fund for the noble person of funding your personal research into ethanol effects on contemplation of the inside of your eyelids.





* In fact, I've seen a movie on the internets that suggest that they also wear garters and perform some remarkable rituals with monks who wear sunglasses.

Date: 2011/05/30 17:25:13, Link
Author: Amadan
Quote (Seversky @ May 30 2011,23:13)
... given that Liddle is an academic psychologist by profession

A neuroscientist, non?

   
Quote
and O'Leary has been highly critical of what she considers to be the wilder speculative excesses of evolutionary psychology.

That should really shake the foundations of Darwinian Academe!


From her previous Mission to the Tardmines:

 
Quote (DaveTard @ January 10 2007)
Just for the record, Febble (Elizabeth Liddle) was banned because she claimed to be a scientist yet didn’t have the first clue about how natural selection works to conserve genomic information. She was writing long diatribes about how rm+ns is “intelligent” yet she didn’t understand and couldn’t be made to understand an important and basic bit about how rm+ns operates. I know people like Richard Hoppe don’t care at all about the evolutionary science being accurate at Panda’s Thumb, but I do care that it’s accurate on Uncommon Descent, and when someone displays that much ignorance, can’t be schooled, and is a critic they get the boot.

Plus ça change...

Date: 2011/05/31 05:02:26, Link
Author: Amadan
Quote (BillB @ May 31 2011,09:40)
 
Quote (Seversky @ May 31 2011,05:11)
Gil Dodgen on who has freedom of thought:

   
Quote
Oops, I forgot, most of these people have no experience in any rigorous engineering discipline. And those who do, and still believe in the Darwinian fantasy, have obviously undergone the atrophy and crippling of their basic reasoning powers — the product of many years of Darwinian indoctrination and suppression of free thought.

Who are the real freethinkers, Darwinists or ID folks? The Darwinian world is Orwellian.


So tell us, Gil, do you want the freedom to decide what is or is not moral in human society or do you want God to lay down the law for you?

Of course, this is already decided, isn't it, Gil?  You have no say in the matter.  Whatever God decides is right, is right.  If He decides He wants to wipe out virtually all life on Earth again then that is fine by you.  If He decides that the virgin daughters of a defeated enemy should be distributed amongst your victorious soldiers as concubines then that is the way it has to be.  What you might think doesn't come into it.

In fact, you are failing in your duties here, Gil.  Not only is homosexuality an abomination but there is a clear OT requirement for adulteresses and rebellious children to be stoned to death.  Why isn't this happening?  You have no choice in these matters.

Could it be that writing checkers programs or modeling how things fall out of the back of aircraft on parachutes does not necessarily endow you with a Jedi-like mastery of all other scientific disciplines.  Could it be that your feeble skills are no match for the power of the Darwin Side?

I suspect Gil wants God to lay down a sufficiently vague and contradictory law so he can decide what is moral or not whilst still claiming that God agrees with him.

As C.S Eisenstein said, God does not play checkers umm.... piano . . . I'm a genius! I was loooost but now am cloooowned . . . Amaaaaazing Grease....

Date: 2011/05/31 09:05:45, Link
Author: Amadan

Date: 2011/06/05 17:02:44, Link
Author: Amadan
Alas, no pics of my flabby fish-belly white torso to quicken* your pulse.

But I recently ran across this, which caused me to rupture internal organs laughing.




* Quickening may occur in negative quantities

Date: 2011/06/07 01:57:07, Link
Author: Amadan
If they can make a musical called The Book of Mormon, we should do the same for Expurgated.



PS: Hasa disa Eebowai!

Date: 2011/06/11 04:08:50, Link
Author: Amadan
Quote (J-Dog @ June 11 2011,01:41)
Quote (Texas Teach @ June 10 2011,19:07)
Quote (Reciprocating Bill @ June 10 2011,16:40)
Uncommonly DeNews:
     
Quote
Expelled film to be sold due to bankruptcy?

...

Note: Re Expelled, this was rumoured. The site has not been serviced for some time. Hang on to your DVDs.)

This is news? Expelled was intellectually bankrupt the day it was released.

<I take no pride in this, but someone must do it>

The site isn't the only thing that hasn't been serviced for some time.

Quote
The site isn't the only thing that hasn't been serviced for some time.


Perfect example of an Irreducible, Irrevocable Law of Nature:  There is a place that Darwin-loving Atheistic Church Burning Ebola Boys won't ever go.  Even for Endless Grant Money. And/or a Noble Prize.

Toxic cucumbers in the news.

Go figure...

Date: 2011/06/16 12:48:24, Link
Author: Amadan
A more challenging challenge:

Can you make it upright from one end of Dublin to the other by way of every pub you pass?

Date: 2011/06/17 04:31:44, Link
Author: Amadan
Quote (J-Dog @ June 17 2011,03:00)
 
Quote (Amadan @ June 16 2011,12:48)
A more challenging challenge:

Can you make it upright from one end of Dublin to the other by way of every pub you pass?

Amadan - If I ever make it over there, we could try a little observation and experimentation - if you haven't done that already.

There are several theories on the possibilities. All, however are suspect, and can be shown to be based on licenced premises.*










* Shamelessly stolen from Flann O'Brien.

Date: 2011/06/17 19:06:36, Link
Author: Amadan
Casey preaches to the converted:

Date: 2011/06/18 08:55:15, Link
Author: Amadan
Quote (Kristine @ June 18 2011,04:37)
People, I have become one of those atheists who had to call the police on my neighbors tonight (this after consulting with two attorneys in the past week), and now must get a restraining order, due to almost four years of harassment after I moved in with Rev. Barky.

I have become a statistic.  ???

ETA - It isn't just the atheism - frankly I think if we were Episcopalians or Buddhists these cretins would still be screaming at us and throwing things into our yard. But the fact of us not being married; not having kids; liking Arabic music and dance; not being "normal," etc., etc., which I guess means not weighing a million pounds and driving to Booger Fling for supper, makes us "the problem." *Sigh*

Ye Gawdz! Sounds an utter horrendoplasty.

Is this intended to bring your souls to their saviour, or is it just cuz yer funnylukin and use all them college words?

Date: 2011/06/19 07:36:18, Link
Author: Amadan
Quote (Louis @ June 19 2011,10:56)
Quote (Seversky @ June 19 2011,02:41)
[SNIP]

It'll all be Adam (and Eve's) fault for trying a fruit diet.  Again.

[SNIP]

Proving, once again, that God is from the South West of the England (probably Cornwall, possibly Somerset due to the cider) and the greatest crime in the universe is scrumping.

Louis

So when Eve ate the apple from the tree of knowledge, she gained in-cider information?

Date: 2011/06/24 05:58:44, Link
Author: Amadan

Date: 2011/06/24 06:01:39, Link
Author: Amadan
In for €50. Happy to look at any EU/UK/Irish (as if!) legal stuff related to distribution etc.

Date: 2011/06/24 19:09:12, Link
Author: Amadan
I think a few musical cut-scenes would be a good way to get across some snarky commentary about the original content.

[Rubs hands eagerly, reaches for rhyming dictionary]

Date: 2011/06/28 16:54:29, Link
Author: Amadan
Meanwhile, a new front emerges in the war.

Date: 2011/06/28 16:57:24, Link
Author: Amadan
Quote (Kristine @ June 28 2011,22:50)
Everything about Revelations I learned from UD! :p

So is the Whore of B. . . .



Sorry. I can't.

I just can't.

Date: 2011/06/29 11:45:38, Link
Author: Amadan
As a general rule it's difficult to pin the losses of an insolvent limited liability corporation on its directors or shareholders. You would have to show that they company had not just been mismanaged but that it was done deliberately or recklessly, or that the company was not being used for its original corporate purposes (i.e. you can't hide behind a limited liability company to avoid paying for your groceries or the kids' private school).

Unless the company was so badly run as to raise an inference of fraud, it's unlikely that the backers will be blamed for being able to walk away from the wreckage. That's what insolvency and bankruptcy laws are there for.

I wouldn't be too surprised if Ruloff & co had a bit of help from Howard and Friends to stop any incriminating production notes falling into the wrong hands. The receiver or liquidator will have no objection, because by overpaying for it, the creditors get a bigger dividend on what they're owed. As a result, I don't expect any legal issues to arise.

Pity, though.

Date: 2011/06/29 14:19:45, Link
Author: Amadan
An interesting point, Kristine. The Salvation Story is very much a part of the evangelical repertoire and always seems too contrived to be true, at least to these (liberal Catholic-bred) eyes.

One staple in The Good Old Daze was The Converted Jesuit, who would send a thrill up the congregation's collective spine with tales of everything ranging from baths of baby blood to papal admissions that the Anglican faith (or, as appropriate, the Southern Baptist Convention) was absolutely right but we can't let on without spoiling the gig. The said "Jesuit" would usually be semi-literate in his own language (typically Pordarican) as well as English, which would strike anyone who has met a real Jesuit as more than slightly discordant. Other Old Reliables on the I-Have-Seen-The-Light front were usually ex-cult types who would be persuaded to amplify the more batshit elements of whatever it was they had escaped from, presumably to distract the audience from the ones they subscribed to themselves. These dog-and-pony shows were common enough in Britain until fairly recently (and they still wheel them out sometimes in NornIron, I'm told), and it seems you can't escape the wretched things in the USA.

It would be interesting to compare these tales and watch how they adapt to different environments and circumstances. However, it would also take more effort and concentration than

Date: 2011/06/30 08:13:24, Link
Author: Amadan
Something that struck me after recharging my synapses (both of them). A Clockwork Orange is narrated by Alex in the form of a redemption story (hence the constant addressing of readers as "Oh my brothers"). A bit like the reformed drunk at a Sally Army meeting.

Date: 2011/06/30 15:48:28, Link
Author: Amadan
[quote=damitall,June 30 2011,21:07]
Quote (CeilingCat @ June 29 2011,23:36)

But when you only have the likes of Luskin, Behe, Dembski as your authorities

You forgot someone.

Date: 2011/07/04 03:48:42, Link
Author: Amadan
A Rich cake?

Date: 2011/07/05 12:28:46, Link
Author: Amadan

Date: 2011/07/05 18:14:32, Link
Author: Amadan
A bit behind schedule, but I think it was J-Dog edit: Sparc who asked about the Luskin Graduate Award earlier.

Now as it happens:



A Monobrow Scroll for the lucky winner.

Tied up with a pretty pink bow. Because, well, you know...

Date: 2011/07/26 11:21:17, Link
Author: Amadan
Quote (OgreMkV @ July 26 2011,15:01)
 
Quote
There is a subtle shift in thought going on. ID is not hep-c on a napkin anymore. Not all people are fleeing from it. They are paying attention to the arguments, and many have teeth.

... as opposed to the usual ID audience?

Date: 2011/07/29 05:17:04, Link
Author: Amadan
Quote (Badger3k @ July 28 2011,18:19)
But....their arguments are not aposteriori - they are nothing but posteriors!

I thought pro-ID arguments were ex-posteriori.



PS: Eek! The US Postal Service has vanished my avatar!

Date: 2011/08/05 03:52:44, Link
Author: Amadan
Quote (Schroedinger's Dog @ Aug. 04 2011,19:41)
ETA: Did I sleep with a nazi lately, or does everyone hate me on general principle? Oh, nevermind then...

(Whispers, muffled giggles in dark corners)

No, ah... nothing...

Honest.


(Tee hee ... Don't tell him, guys...)

Date: 2011/08/06 10:45:03, Link
Author: Amadan
Quote (xd30003 @ Aug. 06 2011,16:37)
what's the harm of atheism?







http://www.ottawaskeptics.org/forum?func=view&id=4318&catid=3

Careful with that pig!

A drop from that height could give it the chop!

Date: 2011/08/06 18:42:24, Link
Author: Amadan
Quote
And because we can imagine such a being, presto, it exists.


So the existence of the Divigner is contingent on human imagination?

No wonder so many accountants are atheists.

Date: 2011/08/06 19:00:41, Link
Author: Amadan
Quote (Schroedinger's Dog @ Aug. 06 2011,16:50)
ETA: also, Denis/David: "What is the ham of atheists" would have been a great improvement, for comedy value...

That would be rash, SD.

Indeed, it could hardly be rasher.

Date: 2011/08/07 19:46:47, Link
Author: Amadan
Quote (Seversky @ Aug. 07 2011,22:58)
So Bully Arrington and kf think ID can tell you whether or not design is present in a sequence of genetic material and even decode a message left there by the designer?  Okay, let's put it to the test.  The sequence that follows may just be a random sequence of 'C', 'A', 'G', 'T' I have punched out on my keyboard or it may be a gene or it may contain the name of an alien designer encoded somewhere in it.  Let's see if ID, in the words of the commercial, can do exactly what it says on the can.

CTCTCGGCGTAACAAGAATTTGTGTTTGGGGAGGTTATTTGTGTAGTGA
CCCGTGTGTGTTGTCCAGTGTGTGTGTGTGTGTGTGAGTGTGTGTGTGT
GTGTAGTGTGTGTGTGTGTGAGTGAGTGTGTGTGTGACCGAAGTGTTTG
TACCGTGTGTAACGAGTGTGTGTACCGTGTTTTGTGTAACAGTTTGGTTG

That's very very discourteous.

Date: 2011/08/08 11:47:16, Link
Author: Amadan
Hope this isn't old 'n busted. Anyway, I liked it:

Date: 2011/08/09 07:50:59, Link
Author: Amadan
Quote (EyeNoTwo @ Aug. 09 2011,12:50)
Quote (Wolfhound @ Aug. 08 2011,23:00)
Quote (Henry J @ Aug. 08 2011,23:03)
 
Quote (Texas Teach @ Aug. 08 2011,17:54)
 
Quote (Reciprocating Bill @ Aug. 08 2011,18:35)
   
Quote (Schroedinger's Dog @ Aug. 08 2011,18:13)
   
Quote (Tom Ames @ Aug. 08 2011,22:46)
     
Quote (JohnW @ Aug. 08 2011,13:31)
     
Quote (Henry J @ Aug. 08 2011,11:37)
       
Quote (Robin @ Aug. 08 2011,12:12)
         
Quote (JLT @ Aug. 08 2011,12:57)
Saying that everything a GA produces is design because it runs on a computer is like saying that I'm laying the eggs because I built the chicken house.


There should be laws against posting such a phrasing knowing full well that readers eat and drink...

:p

Yeah, I reckon there's a yolk in there someplace.

Another pun cascade?  Ova and ova again...

A punnet's cascade, actually.

Yo! Omelette ya finish!

Maybe we'll get this one over easy.

It's a fertile area or puns, which should prevent poaching.

But it could leave 'em scrambling.

Pshaw!  Each one of 'em has benedict for too long to let such thing bother them.

People, please remember this board is viewed around the world. I would hate to see the people of Hollandaised and confused by the poor quality of the puns posted here....

It's read in Rhode Island too.

(OK, that was pathetic. Honestly, one more pun like that and albumen well scream. Bad puns should be ovoided at all costs.)

Date: 2011/08/10 14:05:36, Link
Author: Amadan
Wasn't her argument that Evilushin is the Intelligent Divigner what got Febble banninated last time?

nihil novi sub sole

Date: 2011/08/11 15:34:40, Link
Author: Amadan
Quote (OgreMkV @ Aug. 11 2011,21:28)
So, if computers can design computers, then... what does mean?

Date: 2011/08/14 12:25:48, Link
Author: Amadan
Coffee! Interesting article: Does Secularism Make People More Ethical?

 
Quote
"Humans have two cognitive styles," the psychologist says. "One type finds deeper meaning in everything; even bad weather can be framed as fate. The other type is neurologically predisposed to be skeptical, and they don't put much weight in beliefs and agency detection."

Date: 2011/08/15 14:23:18, Link
Author: Amadan
Quote (midwifetoad @ Aug. 15 2011,19:47)
And if there is an interfering designer, one wonders why His methods look exactly like fecundity and selection. It's pretty bloody and wasteful.

Read the Old Testament recently? It's a pretty good fit.

Date: 2011/08/19 11:19:22, Link
Author: Amadan
Quote (Ftk @ Aug. 19 2011,16:31)
Be back later to answer you ogre...got some stuff to do.

Wish I could monitor the spike in server use at AIG right now!

Date: 2011/08/19 11:55:43, Link
Author: Amadan
Zounds, I'm sure she is!

Date: 2011/08/22 08:16:13, Link
Author: Amadan
Culchure Time!

The Museum of Bad Art

The (ummmmmm) catalogue notes are particularly helpful.

Date: 2011/08/24 14:33:34, Link
Author: Amadan
Quote (Louis @ Aug. 24 2011,20:23)
 
Quote (Lou FCD @ Aug. 24 2011,17:17)
[SNIP]

OChem looks way more fun than General Chem, and OChem was the class about which I have been most concerned. So that's good news.

Good to hear all is well. Organic chemistry IS more fun that general chemistry.

No I'm not biased as all hell. Why do you ask? ;-)

If you ever want organic chem related chats/advice you know where I am. Just remember 99%* of organic chemistry students hate it, don't get it and despair at the sheer volume of crap they are asked to apparently memorise when they first encounter it. It gets better. Usually a few years in, after beating your head against a wall repeatedly and several messy suicide attempts, a magical light pops on in your head and you get it.**

Of course if you do what the vast majority of organic chemistry students don't do, you'll get it in about 3 weeks and can then relax in a bar. The secret is to grasp about 5 or 6 basic principles and forget about memorising huge swathes of shite. The problem is working out which 5 or 6 principles! ;-)

Of course, for a reasonable fee, I can be relied upon to {ahem} illuminate you. In fact seeing as you are a friend, I'll do it for nothing, plus modest expenses of course.***

Louis

* I may be underselling the precise percentage a little.

** I may be making it sound easier than it is.

*** I find my best and most accurate thinking is done on my own private, luxury, tropical island resort surrounded by a bevvy of willing, morally adventurous and nubile young ladies.****

**** When I say "find" what I actually mean is "suppose" and/or "fervently wish".

My mother was an organic chemist.

She told me that the inorganic lot used to look down their noses at her and her classmates, saying that they were doing 'Mrs Beeton in a test tube'.

Her choice was vindicated later in California (this would have been the early 1950s) when her team worked out a way of getting the taste of can out of canned pineapple juice. It was a commercial disaster because the public, in their infinite wisdom, had come to the conclusion that pineapple juice ought to taste of can.

Date: 2011/08/25 03:46:12, Link
Author: Amadan
Heard outside the Mayfair registry office:

"Ay dooo wish them evvrry heppiness. A good fehst mahhrge is say important!"

Felicitaciones, compañero

Date: 2011/08/25 05:42:09, Link
Author: Amadan
A self-made man?

Hmmmm....

Has anyone ever seen Joe and DaveTard in the same room?

Date: 2011/08/27 19:42:34, Link
Author: Amadan
Quote (JLT @ Aug. 26 2011,23:45)
This is a classic:
     
Quote
Perhaps someone needs to start a journal for papers that were rejected by peer review but are still high quality. There would have to be some strict standards though. Otherwise, the editors would be innundated with crappy work.

One fine day in the middle of the night,
Two dead boys got up to fight,
Back to back they faced each other,
Drew their swords and shot each other...

oder für die, die Deutsch können*:

Finster war’s, der Mond schien helle
Auf die grünbeschneite Flur,
Als ein Wagen blitzesschnelle
Langsam um die Ecke fuhr.
Drinnen saßen stehend Leute
Schweigend ins Gespräch vertieft,
Als ein totgeschossner Hase
auf dem Wasser Schlittschuh lief
Und ein blondgelockter Knabe
Mit kohlrabenschwarzem Haar
Auf die grüne Bank sich setzte,
Die gelb angestrichen war.

* I'm sorry. I'll never do it again.

My version begins:

    A creationist peer-review paper got published,

but I never really found the need to go any further with it.


PS: Sorry to respond so late to this meme, have just spent the last 3 days driving over to Edinburgh & back to deposit No. 1 Son back to college. *sniff*

Date: 2011/08/27 20:00:16, Link
Author: Amadan
One of my English teachers was a chinless wonder who would have looked more manly if he had worn an Eton collar. Or maybe a frilly apron. On a trip to London in 3rd year (i.e. when we were 14 and gruesomely hormonally obnoxious) we had the pleasure of hearing the receptionist in the hotel describe him to his face as 'a poncey little stuffed shirt'. It was a memorable trip.

One of the maths teachers was a malodorous lumpen article whom we addressed as Miss [Name] more because we had been told to than for any reason relating to her phenotype.

This misbegotten pair got married.

My brother's year clubbed together and bought them a present of some expensive perfume and an electric shaver. Apparently there was some sort of mix-up when they attached the labels to the presents...

This is a True Story. Pas de Merde.

Date: 2011/09/01 02:29:02, Link
Author: Amadan
Hang on: for a proper 'conversion-to-atheism' story, doesn't he have to have an account of how happy, purpose-driven and Good he was before turning away from Jeebus?

I suspect an infiltrator....

Date: 2011/09/03 19:20:01, Link
Author: Amadan
If doctors bury their mistakes, lawyers appeal theirs, and scientists build on theirs, what do engineers do?


PS: Are statisticians reasonably certain of  their mistakes?

Date: 2011/09/05 06:25:34, Link
Author: Amadan
Quote (Henry J @ Sep. 05 2011,04:13)
Most people have two souls.

One on each foot.

... which is presumably why IDiots have developed their own ToE?

(I'm such a heel for saying that. An utter tarser)

Date: 2011/09/07 12:54:00, Link
Author: Amadan
POTW for Louis' Taxonomy of Tard!

Date: 2011/09/07 15:49:51, Link
Author: Amadan
Quote (sparc @ Sep. 07 2011,04:27)
Isn't a job that gives      
Quote
them enough resources to follow their own passions
already quite some achievement?

As often before, I return to Kliban, the master:

Date: 2011/09/07 17:15:19, Link
Author: Amadan
This one reminds me of everyone's favourite "journalist":

Date: 2011/09/09 18:44:44, Link
Author: Amadan
Quote (Reciprocating Bill @ Sep. 09 2011,22:34)
 
Quote (fnxtr @ Sep. 08 2011,23:45)
 
Quote (midwifetoad @ Sep. 08 2011,17:20)
Casey goes to bat again:

   
Quote
Venema's latter posts in the series discuss evidence that could count as weak, or circumstantial, evidence for common descent -- evidence such as high levels of human / ape genetic similarities. At most, however, this evidence shows circumstantial evidence for common ancestry. It says nothing about the information-generative abilities of random mutation and natural selection. Venema would have done well to heed Behe's advice in The Edge of Evolution that "modern Darwinists point to evidence of common descent and erroneously assume it to be evidence of the power of random mutation." In fact, if we factor into the analysis the possibility of common design of functional genetic programs, Venema's evidence doesn't even strongly point to common descent. But Venema ignores the possibility of common design.


Amusing that Casey, the lawyer, cites Behe, the molecular biologist on the power of random Mutation, then promptly sidesteps the inconvenient fact that Behe accepts common descent.

Good thing you turned off cross examination, eh Casey?

Link

Mighty Casey has struck out. Again.

Alas, no joy in Udville.

Fexache Bill!

Courtesy of this discussion I had just discovered the gem of Americana that is Thayer's opus major, and was about to spend my evening writing a parody of it featuring monobrows and unresolved sexuality, the whole pivoting on a witty pun on 'Mudville'.

And you stole first base, so to speak.

Bitch.

Date: 2011/09/12 06:32:28, Link
Author: Amadan
Try drooling on your keyboard.

Date: 2011/09/13 13:44:08, Link
Author: Amadan
Have just had my first discussion (not the right term, but it'll have to do) with a Freeman. Has anyone encountered this lot before?

Utterly and totally Bonzo-dog spaghetti-in-the-ears lunacy. I thought Floyd Lee and AFDave were the dribbling edge (so to speak) but they're almost rational compared to these Freeman types.

Ye Gawdz, citing Confederate proclamations and Anglo-Saxon common law as a reason for not paying Irish car tax?


Screeeeeeeeeeetch!!!!

Date: 2011/09/14 16:53:22, Link
Author: Amadan
Quote (midwifetoad @ Sep. 13 2011,21:44)
 
Quote
Of course, no evidence the guy is antisemitic.


He has some rather strong associations in the conspiracy world with people who blame Israel for 9/11.

Just looking briefly at the truther sewer, he might have disassociated himself from that. Or not. It's difficult to tell who's in and who's out. What a mess.

I have a personal reason for thinking the Trade Center theorists are full of shit. They talk about the fire not being hot enough.

I live a few blocks from a church that burned a few years ago. It had a frame made of steel I-beams which bent like cooked spaghetti in the fire. There was no additional fuel. It was just a routine fire.


Hmmm. Where exactly were you when this fire took place?

Were there any reports of hemorrhagic fevers in the locality?

Date: 2011/09/17 08:52:17, Link
Author: Amadan


Tied yer kangaroo down, Sport!



PS:


Superman wears Paul O'Connell pyjamas.

Date: 2011/09/18 05:04:24, Link
Author: Amadan
Dog Gilden?

Date: 2011/09/18 08:38:33, Link
Author: Amadan
Quote (Tracy P. Hamilton @ Sep. 18 2011,04:30)
Quote (midwifetoad @ Sep. 17 2011,18:55)
Quote
Natural Selection process itself has absolutely nothing to with Human Evolution either!!!! Too bad I know your playbook Elizabeth,,,,


 
Quote
as the observer approached the constant of the speed of light.,,,


 
Quote
see what the almighty power of neo-Darwinian evolution has DEMONSTRATED for this fool to behold:

And the drum-roll please,,,,,,,


You can almost see the bile pouring out of every orifice.

He does seem to have a problem with punctuational entropy and meltdown.

Maybe bornagan77 will eventually reach punctuational equilibrium,,,

... or vanish up his own colon

Date: 2011/09/19 15:25:12, Link
Author: Amadan
Contratulations to Wes for making the Big Time

WND and FSTDT!

Date: 2011/09/20 08:35:02, Link
Author: Amadan
Wes,

Forward them to his ISP.

Date: 2011/09/20 12:24:47, Link
Author: Amadan
Well done Kristine!

Date: 2011/09/20 12:27:43, Link
Author: Amadan
Quote (Louis @ Sep. 20 2011,11:20)
Oh I was so happy when I watched this match. Well done Ireland. I knew you had it in you!

Louis

You realise that, absent our highly-predicted screw-up against Italy (or Russia! eeeeek!!) this means Wales in a QF and possible England in the semis?

Oh, I see, that's why you're pleased.


PS: But thatnks anyway. It was marvellous to read the Oz press and blogs afterwards (snigger)

Date: 2011/09/23 09:01:48, Link
Author: Amadan
In the window of Opus II music shop on South Great George's St this week:




Respect

Date: 2011/09/23 11:33:21, Link
Author: Amadan
Quote (Louis @ Sep. 23 2011,13:31)
Quote (Dr.GH @ Sep. 23 2011,06:04)
 
Quote (Kristine @ Sep. 22 2011,11:07)
<massive clip>
Creationism is unique in that it is constantly obscuring its own history - since it is such a part of American history particularly, it would be my life's ambition to write the history of creationism, because creationists react toward their own history as they do toward the fossil evidence.

That is what all of this is about!

Excellent comment.

Brava!

Seconded. Definitely a POTW.

Possibly for as little as 3 seconds.*

Louis

* For those not in the know, the joke is that POTWs last for vastly less than a week. The shorter the time, the better they are. It's an AtBC meme. Just go with it. HOMO.

POTW!

Date: 2011/09/23 19:01:38, Link
Author: Amadan
Quote (afarensis @ Sep. 24 2011,00:54)
POTW!*

* Let the recursive meltdown begin!

10 GOTO PROC *POTW

Date: 2011/09/24 06:12:08, Link
Author: Amadan
Quote
The bartender says "We don't allow your type in here." A faster than light neutrino walk into a bar.



Not my own, but I am still happy to take any credit I can.

Date: 2011/09/27 09:13:48, Link
Author: Amadan
Quote (Schroedinger's Dog @ Sep. 27 2011,14:22)
what's-the-name-of-that-drop-shaped-stuff-at-the-back-of-my-throat-again (lurette in French).

So here is my question: does this condition have a name?

45 minutes, copies to be left on the desk before bell rings...

Uvula (the palatine one, apparently. Whodathunkit?)

Date: 2011/10/02 05:54:47, Link
Author: Amadan
Who says creationism hasn't led to useful scientific innovation?



[URL=http://www.theaustralian.com.au/a-japanese-company-has-developed-a-modern-version-of-noahs-ark-for-people-to-float-out-the

-next-tsunami/story-fn84naht-1226155898531]Japanese Noah's Ark Tsunami Survival Pods[/URL]

Date: 2011/10/02 16:44:13, Link
Author: Amadan
Quote (sledgehammer @ Oct. 02 2011,04:38)
 
Quote (Henry J @ Oct. 01 2011,15:54)
         
Quote
Details? We don' need no steenkin details. It's not ID's job to match your pathetic demand for details. Your details stink anyways.

Then why not just say that the "Almighty" did it in whatever the way it was done, even if that is consistent with evolution as described by science, and be done with it? After all, if they say that some method or other was impossible, they're directly implying that the "Almighty" couldn't have done it using that method, which contradicts what I thought was their base assumption. Or am I missing something here?

Henry

 Because that would mean that humans are just another animal, a filthy, stinkin' ape no less, with no Greater Purpose, and that would also mean that the Fall never happened, and therefore we didn't need to be Saved, and so The Scriptures might not be the Revealed Truth.
  Once you start down that slippery slope,  it can only end in one place:  the possibility that the atheists were right all along in that when we die, that's it, which can't possibly be the Truth because He is Risen.
 So all that other sciency stuff must be wrong.  Simple as that.  QED.  End of story.
Besides, everyone knows that Darwinism leads the innocent to Atheism and materialism, which is far, far worse than Islam, Naziism, and Communism combined, and so must be stopped at all costs.

More importantly, it would mean that Teh Eevul Darwinists are right about something. There is also the not inconsiderable problem that those fellows in frocks in Rome take that line, and some of the constituency would be very unhappy about agreeing with Them.

Having invested so heavily in YECs as a core component of movement conservatism, why let a bit of intellectual honesty spoil the party?

Date: 2011/10/02 16:47:58, Link
Author: Amadan
All the better to . . .

Date: 2011/10/03 16:33:31, Link
Author: Amadan
What's the point of the reference to 'Clears' in that story, do you think?

Just having a dig at the Clams?

Date: 2011/10/04 16:51:26, Link
Author: Amadan
Ye Gawdz, Bozo Joe snuggles up to the UDiots?

Will the hybrid fleas constitute a new species?

Date: 2011/10/07 04:12:40, Link
Author: Amadan
Speaking of cyber monsters, Optimus Prime is a poet!

Whodathunkit.

Date: 2011/10/08 04:57:19, Link
Author: Amadan
Agreed, we were well beaten by a better team. Cymru ar gyfer y cwpan!

*sniff*

Tough luck England. Do they still keep a pillory in Johnson's size?

Date: 2011/10/08 09:04:32, Link
Author: Amadan
I knew I'd heard of Pacific Western University somewhere!

Date: 2011/10/08 09:06:55, Link
Author: Amadan
Winners get a K

Losers get 'ell.

Date: 2011/10/09 12:11:26, Link
Author: Amadan
Quote (Tracy P. Hamilton @ Oct. 09 2011,14:26)
 
Quote
What if the mind is the TV station and the brain is the set?


New book idea: "The Spiritual TV Station"

Some people are clearly only receiving the test card.

Date: 2011/10/15 06:49:10, Link
Author: Amadan
Anyone watch France - Wales?

This game illustrates why ballot papers whould have a "None of the Above" option.

What a godawful match! France played like a coach-tour of kindly-disposed nuns. Wales certainly had a lot of fight in them, especially after a doubtful red card, but couldn't make up their mind what to do with the ball when they won it.

Very very frustrating. The SH teams will not be impressed.

Date: 2011/10/23 08:11:14, Link
Author: Amadan
I am a hide-behind-the-sofa sort of Eurovision fan.

In the late 60s and early 70s any Eurovision broadcast was a Big Thing (I grew up in a country with slightly less than two television channels!). The Song Contest seemed like sophistication on castors.

It was the apotheosis of eye-popping 70s fashion disasters (for those who are into that sort of thing, as I, in a rather morbid way am). And some of the songs were quite spectacularly bad (as I began to appreciate during my Death Metal years).

I suppose it only became as camp as a boy-scout jamboree during the 80s, when the likes of MTV made it very clear to all concerned that credibility was beyond its reach, satellite broadcasting was strictly Vieux Chapeau, and a new demographic had to be found.

Since the Wall fell and the Eastern Europeans became dominant it has lost some of its lustre* but it's still entertaining to watch the voting to get a grasp of the cultural and ethnic fault lines in this Brave New World. I couldn't be bothered listening to the music though. Uniformly rubbish, except for the very deliberate piss-takes that occasionally make it through.



* Lustre not necessarily included.

Date: 2011/10/23 10:33:43, Link
Author: Amadan
Kristine,

Saw this and thought you might be interested.

Date: 2011/10/24 06:10:53, Link
Author: Amadan
Quote (George @ Oct. 24 2011,08:23)
Don't distract him!  I think I speak for everyone here (well, ok, maybe just 'Ras) when I want to hear more about his theory that coprophagy proves design.

Is this something to do with 'Mud to Mozart'?

Date: 2011/10/24 12:37:55, Link
Author: Amadan
Falando do quem, has AFDave been seen anywhere recently?

He discovered an[other] exciting business opportunity when Febble et al painted him into the corner of a zircon crystal at TalkOrigins a few months ago.

It would be such as shame to lose the Internet's premier resource for countering creationism.

Date: 2011/10/24 15:13:09, Link
Author: Amadan
Quote (Ra-Úl @ Oct. 24 2011,20:05)
'Forastero means 'stranger' or 'foreigner' in Spanish. From a Catalan word. I was trying to find a Portuguese cognate for a weak pun, but no luck. I like how Forastero use 'y'all' and other Americanisms. Foreigners find other foreigner's English very amusing.

Maybe 'Forastero' is just a misspelling of 'For Hysterics'?

Apropos nothing in particular, in Dublin, the English word for someone of a different nationality is pronounced fardn.

(Similarly, the local newspaper published during the afternoon is termed the Eden Heddle.)

Thank you for your attention during this short digression.

Date: 2011/10/25 08:35:02, Link
Author: Amadan
Forastero,

A little tip from the grown-ups.

Ad hominem is the logical fallacy of arguing that a proposition is false because of a characteristic of the person proposing it. For example, it would be an ad hominem for me to tell reader to disregard what you say because you have red hair or are left-handed.

Describing you or the assertions you inflict on us as stupid is not ad hominem. It is a mixture of verbal abuse, fair comment and entertaining derision. You will find that it tends to stop (or at least ease off a bit) if you present evidence and argument in support of your position.

But it's been a while since there was a half-way decent chew-toy for the scientists here, so carry on as you were.

Date: 2011/10/26 09:51:51, Link
Author: Amadan
Quote (Richardthughes @ Oct. 26 2011,15:22)
Quote (BillB @ Oct. 26 2011,04:35)
Quote (paragwinn @ Oct. 26 2011,07:21)
 
Quote (Ptaylor @ Oct. 25 2011,17:45)
Final comment on that thread:
           
Quote
I will not reward that behaviour, so I will now shut down comments, and add responses in brief overnight to what requires a reasonable comment for record, as editorial notes.

GEM of TKI


POTW? - gets my vote.

Seconded!

Turded!

Date: 2011/10/29 10:23:20, Link
Author: Amadan
I am pleased to share with onvoyeurs the following delightful entry I stumbled across in the Oxford Universal Dictionary (3rd Ed. 1933, revised 1955, ex libris Grand-Amadan):
   
Quote
bumbailiff (1603): A bailiff of the meanest kind; one that is employed in arrests.


I can see a future for the term if some of the US theocrats have their way.

Date: 2011/11/01 09:44:18, Link
Author: Amadan
Oh dear. Another nested punnerarchy.

On UD they prevent this by use of the barnination button.

Date: 2011/11/03 09:36:59, Link
Author: Amadan
So, was Wallace doobin' up too?

Date: 2011/11/04 04:10:17, Link
Author: Amadan
Quote (Erasmus @ FCD,Nov. 04 2011,05:02)
which one of you guys is fourasstero again?

(Stands up)

I am Tardacus!

Date: 2011/11/05 08:01:51, Link
Author: Amadan
Quote (Woodbine @ Nov. 05 2011,13:12)
 
Quote (oldmanintheskydidntdoit @ Nov. 05 2011,12:15)
 
Quote (forastero @ Nov. 05 2011,04:29)
Most importantly though is that fact that all kinds of dinosaurs are found with soft tissues

Citation please.

Tyrannosaurus Andrex.

Date: 2011/11/12 03:47:12, Link
Author: Amadan


HB.

Date: 2011/11/14 17:07:16, Link
Author: Amadan
Quote (Kristine @ Nov. 14 2011,19:13)
I have always argued that Edgar Allan Poe came up with the idea of the unconscious before Freud, ...

Or how about Hieronymus Bosch?

Date: 2011/11/16 04:35:52, Link
Author: Amadan
Isn't she at least nominally a Catholic? And of the emigrant-Irish variety, at that? (Our Lady of Nagging Guilt, pray for us...)

Catholics of that generation were imbued with a deep and firm conviction that Protestants - particularly the fundagelicals - are Teh Eeevul. The old joke about Fr. O'Reilly asking Brigid what she wanted to be when she grew up (punchline "Oh, that's OK, I thought you said 'A protestant'!") was scarily close to the truth.

It is not unusual for those of that background to end up wallowing in fundagelical primal ooze. But doing would normally require a Hallelujah Moment and a Jack Chick style Frillologue, typically adorned with a few evil Jesuits etc etc.

Densye, your mother is suffering because of your infidelity to The One True Church! Have you no shame?

Date: 2011/11/16 07:01:01, Link
Author: Amadan
Quote (Quack @ Nov. 16 2011,11:38)
 
Quote
the Big Tent holds a lot of clowns.

Right, When you go to UcD you know you are in a circus.

Oi! That's my alma mater you're talking about!

Mind you, it was a bit of a circus alright....

Never mind, just pretend I didn't say anything.

Date: 2011/11/16 07:46:02, Link
Author: Amadan
I was about to brag about having cadged a ticket to Prof. Pratchett's talk this evening but then saw this.

Rather puts a damper on things, eh?

Date: 2011/11/17 02:14:43, Link
Author: Amadan
Quote (forastero @ Nov. 17 2011,06:46)
You playing General Custer?

And you would be . . .

Date: 2011/11/17 05:47:12, Link
Author: Amadan
Quote (Schroedinger's Dog @ Nov. 17 2011,10:14)
Quote (Amadan @ Nov. 16 2011,13:46)
I was about to brag about having cadged a ticket to Prof. Pratchett's talk this evening but then saw this.

Rather puts a damper on things, eh?

My live drummer was at the lecture yesterday. His step-father is tetraplegic and disagrees with Sir Pterry's views on assisted death.

I'm waiting for his feedbacks...

No great insights were offered, really. I suppose the take-away message on assisted death was that it wasn't a good option, more of a less-worse one. It wasn't the sort of discussion where they were likely to go into the question of absolute rights and wrongs.

He mentioned a project with Stephen Baxter called The Long Earth which sounds interesting. Baxter is quite good, though I find him a bit turgid at times.

And then we had a glass of plonk and I cycled home through the rain!

Pic (taken with pokey little phone: apols!)

Date: 2011/11/17 08:30:38, Link
Author: Amadan
Quote (Schroedinger's Dog @ Nov. 17 2011,14:02)
Cool pic!

My drummer told me he wasn't there yesterday night, but tonight there's supposed to be a debate between Sir Pterry and Vince's step-father, also at Trinity. I find it a bit dubious, do you know anything about such event?

Sounds a bit mythomaniac to me, but I might be wrong, in which case it would be ubber cool!

Matt. 7.7:  "Seek and ye shall find"

Date: 2011/11/19 03:30:26, Link
Author: Amadan
Quote (forastero @ Nov. 19 2011,04:46)
Its supposed to look like this P(n) = 8(1 + .005)^N   but you wrote it like P(N) = 8 × (1.005)^N and I'd say willfully so;

That really deserves an award of the coveted CreoCup:

Date: 2011/12/03 12:04:19, Link
Author: Amadan
Does the lady in your picture reproduce?

Would she like some help?

Date: 2011/12/05 18:31:10, Link
Author: Amadan
Quote (Lou FCD @ Dec. 05 2011,02:40)
Quote (Tracy P. Hamilton @ Dec. 04 2011,20:56)
Quote (Lou FCD @ Dec. 04 2011,07:58)
 
Quote (Amadan @ Dec. 03 2011,13:04)
Does the lady in your picture reproduce?

Would she like some help?

The painting on the tapestry has a special place in Gil's heart. When I saw it hanging on the wall at our advisor's house, I grabbed a quick shot with my phone.

It has some minor significance for me. :D :D

Which came first - seeing the tapestry or winding up DaveScot?

Seeing the tapestry on Friday night was the first time I've ever actually seen a print in fer-real life, though I've liked the painting since I first saw it online sometime before the DaveScot affair.

Not being a learned AtBCer I hadn't made the lady's acquaintance.

Very,ah, spiritual.

Date: 2011/12/08 05:08:18, Link
Author: Amadan
Quote (Occam's Toothbrush @ Dec. 07 2011,15:58)
Quote (CeilingCat @ Dec. 07 2011,06:13)
A new metaphor from kairosflatus:

"I can understand your sense of urgency to respond to specific tangential challenges. However, I must note that the point of these is inherently to distract and to pull us into a poisonous crocodile death roll fight."

Now I'd pay good money to see that!

tard

Waiter, bring me a poisonous crocodile death roll, medium rare please.  Can I have that soaked in oil of ad hominem?

And make it snappy!


Badum-TISH!

Date: 2011/12/12 05:10:23, Link
Author: Amadan
Paaaaartaaaayyy!

Date: 2012/01/13 08:53:29, Link
Author: Amadan
Anyone read Snuff?

What did you think?

Date: 2012/01/13 16:16:56, Link
Author: Amadan
Quote (Schroedinger's Dog @ Jan. 13 2012,17:03)
Quote (Amadan @ Jan. 13 2012,15:53)
Anyone read Snuff?

What did you think?