Antievolution.org :: Antievolution.org Discussion Board The Critic's Resource on Antievolution

Antievolution.org Discussion Board > From the Panda's Thumb > After the Bar Closes... > Cosmic Fingerprints

Pages: (2) < [1] 2 >

FrankH Posts: 525 Joined: Feb. 2009 (Permalink) Posted: April 09 2010,14:53    I found a new place that looks fun for Tard mining: Comic, er Cosmic Fingerprints I don't know if I should be proud that I found it or saddened that it exists at all. -------------- Marriage is not a lifetime commitment, it's a life sentence!

Kristine Posts: 3061 Joined: Sep. 2006 (Permalink) Posted: April 09 2010,15:37    Quote (FrankH @ April 09 2010,14:53) I found a new place that looks fun for Tard mining: Comic, er Cosmic Fingerprints I don't know if I should be proud that I found it or saddened that it exists at all. Yes, alrighty, we have achieved "tired, wretched, poor..." In fact, this qualifies as wretched refuse of their teeming snore. Quote Day 1 -  The mistake Einstein later called “the biggest blunder of my career” – and a dangerous assumption that nearly blinded him to the greatest discovery of the 20th century. Ho hum, I wonder what that could be. Zzzzzzzzzzzzzz -------------- Which came first: the shimmy, or the hip? AtBC Poet Laureate "I happen to think that this prerequisite criterion of empirical evidence is itself not empirical." - Clive "Damn you. This means a trip to the library. Again." -- fnxtr

FrankH Posts: 525 Joined: Feb. 2009 (Permalink) Posted: April 09 2010,15:51    Yeah, the stuff gets "better" (or is that much, much worse?) the more one reads. After reading this site and UD, UD is a bastion of intelligence. This guy though seems to allow more open debate.  But he's still bit shat nucking futz. -------------- Marriage is not a lifetime commitment, it's a life sentence!

keiths Posts: 2195 Joined: Jan. 2006 (Permalink) Posted: May 18 2010,20:41    And now Mr. Marshall has jumped on the "Darwinism in its death throes" bandwagon: Quote 2013: Darwin Fails. In 2013, the Berlin Wall of Darwinism Will Fall. Here’s Why. Evolution really did happen, living things really do have a common ancestor, and the earth really is 4.5 billion years old. But the way evolution really works has little in common with Darwin’s theory. Darwinism is in deep trouble and it’s too late save it. It’s no different than the Berlin Wall in 1986, Enron in 2000 or the US financial markets 3 years ago: It’s a bubble propped up by academic theorists, atheist zealots, politics and shell games - not hard science. All that needs to happen is for the right 3-5 scientists to step forward and expose the evolution industry for what it is…. and it’s not a question of “IF”, it’s only a question of WHEN. Darwinism has about 2-5 years left. And when the !@#$ hits the, fan it’s it’s gonna be quite a spectacle. Add another one to the list of people to mock in a few years. -------------- And the set of natural numbers is also the set that starts at 0 and goes to the largest number. -- Joe G Please stop putting words into my mouth that don't belong there and thoughts into my mind that don't belong there. -- KF

Timothy McDougald Posts: 1036 Joined: Dec. 2006 (Permalink) Posted: May 18 2010,22:50    Okay, so, I, um, had to subscribe to the Darwinism thing. Couldn't resist. It's a sickness, I know, I'll start the twelve step program as soon as I'm able. Sob, sniffle. A small taste: Quote Nature can create fascinating patterns - snowflakes, sand dunes, crystals, stalagmites and stalactites. Tornadoes and turbulence and cloud formations. But non-living things cannot create language. They *cannot* create codes.  Rocks cannot think and they cannot talk.  And they cannot create information. It is believed by some that life on planet earth arose accidentally from the "primordial soup," the early ocean which produced enzymes and eventually RNA, DNA, and primitive cells. But there is still a problem with this theory: It fails to answer the question, 'Where did the information come from?' -------------- Church burning ebola boy FTK: I Didn't answer your questions because it beats the hell out of me. PaV: I suppose for me to be pried away from what I do to focus long and hard on that particular problem would take, quite honestly, hundreds of thousands of dollars to begin to pique my interest.

Reciprocating Bill Posts: 4265 Joined: Oct. 2006 (Permalink) Posted: May 18 2010,22:58    Quote (afarensis @ May 18 2010,23:50) Okay, so, I, um, had to subscribe to the Darwinism thing. Couldn't resist. It's a sickness, I know, I'll start the twelve step program as soon as I'm able. Sob, sniffle. A small taste:   Quote Nature can create fascinating patterns - snowflakes, sand dunes, crystals, stalagmites and stalactites. Tornadoes and turbulence and cloud formations. But non-living things cannot create language. They *cannot* create codes.  Rocks cannot think and they cannot talk.  And they cannot create information. It is believed by some that life on planet earth arose accidentally from the "primordial soup," the early ocean which produced enzymes and eventually RNA, DNA, and primitive cells. But there is still a problem with this theory: It fails to answer the question, 'Where did the information come from?' You mean it doesn't come from talking rocks? I'm in trouble. -------------- Myth: Something that never was true, and always will be. "The truth will set you free. But not until it is finished with you." - David Foster Wallace "Here’s a clue. Snarky banalities are not a substitute for saying something intelligent. Write that down." - Barry Arrington

Timothy McDougald Posts: 1036 Joined: Dec. 2006 (Permalink) Posted: May 18 2010,23:09    Quote (Reciprocating Bill @ May 18 2010,22:58) Quote (afarensis @ May 18 2010,23:50) Okay, so, I, um, had to subscribe to the Darwinism thing. Couldn't resist. It's a sickness, I know, I'll start the twelve step program as soon as I'm able. Sob, sniffle. A small taste:   Quote Nature can create fascinating patterns - snowflakes, sand dunes, crystals, stalagmites and stalactites. Tornadoes and turbulence and cloud formations. But non-living things cannot create language. They *cannot* create codes.  Rocks cannot think and they cannot talk.  And they cannot create information. It is believed by some that life on planet earth arose accidentally from the "primordial soup," the early ocean which produced enzymes and eventually RNA, DNA, and primitive cells. But there is still a problem with this theory: It fails to answer the question, 'Where did the information come from?' You mean it doesn't come from talking rocks? I'm in trouble. I thought the mice were, ultimately, responsible... -------------- Church burning ebola boy FTK: I Didn't answer your questions because it beats the hell out of me. PaV: I suppose for me to be pried away from what I do to focus long and hard on that particular problem would take, quite honestly, hundreds of thousands of dollars to begin to pique my interest.

Venus Mousetrap Posts: 201 Joined: Aug. 2007 (Permalink) Posted: May 19 2010,05:01    Quote (afarensis @ May 18 2010,22:50) Okay, so, I, um, had to subscribe to the Darwinism thing. Couldn't resist. It's a sickness, I know, I'll start the twelve step program as soon as I'm able. Sob, sniffle. A small taste: Quote Nature can create fascinating patterns - snowflakes, sand dunes, crystals, stalagmites and stalactites. Tornadoes and turbulence and cloud formations. But non-living things cannot create language. They *cannot* create codes.  Rocks cannot think and they cannot talk.  And they cannot create information. It is believed by some that life on planet earth arose accidentally from the "primordial soup," the early ocean which produced enzymes and eventually RNA, DNA, and primitive cells. But there is still a problem with this theory: It fails to answer the question, 'Where did the information come from?' I was about to argue with this, but then I saw that he enclosed *cannot* in asterisks, which makes his argument completely undefeatable. I might as well give up now. The best I've got is a few weedy little carats.

Kristine Posts: 3061 Joined: Sep. 2006 (Permalink) Posted: May 19 2010,08:51    Quote (keiths @ May 18 2010,20:41) And now Mr. Marshall has jumped on the "Darwinism in its death throes" bandwagon: Quote 2013: Darwin Fails. In 2013, the Berlin Wall of Darwinism Will Fall. Here’s Why. Evolution really did happen, living things really do have a common ancestor, and the earth really is 4.5 billion years old. But the way evolution really works has little in common with Darwin’s theory. Darwinism is in deep trouble and it’s too late save it. It’s no different than the Berlin Wall in 1986, Enron in 2000 or the US financial markets 3 years ago: It’s a bubble propped up by academic theorists, atheist zealots, politics and shell games - not hard science. All that needs to happen is for the right 3-5 scientists to step forward and expose the evolution industry for what it is…. and it’s not a question of “IF”, it’s only a question of WHEN. Darwinism has about 2-5 years left. And when the !@#$ hits the, fan it’s it’s gonna be quite a spectacle. Add another one to the list of people to mock in a few years. Oh, the rocks and stones themselves will sing!   A-nutter countdown! Me like. -------------- Which came first: the shimmy, or the hip? AtBC Poet Laureate "I happen to think that this prerequisite criterion of empirical evidence is itself not empirical." - Clive "Damn you. This means a trip to the library. Again." -- fnxtr

J-Dog Posts: 4402 Joined: Dec. 2006 (Permalink) Posted: May 19 2010,09:32    HaHa, he's wrong, the jokes on him!  Darwin won't be proved wrong in 2013 - the Mayan's have already decided that the world ends in 2012, and it says so right on the TV*.   *Telly for all you Brit fans out there. -------------- Come on Tough Guy, do the little dance of ID impotence you do so well. - Louis to Joe G 2/10 Gullibility is not a virtue - Quidam on Dembski's belief in the Bible Code Faith Healers & ID 7/08 UD is an Unnatural Douchemagnet. - richardthughes 7/11

curiousgeorge Posts: 2 Joined: May 2010 (Permalink) Posted: May 19 2010,10:07    I would be interested in hearing the counter arguments to what he is saying rather than seeing people try to brush it off. Anyone care to do so?

Amadan Posts: 1337 Joined: Jan. 2007 (Permalink) Posted: May 19 2010,10:16    Quote Gibbering creobot: " . . . the Berlin wall in 1986" Francis Bacon (a well-known Christian and a scientist) surveys the Berlin Wall in 1986: That must have been what made it fall three years later. Maybe. -------------- "People are always looking for natural selection to generate random mutations" - Densye  4-4-2011 JoeG BTW dumbass- some variations help ensure reproductive fitness so they cannot be random wrt it.

Amadan Posts: 1337 Joined: Jan. 2007 (Permalink) Posted: May 19 2010,10:18    Quote (curiousgeorge @ May 19 2010,10:07) I would be interested in hearing the counter arguments to what he is saying rather than seeing people try to brush it off. Anyone care to do so? Hello Perry.  Good of you to join us. -------------- "People are always looking for natural selection to generate random mutations" - Densye  4-4-2011 JoeG BTW dumbass- some variations help ensure reproductive fitness so they cannot be random wrt it.

Venus Mousetrap Posts: 201 Joined: Aug. 2007 (Permalink) Posted: May 19 2010,10:20    Quote (curiousgeorge @ May 19 2010,10:07) I would be interested in hearing the counter arguments to what he is saying rather than seeing people try to brush it off. Anyone care to do so? Why don't you try? It's good practice.

Albatrossity2 Posts: 2780 Joined: Mar. 2007 (Permalink) Posted: May 19 2010,10:31    Quote (curiousgeorge @ May 19 2010,10:07) I would be interested in hearing the counter arguments to what he is saying rather than seeing people try to brush it off. Anyone care to do so? What is the "counter argument" to a prediction about the future? As far as I can tell, there are no arguments in anything quoted here, just predictions. But if you are interested in the history of success of those folks who predict the downfall of Darwinism, I'm sure someone here could oblige you. Suffice it to say that there is a long and glorious history of failed predictions there. -------------- Flesh of the sky, child of the sky, the mind Has been obligated from the beginning To create an ordered universe As the only possible proof of its own inheritance.                         - Pattiann Rogers

midwifetoad Posts: 4003 Joined: Mar. 2008 (Permalink) Posted: May 19 2010,12:07    They've already got the 3-5 scientists: Behe, Dembski, Gish, Hunter, Marks. What more could you ask for? -------------- Any version of ID consistent with all the evidence is indistinguishable from evolution.

ppb Posts: 325 Joined: Dec. 2006 (Permalink) Posted: May 19 2010,14:32    Quote (curiousgeorge @ May 19 2010,11:07) I would be interested in hearing the counter arguments to what he is saying rather than seeing people try to brush it off. Anyone care to do so? He says "In fact the evolutionary paradigm I’m about to share with you was first proposed more than 60 years ago. It was an object of derision and ridicule until it won the Nobel Prize for Science in 1983." There is no Nobel Prize for "Science". ETA:  Maybe he meant Barbara McClintock, for her work on horizontal gene transfer.   If her work was ridiculed, why was she given the Nobel Prize in Physiology or Medicine? -------------- "[A scientific theory] describes Nature as absurd from the point of view of common sense. And it agrees fully with experiment. So I hope you can accept Nature as She is - absurd." - Richard P. Feynman

curiousgeorge Posts: 2 Joined: May 2010 (Permalink) Posted: May 19 2010,18:03    So no serious responses as of yet...

ppb Posts: 325 Joined: Dec. 2006 (Permalink) Posted: May 19 2010,18:10    Quote (curiousgeorge @ May 19 2010,19:03) So no serious responses as of yet... The website doesn't give us much to comment on without subscribing.  Perhaps you could post something of substance from there and we can respond to it. My earlier post addressed some misinformation from the web site.  Care to respond to that? -------------- "[A scientific theory] describes Nature as absurd from the point of view of common sense. And it agrees fully with experiment. So I hope you can accept Nature as She is - absurd." - Richard P. Feynman

Cubist Posts: 551 Joined: Oct. 2007 (Permalink) Posted: May 19 2010,18:25    Quote (curiousgeorge @ May 19 2010,18:03) So no serious responses as of yet... There's a very appropriate quote from Thomas Jefferson: "Ridicule is the only weapon which can be used against unintelligible propositions. Ideas must be distinct before reason can act upon them..." The proposition you're asking us to provide serious responses to is, itself, unintelligible. The author of the quote you're referring to asserts that nonliving things cannot create "information"; what does he mean by "information"? If his definition of "information" includes any clause to the effect that information absolutely must come from a living/intelligent source, then sure, by definition rocks cannot create "information" in the sense that guy means it. Wonderful! All he has to do is demonstrate that his personal definition of "information" has any bearing on the RealWorld, and he's got something. Also, if the author of that quote doesn't know how to measure information, it follows that he can't even tell if rocks can create information. So perhaps the author of that quote might want to visit the So You Think ID Has Substance? thread and take the third challenge, the one about determining which of two different nucleotide sequences has more information in it? Or, if the author of that quote is unavailable for whatever reason, how about you do that, Curious George?

nmgirl Posts: 92 Joined: Sep. 2009 (Permalink) Posted: May 19 2010,18:35    Quote (J-Dog @ May 19 2010,09:32) HaHa, he's wrong, the jokes on him!  Darwin won't be proved wrong in 2013 - the Mayan's have already decided that the world ends in 2012, and it says so right on the TV*.   *Telly for all you Brit fans out there. i was trying to figure out why 2013 and then I realized: that is when the rethuglicans take over the world again.

Kristine Posts: 3061 Joined: Sep. 2006 (Permalink) Posted: May 19 2010,19:50    Quote (J-Dog @ May 19 2010,09:32) HaHa, he's wrong, the jokes on him!  Darwin won't be proved wrong in 2013 - the Mayan's have already decided that the world ends in 2012, and it says so right on the TV*.   *Telly for all you Brit fans out there. Gee, J-Dog, does that mean that evolution will not die in 2016 after all? Because I've been worried...evolution has not been watching his diet lately...wouldn't want it to have a heart attack on April 1, 2016 or something. -------------- Which came first: the shimmy, or the hip? AtBC Poet Laureate "I happen to think that this prerequisite criterion of empirical evidence is itself not empirical." - Clive "Damn you. This means a trip to the library. Again." -- fnxtr

Timothy McDougald Posts: 1036 Joined: Dec. 2006 (Permalink) Posted: May 19 2010,22:11    I have only received the one email...it's been almost 24 hours since the last one. I am very disappointed. -------------- Church burning ebola boy FTK: I Didn't answer your questions because it beats the hell out of me. PaV: I suppose for me to be pried away from what I do to focus long and hard on that particular problem would take, quite honestly, hundreds of thousands of dollars to begin to pique my interest.

Venus Mousetrap Posts: 201 Joined: Aug. 2007 (Permalink) Posted: May 20 2010,09:27    Quote (curiousgeorge @ May 19 2010,18:03) So no serious responses as of yet... I'll have a go, then. This is 'the atheist's riddle'. Quote Gentlemen: The starting point of this discussion is my central thesis, which is: 1) DNA is not merely a molecule with a pattern; it is a code, a language, and an information storage mechanism. 2) All codes are created by a conscious mind; there is no natural process known to science that creates coded information. 3) Therefore DNA was designed by a mind. If you can provide an empirical example of a code or language that occurs naturally, you've toppled my proof. All you need is one. Perry Marshall I offer the following counter: a) All minds are ultimately the result of DNA, since it tells the body how to form, and there are no known non-biological minds. b) Following from point 3, this means that DNA was designed by a mind which was formed from DNA, which was also designed by a mind, in an infinite chain of causality. c) Since the universe has existed for a finite time, this cannot be the case. Therefore either point 3 is false, or there exist minds which are not biological - something science has never observed. d) Therefore, DNA was not designed by a mind. If you can provide an empirical example of a non-biological mind, you've toppled my counter.

oldmanintheskydidntdoit Posts: 4999 Joined: July 2006 (Permalink) Posted: May 20 2010,10:58    curiousgeorge     Quote 1) DNA is not merely a molecule with a pattern; it is a code, a language, and an information storage mechanism. One of the attributes that language possesses is that it can be translated into other languages. Please translate this   Quote ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCC CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGC Into a different language. German perhaps? Note, google translate will not help you here. If you cannot translate it, is it really a "language"? Perhaps language is not quite the right word then? If, of course, you cannot translate it. -------------- I also mentioned that He'd have to give me a thorough explanation as to *why* I must "eat human babies". FTK if there are even critical flaws in Gauger’s work, the evo mat narrative cannot stand Gordon Mullings

Kristine Posts: 3061 Joined: Sep. 2006 (Permalink) Posted: May 20 2010,11:43    I am continually amazed at how IDers refer to "information" as if it were knowledge, wisdom, or foresight. Information happens all the time; it does not take a mind to create it, whereas human-generated information does take a mind to organize it, otherwise it turns into Borges' Library of Babel - which is where ID is going. After all, ID seems to be building no taxonomy. They're just throwing out a bunch of top-level terms to see if something sticks. -------------- Which came first: the shimmy, or the hip? AtBC Poet Laureate "I happen to think that this prerequisite criterion of empirical evidence is itself not empirical." - Clive "Damn you. This means a trip to the library. Again." -- fnxtr

Kristine Posts: 3061 Joined: Sep. 2006 (Permalink) Posted: May 20 2010,12:07    Quote (Venus Mousetrap @ May 20 2010,09:27)   Quote (curiousgeorge @ May 19 2010,18:03) So no serious responses as of yet... I'll have a go, then. This is 'the atheist's riddle'.     Quote Gentlemen: The starting point of this discussion is my central thesis, which is: 1) DNA is not merely a molecule with a pattern; it is a code, a language, and an information storage mechanism. 2) All codes are created by a conscious mind; there is no natural process known to science that creates coded information. 3) Therefore DNA was designed by a mind. If you can provide an empirical example of a code or language that occurs naturally, you've toppled my proof. All you need is one. Perry Marshall I offer the following counter: a) All minds are ultimately the result of DNA, since it tells the body how to form, and there are no known non-biological minds. b) Following from point 3, this means that DNA was designed by a mind which was formed from DNA, which was also designed by a mind, in an infinite chain of causality. c) Since the universe has existed for a finite time, this cannot be the case. Therefore either point 3 is false, or there exist minds which are not biological - something science has never observed. d) Therefore, DNA was not designed by a mind. If you can provide an empirical example of a non-biological mind, you've toppled my counter. It should also be remembered that, whenever IDists or scientists refer to a biological entity as a machine, code, robot, module, etc. that these are at best analogies. Just because I observe that the sky is "blue" does not mean that the sky is actually paint pigment. We humans created words to describe our human social activities first, not the cosmos (and not our subjective states of mind). Quarks are not really "charmed" or "strange," or up or down; the "big bang" was not a "bang" (the phrase was intended as a pejorative); even "species" is a convenience because, remember, species are mutable. As I wrote in my paper, it is tremendously difficult for us to mentally grasp the natural world, since we see ourselves as artificial and separate from it. Christians refer to Christ as the "lamb of God," but if I were to argue that therefore Jesus literally was an Ovis aries, that would be pretty deceptive, wouldn't it? -------------- Which came first: the shimmy, or the hip? AtBC Poet Laureate "I happen to think that this prerequisite criterion of empirical evidence is itself not empirical." - Clive "Damn you. This means a trip to the library. Again." -- fnxtr

JLT Posts: 740 Joined: Jan. 2008 (Permalink) Posted: May 20 2010,15:25    Quote (Venus Mousetrap @ May 20 2010,15:27)     Quote (curiousgeorge @ May 19 2010,18:03) So no serious responses as of yet... I'll have a go, then. This is 'the atheist's riddle'.       Quote Gentlemen: The starting point of this discussion is my central thesis, which is: 1) DNA is not merely a molecule with a pattern; it is a code, a language, and an information storage mechanism. 2) All codes are created by a conscious mind; there is no natural process known to science that creates coded information. 3) Therefore DNA was designed by a mind. If you can provide an empirical example of a code or language that occurs naturally, you've toppled my proof. All you need is one. Perry Marshall I offer the following counter: a) All minds are ultimately the result of DNA, since it tells the body how to form, and there are no known non-biological minds. b) Following from point 3, this means that DNA was designed by a mind which was formed from DNA, which was also designed by a mind, in an infinite chain of causality. c) Since the universe has existed for a finite time, this cannot be the case. Therefore either point 3 is false, or there exist minds which are not biological - something science has never observed. d) Therefore, DNA was not designed by a mind. If you can provide an empirical example of a non-biological mind, you've toppled my counter. Me, too! I don't agree that DNA is a code in the same sense that we use for man made codes, but that doesn't really matter. Marshall's argument fails anyway. Two possibilities: a) DNA had a natural origin or b) DNA was designed If a) is true, then not all codes are designed and Marshall's 2) doesn't apply. Only if b) was true Marshall's point 2) stands - which means that Marshall's taken as premise what he wants to prove. Logic is a wonderful thing but doesn't always beat actual thought. -------------- "Random mutations, if they are truly random, will affect, and potentially damage, any aspect of the organism, [...] Thus, a realistic [computer] simulation [of evolution] would allow the program, OS, and hardware to be affected in a random fashion." GilDodgen, Frilly shirt owner

Quack Posts: 1961 Joined: May 2007 (Permalink) Posted: May 20 2010,16:16    Quote As I wrote in my paper, it is tremendously difficult for us to mentally grasp the natural world, since we see ourselves as artificial and separate from it. Part of the problem may be that our brains weren't made for mentally grasping anything. I suspect my brain was made just to help me survive and 'multiply'. Which I've done. Another problem may be that the world really isn't really (fully) mentally graspable. -------------- Rocks have no biology.               Robert Byers.

Timothy McDougald Posts: 1036 Joined: Dec. 2006 (Permalink) Posted: May 20 2010,19:40    Low and behold another email. This one full of gross mischaracterizations of natural selection - and an insulting account of "cavemen" to boot: Quote Darwin was definitely right about natural selection. To be fair, being right about that is no Nobel Prize winning accomplishment. The weaklings die and the strong survive. I think our cave man ancestors were familiar with that one. (Rog hits Grog over the head with a rock and kills him, then they both get eaten by a hungry tiger. Survival of the fittest... nothing profound about that.) Seriously, natural selection does not have any kind of creative power at all. All it does is kill of the runts. The secret to evolution, then, has to be in the "random variation" part. Darwin, in his time, believed that random variation in heredity produced all manner of species. He said: most of the time it's harmful, but occasionally it's helpful and from these variations come all kinds of beautiful forms that appear to be designed. So, my first serious criticism is that Perry has totally misunderstood the nature of selection which comes in a wide variety of types. There is stabilizing selection, disruptive selection, directional selection (positive and negative), differential types such as frequency dependent selection. Each of which as a different effect on the genome. To reduce these to the above characterization is a gross simplification of the phenomena. Then we get: Quote What is meant by "random variation"? Thousands of biology books say it's accidental copying errors in DNA. They say, essentially, that it's corrupted data that occasionally turns out to be beneficial instead of harmful. This is where Darwin and the biology books are wrong. As a communication engineer I know - with 100.000000000% certainty - that this is impossible. Nowhere in the vast field of engineering is there any such thing as "the percentage of the time that corrupted data is helpful instead of harmful." It's ALWAYS harmful. Always. Copying errors and data transmission errors never help the signal. They only hurt it. Mutations have a wide variety of causes and effects and to reduce them to copy errors only is quite misleading - it may play well with folks who know nothing about biology but folks who do might consider such oversimplifications to be misleading. I would also argue, like several others above, that the asserted analogy between data/information and genes is not sufficiently strong enough to carry the weight of the argument being made. The analogy is asserted but there is actual proof to back up the asserted equivalency. -------------- Church burning ebola boy FTK: I Didn't answer your questions because it beats the hell out of me. PaV: I suppose for me to be pried away from what I do to focus long and hard on that particular problem would take, quite honestly, hundreds of thousands of dollars to begin to pique my interest.

Kristine Posts: 3061 Joined: Sep. 2006 (Permalink) Posted: May 20 2010,20:08    Quote (afarensis @ May 20 2010,19:40) Low and behold another email. This one full of gross mischaracterizations of natural selection - and an insulting account of "cavemen" to boot:     Quote Darwin was definitely right about natural selection. To be fair, being right about that is no Nobel Prize winning accomplishment. The weaklings die and the strong survive. I think our cave man ancestors were familiar with that one. (Rog hits Grog over the head with a rock and kills him, then they both get eaten by a hungry tiger. Survival of the fittest... nothing profound about that.) Seriously, natural selection does not have any kind of creative power at all. All it does is kill of the runts. *Headdesk* So, to use their own comic book version, whose child went and hunted the tiger - Roc or Groc's? Because which one of them had children? And which one was the swingin' bachelor back at the cave? They always forget - everything dies. Natural selection kills everything. It isn't "death" that is the essential factor, it's differential reproduction. And being "fit" in this cartoonish caricature has nothing to do with happiness. A lot of animals never reproduce, and they're not walking around with long faces, thinking "I'm stupid and weak, and my genes will never be passed on." As long as your sibling reproduces, you essentially do; once again creationists have no clue what long time spans we are talking about when we are talking about adaptations. Arg! -------------- Which came first: the shimmy, or the hip? AtBC Poet Laureate "I happen to think that this prerequisite criterion of empirical evidence is itself not empirical." - Clive "Damn you. This means a trip to the library. Again." -- fnxtr

Timothy McDougald Posts: 1036 Joined: Dec. 2006 (Permalink) Posted: May 20 2010,20:49    Quote (Kristine @ May 20 2010,20:08) Quote (afarensis @ May 20 2010,19:40) Low and behold another email. This one full of gross mischaracterizations of natural selection - and an insulting account of "cavemen" to boot:     Quote Darwin was definitely right about natural selection. To be fair, being right about that is no Nobel Prize winning accomplishment. The weaklings die and the strong survive. I think our cave man ancestors were familiar with that one. (Rog hits Grog over the head with a rock and kills him, then they both get eaten by a hungry tiger. Survival of the fittest... nothing profound about that.) Seriously, natural selection does not have any kind of creative power at all. All it does is kill of the runts. *Headdesk* So, to use their own comic book version, whose child went and hunted the tiger - Roc or Groc's? Because which one of them had children? And which one was the swingin' bachelor back at the cave? They always forget - everything dies. Natural selection kills everything. It isn't "death" that is the essential factor, it's differential reproduction. And being "fit" in this cartoonish caricature has nothing to do with happiness. A lot of animals never reproduce, and they're not walking around with long faces, thinking "I'm stupid and weak, and my genes will never be passed on." As long as your sibling reproduces, you essentially do; once again creationists have no clue what long time spans we are talking about when we are talking about adaptations. Arg! I think creationism - of any stripe - can be summed up in the phrase "I can haz equivocation?" -------------- Church burning ebola boy FTK: I Didn't answer your questions because it beats the hell out of me. PaV: I suppose for me to be pried away from what I do to focus long and hard on that particular problem would take, quite honestly, hundreds of thousands of dollars to begin to pique my interest.

sledgehammer Posts: 533 Joined: Sep. 2008 (Permalink) Posted: May 20 2010,22:08    Quote Nowhere in the vast field of engineering is there any such thing as "the percentage of the time that corrupted data is helpful instead of harmful." It's ALWAYS harmful. Always. Copying errors and data transmission errors never help the signal. They only hurt it. BZZZT! Wrong. Random noise added to a signal before digitization by an Analog-to-Digital Converter actually improves the resolution of the resulting digital representation by "dithering" the quantization levels. That's just engineering.  In physics, thermal noise can prevent a system from getting stuck in a local minimum (potential well) and significantly affect the outcome of a process by allowing it to sample a wider range of possible states. -------------- The majority of the stupid is invincible and guaranteed for all time. The terror of their tyranny is alleviated by their lack of consistency. -A. Einstein  (H/T, JAD) If evolution is true, you could not know that it's true because your brain is nothing but chemicals. ?Think about that. -K. Hovind

Henry J Posts: 5760 Joined: Mar. 2005 (Permalink) Posted: May 22 2010,01:18    It appears to me that calling a genome a "signal" is a misleading analogy. When a deliberately sent signal is vital to some goal, then degrading of that signal is harmful. But a genome isn't a deliberate signal, and there isn't a goal that depends on 100% accuracy of its transmission, especially not to all of a large number of descendants. Henry

Timothy McDougald Posts: 1036 Joined: Dec. 2006 (Permalink) Posted: May 22 2010,07:47    Wohoo! Another email. This one tries to apply the work of Barbara McClintock: Quote DNA generates new adaptations the exact same way. It obeys the rules of grammar.  It actually re-arranges itself like a computer program that rewrites itself on the fly. Now here's the kicker: This is not new. And it's not even theory. It's fact. It's actually more than 60 years old. It's only new to those who are hearing it for the first time. It was discovered by biologist Barbara McClintock in 1944. She was decades ahead of her time and she received the Nobel Prize for this discovery in 1983. Her picture is now on a U.S. Postage Stamp and she's one of the greatest scientists in the history of biology. Her discoveries were so radical, so contrary to Darwin, that for 20 years she mostly kept this to herself. Some historians think that she was afraid of being cast out by the existing orthodoxy of the time. But even now, people ask me, "Why didn't they ever teach this to me in biology class?" Good question. I'll just say, it's not because her findings haven't been verified. And it's also not because the "random mutation" model works. It actually doesn't. I've been debating this online for 5 years and I have yet to have one person send me a link or refer to a book that says, "Here is the actual experiment that proves random mutations drive evolution." Combined with the work of James Shapiro (also see this). -------------- Church burning ebola boy FTK: I Didn't answer your questions because it beats the hell out of me. PaV: I suppose for me to be pried away from what I do to focus long and hard on that particular problem would take, quite honestly, hundreds of thousands of dollars to begin to pique my interest.

Quack Posts: 1961 Joined: May 2007 (Permalink) Posted: May 22 2010,10:20    Quote (sledgehammer @ May 20 2010,22:08)   Quote Nowhere in the vast field of engineering is there any such thing as "the percentage of the time that corrupted data is helpful instead of harmful." It's ALWAYS harmful. Always. Copying errors and data transmission errors never help the signal. They only hurt it. BZZZT! Wrong. Random noise added to a signal before digitization by an Analog-to-Digital Converter actually improves the resolution of the resulting digital representation by "dithering" the quantization levels. That's just engineering.  In physics, thermal noise can prevent a system from getting stuck in a local minimum (potential well) and significantly affect the outcome of a process by allowing it to sample a wider range of possible states. That was news to me. Very interesting. I presume being relevant for physics, it is relevant for chemistry too - and maybe for genetics in ways not encouraging for creationists? Just speculating. -------------- Rocks have no biology.               Robert Byers.

Schroedinger's Dog Posts: 1692 Joined: Jan. 2009 (Permalink) Posted: May 22 2010,11:15    Quote (Quack @ May 22 2010,16:20) Quote (sledgehammer @ May 20 2010,22:08)   Quote Nowhere in the vast field of engineering is there any such thing as "the percentage of the time that corrupted data is helpful instead of harmful." It's ALWAYS harmful. Always. Copying errors and data transmission errors never help the signal. They only hurt it. BZZZT! Wrong. Random noise added to a signal before digitization by an Analog-to-Digital Converter actually improves the resolution of the resulting digital representation by "dithering" the quantization levels. That's just engineering.  In physics, thermal noise can prevent a system from getting stuck in a local minimum (potential well) and significantly affect the outcome of a process by allowing it to sample a wider range of possible states. That was news to me. Very interesting. I presume being relevant for physics, it is relevant for chemistry too - and maybe for genetics in ways not encouraging for creationists? Just speculating. It is also relevant in audio productions. Most studios now make their takes in 24 bits/48000hz, or more, then have to process everything down to 16 bits/24000hz for commercial audio cd production. In doing so, we usually run through a series of dithering/anti-dithering processes. this is most notably due to the fact that a modern production chain will quite often be numeric and yet start from a digital workbench. The alteration of audio signals is not something I could detail with 100% expertise, but adding white noise before a frequency shrinking can actually smooth the conversion... -------------- "Hail is made out of water? Are you really that stupid?" Joe G "I have a better suggestion, Kris. How about a game of hide and go fuck yourself instead." Louis "The reason people use a crucifix against vampires is that vampires are allergic to bullshit" Richard Pryor

qetzal Posts: 311 Joined: Feb. 2006 (Permalink) Posted: May 22 2010,12:21    Quote As a communication engineer I know - with 100.000000000% certainty - that this is impossible. Nowhere in the vast field of engineering is there any such thing as "the percentage of the time that corrupted data is helpful instead of harmful." It's ALWAYS harmful. Always. Copying errors and data transmission errors never help the signal. They only hurt it. Excellent disproof by sledgehammer. But empirical disproofs aren't even needed. This is simply logically false. The only way that modifying data can ALWAYS be harmful is if you assume the data starts out PERFECT. But as any competent engineer knows, data is rarely (if ever) perfect. Of course, we know what kind of person assumes that all organisms were initially created perfect.

Henry J Posts: 5760 Joined: Mar. 2005 (Permalink) Posted: May 22 2010,12:34    Quote Quote And it's also not because the "random mutation" model works. It actually doesn't. I've been debating this online for 5 years and I have yet to have one person send me a link or refer to a book that says, "Here is the actual experiment that proves random mutations drive evolution." The experiment? The experiment? Try over a century of research by tens (or is it hundreds?) of thousands of researchers looking for contradictions and not finding them, in spite of there being plenty of places where contrary evidence would be expected if theory were wrong. Or am I missing the point? Henry

Reed Posts: 274 Joined: Feb. 2008 (Permalink) Posted: May 22 2010,15:51    Quote (Henry J @ May 21 2010,23:18) It appears to me that calling a genome a "signal" is a misleading analogy. When a deliberately sent signal is vital to some goal, then degrading of that signal is harmful. But a genome isn't a deliberate signal, and there isn't a goal that depends on 100% accuracy of its transmission, especially not to all of a large number of descendants. Henry Agreed, the whole analogy is bogus. It seems to me it's largely based on a failure to understand how messy and plastic biology is, in contrast to things that are actually designed. A bit ironic coming from people who claim to be experts in "design detection". ID proponents like to go on about how genomes are "code", but unlike real, designed computer code, we observe that flipping a few bits frequently has no noticeable effect, and when it does have an effect, the resulting function is frequently similar to the original. Signals that are actually designed don't work like that, because they had designers who had specific goals and were concerned about maximizing efficiency. It's worth emphasizing that this is an observation, not a hypothetical argument. Blast a colony of bacteria with radiation, and if they don't all die, you'll get a lot of mutations, most neutral. Blast a computer with radiation, and eventually some bits will flip and the program will stop doing what it was designed to do. (aside, voyager 2 just experienced a radiation induced bit flip: http://www.jpl.nasa.gov/news/news.cfm?release=2010-151 )

fnxtr Posts: 3497 Joined: June 2006 (Permalink) Posted: May 22 2010,19:47    Quote (Schroedinger's Dog @ May 22 2010,09:15) (snip) It is also relevant in audio productions. Most studios now make their takes in 24 bits/48000hz, or more, then have to process everything down to 16 bits/24000hz for commercial audio cd production. In doing so, we usually run through a series of dithering/anti-dithering processes. this is most notably due to the fact that a modern production chain will quite often be numeric and yet start from a digital workbench. The alteration of audio signals is not something I could detail with 100% expertise, but adding white noise before a frequency shrinking can actually smooth the conversion... How are you on video, SD? I was in Future Shop today browsing their screens/monitors/TVs/whatever the hell they're called these days.  "I, Robot" on 2 different screens: one looked like film; one had that 2D, videotape look, like daytime soaps. Any idea why? also, I hope the healing is coming along with no complications. -------------- "[A] book said there were 5 trillion witnesses. Who am I supposed to believe, 5 trillion witnesses or you? That shit's, like, ironclad. " -- stevestory "Wow, you must be retarded. I said that CO2 does not trap heat. If it did then it would not cool down at night."  Joe G

Schroedinger's Dog Posts: 1692 Joined: Jan. 2009 (Permalink) Posted: May 23 2010,01:49    Quote (fnxtr @ May 23 2010,01:47) Quote (Schroedinger's Dog @ May 22 2010,09:15) (snip) It is also relevant in audio productions. Most studios now make their takes in 24 bits/48000hz, or more, then have to process everything down to 16 bits/24000hz for commercial audio cd production. In doing so, we usually run through a series of dithering/anti-dithering processes. this is most notably due to the fact that a modern production chain will quite often be numeric and yet start from a digital workbench. The alteration of audio signals is not something I could detail with 100% expertise, but adding white noise before a frequency shrinking can actually smooth the conversion... How are you on video, SD? I was in Future Shop today browsing their screens/monitors/TVs/whatever the hell they're called these days.  "I, Robot" on 2 different screens: one looked like film; one had that 2D, videotape look, like daytime soaps. Any idea why? also, I hope the healing is coming along with no complications. I look gorgeous on video, thanks for asking. The healing is going just fine, thanks. I'll only keep a slighlty redder area of skin, nothing a  beard-trimming can't hide...:) As for the video stuff, new flatscreens can double the standard frequency from 60hz to 120hz, in order to give a "smoother" image and movement. But I can't for the life of me figure out why they would do this. Personaly, I hate it and totally agree with you. Any movie you watch in 120hz looks like it's been filmed with a camcorder. -------------- "Hail is made out of water? Are you really that stupid?" Joe G "I have a better suggestion, Kris. How about a game of hide and go fuck yourself instead." Louis "The reason people use a crucifix against vampires is that vampires are allergic to bullshit" Richard Pryor

Quack Posts: 1961 Joined: May 2007 (Permalink) Posted: May 23 2010,02:43    Sorry guys, nitpicking maybe, but something happens inside of me when I read about hz - or other units. Hertz That's the way that I am, can't help it. -------------- Rocks have no biology.               Robert Byers.

midwifetoad Posts: 4003 Joined: Mar. 2008 (Permalink) Posted: May 23 2010,09:22    I used to wonder why special effects look cheesier on DVD movies than they did on the big screen. I've decided it is an artifact of scanning and sharpening of the image. It increases any contrast difference between background and the composited foreground elements. -------------- Any version of ID consistent with all the evidence is indistinguishable from evolution.

fnxtr Posts: 3497 Joined: June 2006 (Permalink) Posted: May 23 2010,11:18    Quote (Quack @ May 23 2010,00:43) Sorry guys, nitpicking maybe, but something happens inside of me when I read about hz - or other units. Hertz That's the way that I am, can't help it. Must have been a radioactivity-induced bit flip. 1101000 ->1001000 hz -> Hz. Happy now? edit: binary goof -------------- "[A] book said there were 5 trillion witnesses. Who am I supposed to believe, 5 trillion witnesses or you? That shit's, like, ironclad. " -- stevestory "Wow, you must be retarded. I said that CO2 does not trap heat. If it did then it would not cool down at night."  Joe G

fnxtr Posts: 3497 Joined: June 2006 (Permalink) Posted: May 23 2010,11:19    Quote (midwifetoad @ May 23 2010,07:22) I used to wonder why special effects look cheesier on DVD movies than they did on the big screen. I've decided it is an artifact of scanning and sharpening of the image. It increases any contrast difference between background and the composited foreground elements. It always looked like a depth-of-field issue to me.  On digital video everything is in focus at once.  Unlike real life. -------------- "[A] book said there were 5 trillion witnesses. Who am I supposed to believe, 5 trillion witnesses or you? That shit's, like, ironclad. " -- stevestory "Wow, you must be retarded. I said that CO2 does not trap heat. If it did then it would not cool down at night."  Joe G

midwifetoad Posts: 4003 Joined: Mar. 2008 (Permalink) Posted: May 23 2010,12:18    Doing a bit of Google on the subject, I see edge enhancement (digital sharpening) listed as a frequent flaw. This could make foreground objects stand out against matte painting or green screen backgrounds. -------------- Any version of ID consistent with all the evidence is indistinguishable from evolution.

Quack Posts: 1961 Joined: May 2007 (Permalink) Posted: May 23 2010,16:37    Quote (fnxtr @ May 23 2010,11:18)   Quote (Quack @ May 23 2010,00:43) Sorry guys, nitpicking maybe, but something happens inside of me when I read about hz - or other units. Hertz That's the way that I am, can't help it. Must have been a radioactivity-induced bit flip. 1101000 ->1001000 hz -> Hz. Happy now? edit: binary goof Happy as a lark... -------------- Rocks have no biology.               Robert Byers.

Henry J Posts: 5760 Joined: Mar. 2005 (Permalink) Posted: May 23 2010,22:25    hz -> Hz? Heinz Hertz?

fnxtr Posts: 3497 Joined: June 2006 (Permalink) Posted: May 24 2010,03:02    Quote (Henry J @ May 23 2010,20:25) hz -> Hz? Heinz Hertz? Only if it gets in your eye. -------------- "[A] book said there were 5 trillion witnesses. Who am I supposed to believe, 5 trillion witnesses or you? That shit's, like, ironclad. " -- stevestory "Wow, you must be retarded. I said that CO2 does not trap heat. If it did then it would not cool down at night."  Joe G

Schroedinger's Dog Posts: 1692 Joined: Jan. 2009 (Permalink) Posted: May 24 2010,04:45    Ok, my appologies for the cap mistake. won't Happen aGain, evER! -------------- "Hail is made out of water? Are you really that stupid?" Joe G "I have a better suggestion, Kris. How about a game of hide and go fuck yourself instead." Louis "The reason people use a crucifix against vampires is that vampires are allergic to bullshit" Richard Pryor

Quack Posts: 1961 Joined: May 2007 (Permalink) Posted: May 24 2010,06:15    Quote (Schroedinger's Dog @ May 24 2010,04:45) Ok, my appologies for the cap mistake. won't Happen aGain, evER! Coming from you, I really believe it! But seriously, such mistakes are easy to make but I am afraid I have an eye for typographical mistakes. According to Wikipedia, a mistake is an error. -------------- Rocks have no biology.               Robert Byers.

dogdidit Posts: 315 Joined: Mar. 2008 (Permalink) Posted: May 24 2010,08:28    Quote (Quack @ May 23 2010,02:43) Sorry guys, nitpicking maybe, but something happens inside of me when I read about hz - or other units. Hertz That's the way that I am, can't help it. Yup. Physical units named after individuals are spelled out in lower case, but capitalized in abbreviation. Thus: hertz -> Hz newton -> N watt -> W OTOH units not derived from names (proper nouns) are lower case wheter spelled out or abbreviated: foot -> ft meter/metre -> m Not entirely sure why, but dem's da rules. -------------- "Humans carry plants and animals all over the globe, thus introducing them to places they could never have reached on their own. That certainly increases biodiversity." - D'OL

fnxtr Posts: 3497 Joined: June 2006 (Permalink) Posted: May 24 2010,13:20    Quote (dogdidit @ May 24 2010,06:28) Quote (Quack @ May 23 2010,02:43) Sorry guys, nitpicking maybe, but something happens inside of me when I read about hz - or other units. Hertz That's the way that I am, can't help it. Yup. Physical units named after individuals are spelled out in lower case, but capitalized in abbreviation. Thus: hertz -> Hz newton -> N watt -> W OTOH units not derived from names (proper nouns) are lower case wheter spelled out or abbreviated: foot -> ft meter/metre -> m Not entirely sure why, but dem's da rules. then theres the multiplication prefixes.... re: edge sharpening. That would also explain why backgrounds come more into focus, giving the flat, direct-to-video appearance. Tangentially: I really hate digital cameras and wish they hadn't taken over so fast. That annoying shutter delay makes me want to give them all flying lessons, down by the sea. GRRR! -------------- "[A] book said there were 5 trillion witnesses. Who am I supposed to believe, 5 trillion witnesses or you? That shit's, like, ironclad. " -- stevestory "Wow, you must be retarded. I said that CO2 does not trap heat. If it did then it would not cool down at night."  Joe G

Bob O'H Posts: 2561 Joined: Oct. 2005 (Permalink) Posted: May 24 2010,14:10    I recently read a blog post talking about things that were a few nm out to sea. Eventually I worked out why I was so confused. -------------- It is fun to dip into the various threads to watch cluelessness at work in the hands of the confident exponent. - Soapy Sam (so say we all)

midwifetoad Posts: 4003 Joined: Mar. 2008 (Permalink) Posted: May 24 2010,15:11    Quote That annoying shutter delay makes me want to give them all flying lessons, down by the sea. GRRR! Most on cheaper cameras. The SLRs are as fast as film cameras and are rapidly closing in on detail and lattitude. I have a little Canon point and shoot that has no perceptable shutter delay. For high contrast situations, you can atobracket exposures and combine them into one image in Photoshop. You can have full detail in highlights and shadows with no compromise. -------------- Any version of ID consistent with all the evidence is indistinguishable from evolution.

Kristine Posts: 3061 Joined: Sep. 2006 (Permalink) Posted: May 24 2010,17:41    Quote (dogdidit @ May 24 2010,08:28)     Quote (Quack @ May 23 2010,02:43) Sorry guys, nitpicking maybe, but something happens inside of me when I read about hz - or other units. Hertz That's the way that I am, can't help it. Yup. Physical units named after individuals are spelled out in lower case, but capitalized in abbreviation. Thus: hertz -> Hz newton -> N watt -> W OTOH units not derived from names (proper nouns) are lower case wheter spelled out or abbreviated: foot -> ft meter/metre -> m Not entirely sure why, but dem's da rules. So, 01100010 01101001 01101110 01100001 01110010 01111001 00001101 00001010  or 01000010 01101001 01101110 01100001 01110010 01111001 00001101 00001010 ? -------------- Which came first: the shimmy, or the hip? AtBC Poet Laureate "I happen to think that this prerequisite criterion of empirical evidence is itself not empirical." - Clive "Damn you. This means a trip to the library. Again." -- fnxtr

Henry J Posts: 5760 Joined: Mar. 2005 (Permalink) Posted: May 24 2010,20:58    Quote So, 01100010 01101001 01101110 01100001 01110010 01111001 00001101 00001010??or 01000010 01101001 01101110 01100001 01110010 01111001 00001101 00001010 ? The first one sounds like a capital idea. Henry

Quack Posts: 1961 Joined: May 2007 (Permalink) Posted: May 25 2010,02:25    All I can say is µF or µH looks much better than µf or µh. ... ETA: For the uninitiated, microfarad or microhenry. -------------- Rocks have no biology.               Robert Byers.

midwifetoad Posts: 4003 Joined: Mar. 2008 (Permalink) Posted: May 25 2010,09:01    Quote browsing their screens/monitors/TVs/whatever the hell they're called these days.  "I, Robot" on 2 different screens: one looked like film; one had that 2D, videotape look, Display demos in retail stores are fed from a common source. Differences in appearance are often bogus, because there are so many possible settings for color balance, brightness and contrast. Sets are often set to an unnatural level of color saturation to get your attention from across the room. They could also be jiggered to direct sales to the most profitable models. -------------- Any version of ID consistent with all the evidence is indistinguishable from evolution.

Pages: (2) < [1] 2 >

Track this topic	Email this topic	Print this topic

© 2002-2009 Antievolution.org Powered by Ikonboard 3.0.2a © 2001 Ikonboard